miRTarBase - #MIRT524753 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BIRC5   
Synonyms API4, EPR-1
Description baculoviral IAP repeat containing 5
Transcript NM_001012271   
Other Transcripts NM_001012270 , NM_001168   
Expression
Putative miRNA Targets on BIRC5
3'UTR of BIRC5
(miRNA target sites are highlighted)
>BIRC5|NM_001012271|3'UTR
   1 GGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTG
  81 TGGGCCCCTTAGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTGTTTTGTCTTG
 161 AAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAACAGTGGCTGCTTCTCTCTCTCTCTCTCTTTT
 241 TTGGGGGCTCATTTTTGCTGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTG
 321 CTAGAGCTGACAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTGAGGCTGTCAC
 401 AGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTTCCTTATCTGTCACACCTGTGCCTCCTCAGA
 481 GGACAGTTTTTTTGTTGTTGTGTTTTTTTGTTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAG
 561 ACAGAGTCCCTGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAGAATAGCACAA
 641 ACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGGGGTGAACTTCAGGTGGATGAGGAGACAGAA
 721 TAGAGTGATAGGAAGCGTCTGGCAGATACTCCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCAC
 801 ATGCTGGCCGCTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTGGGGGACTG
 881 GCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTCACGTTCTCCACACGGGGGAGAGACGCAGTC
 961 CGCCCAGGTCCCCGCTTTCTTTGGAGGCAGCAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCC
1041 CTCCTCCCTGTCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGGCTGTTCCTGA
1121 GAAATAAAAAGCCTGTCATTTCAAACACTGCTGTGGACCCTACTGGGTTTTTAAAATATTGTCAGTTTTTCATCGTCGTC
1201 CCTAGCCTGCCAACAGCCATCTGCCCAGACAGCCGCAGTGAGGATGAGCGTCCTGGCAGAGACGCAGTTGTCTCTGGGCG
1281 CTTGCCAGAGCCACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAG
1361 ACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTT
1441 GTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATA
1521 CTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGC
1601 ATGCCAGGCGGTGATGTGGATCTCGGCTTCTGTGAGCCTGTGCTGTGGGCAGGGCTGAGCTGGAGCCGCCCCTCTCAGCC
1681 CGCCTGCCACGGCCTTTCCTTAAAGGCCATCCTTAAAACCAGACCCTCATGGCTACCAGCACCTGAAAGCTTCCTCGACA
1761 TCTGTTAATAAAGCCGTAGGCCCTTGTCTAAGTGCAACCGCCTAGACTTTCTTTCAGATACATGTCCACATGTCCATTTT
1841 TCAGGTTCTCTAAGTTGGAGTGGAGTCTGGGAAGGGTTGTGAATGAGGCTTCTGGGCTATGGGTGAGGTTCCAATGGCAG
1921 GTTAGAGCCCCTCGGGCCAACTGCCATCCTGGAAAGTAGAGACAGCAGTGCCCGCTGCCCAGAAGAGACCAGCAAGCCAA
2001 ACTGGAGCCCCCATTGCAGGCTGTCGCCATGTGGAAAGAGTAACTCACAATTGCCAATAAAGTCTCATGTGGTTTTATCT
2081 AAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG--UGUGAGGu 5'
            |:|::|  || |  |:||||| 
Target 5' gaAGCGTC--TGGCAGATACTCCt 3'
732 - 753 134.00 -13.20
2
miRNA  3' guuugugguaACAGUGUGAGGu 5'
                    ||||||| ||| 
Target 5' ttgttgaggcTGTCACAGTCCt 3'
385 - 406 128.00 -13.70
3
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ::|||||| 
Target 5' tgttagcagaaaaTGCACTCCa 3'
1440 - 1461 125.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7457208 3 COSMIC
COSM7954829 11 COSMIC
COSM5646702 30 COSMIC
COSM8035166 48 COSMIC
COSM985068 59 COSMIC
COSM7946875 78 COSMIC
COSM8807253 84 COSMIC
COSM5524330 99 COSMIC
COSM1589261 100 COSMIC
COSN228482 106 COSMIC
COSM8466621 145 COSMIC
COSM8277992 146 COSMIC
COSM3820768 149 COSMIC
COSM5713323 150 COSMIC
COSM1610893 160 COSMIC
COSM1480111 237 COSMIC
COSM7693061 237 COSMIC
COSM9368754 314 COSMIC
COSM9404272 316 COSMIC
COSM9384980 325 COSMIC
COSN20114489 500 COSMIC
COSN20114491 500 COSMIC
COSN17474715 511 COSMIC
COSN18783147 511 COSMIC
COSN20114492 511 COSMIC
COSN15657350 512 COSMIC
COSN15657316 522 COSMIC
COSN15657326 523 COSMIC
COSN15657381 524 COSMIC
COSN17363415 689 COSMIC
COSM5794977 890 COSMIC
COSM5783275 945 COSMIC
COSM9478746 949 COSMIC
COSM9478743 955 COSMIC
COSM9370572 980 COSMIC
COSM9478745 1019 COSMIC
COSM9478744 1021 COSMIC
COSN4770657 1935 COSMIC
COSN9323436 2047 COSMIC
COSN29509441 2064 COSMIC
rs17879146 311 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760508738 3 dbSNP
rs1188637224 5 dbSNP
rs112471026 12 dbSNP
rs776613516 13 dbSNP
rs1217843298 17 dbSNP
rs1170140374 19 dbSNP
rs761747371 20 dbSNP
rs370922732 23 dbSNP
rs1310191201 28 dbSNP
rs561843820 29 dbSNP
rs749926799 38 dbSNP
rs1377462147 39 dbSNP
rs1396792895 41 dbSNP
rs758031351 44 dbSNP
rs373086357 47 dbSNP
rs17885521 51 dbSNP
rs1225238355 52 dbSNP
rs377394472 53 dbSNP
rs778286403 58 dbSNP
rs749753633 59 dbSNP
rs757860515 69 dbSNP
rs779009224 71 dbSNP
rs1329079217 83 dbSNP
rs745971364 84 dbSNP
rs772312741 85 dbSNP
rs1261549356 87 dbSNP
rs754622241 92 dbSNP
rs140169554 97 dbSNP
rs1359636644 98 dbSNP
rs957467589 101 dbSNP
rs17882627 105 dbSNP
rs762868101 110 dbSNP
rs761692199 112 dbSNP
rs1178792701 116 dbSNP
rs765120054 118 dbSNP
rs780850257 119 dbSNP
rs938705528 120 dbSNP
rs1158208097 122 dbSNP
rs1383978350 132 dbSNP
rs747777761 134 dbSNP
rs772749498 140 dbSNP
rs1365793433 142 dbSNP
rs188097548 143 dbSNP
rs922951036 146 dbSNP
rs1491029952 148 dbSNP
rs796491719 148 dbSNP
rs2239680 149 dbSNP
rs17882139 150 dbSNP
rs766041929 151 dbSNP
rs779690492 161 dbSNP
rs751323998 163 dbSNP
rs1349009382 168 dbSNP
rs754690546 177 dbSNP
rs898021487 189 dbSNP
rs1269128376 195 dbSNP
rs1468464730 196 dbSNP
rs1192294254 204 dbSNP
rs929468494 206 dbSNP
rs1051500460 209 dbSNP
rs1047418031 215 dbSNP
rs1302130941 220 dbSNP
rs369792774 221 dbSNP
rs747343335 221 dbSNP
rs777250034 221 dbSNP
rs1181381107 225 dbSNP
rs1418616207 227 dbSNP
rs772563554 227 dbSNP
rs1402486381 237 dbSNP
rs775748394 237 dbSNP
rs1166545623 239 dbSNP
rs908991160 242 dbSNP
rs893733975 243 dbSNP
rs1255911482 249 dbSNP
rs764503657 251 dbSNP
rs1489571172 257 dbSNP
rs1264595539 258 dbSNP
rs1389077757 260 dbSNP
rs1460912743 262 dbSNP
rs1215952195 270 dbSNP
rs1487385286 271 dbSNP
rs1021280400 272 dbSNP
rs941788563 279 dbSNP
rs138133959 280 dbSNP
rs1369113856 307 dbSNP
rs894613464 309 dbSNP
rs17879146 311 dbSNP
rs1305885915 315 dbSNP
rs566341645 318 dbSNP
rs1263990577 321 dbSNP
rs1342268485 324 dbSNP
rs1298775643 334 dbSNP
rs907451552 336 dbSNP
rs1035781513 338 dbSNP
rs1229825411 342 dbSNP
rs779336150 343 dbSNP
rs141087478 344 dbSNP
rs17878866 345 dbSNP
rs957687466 347 dbSNP
rs1479032435 366 dbSNP
rs1424969797 368 dbSNP
rs1193643199 380 dbSNP
rs915935753 383 dbSNP
rs1267694783 388 dbSNP
rs942011585 393 dbSNP
rs1220429661 403 dbSNP
rs1488862514 410 dbSNP
rs1011628017 412 dbSNP
rs186338705 413 dbSNP
rs1211555877 418 dbSNP
rs767165758 424 dbSNP
rs1476573615 425 dbSNP
rs1462871485 427 dbSNP
rs975895755 431 dbSNP
rs923214582 436 dbSNP
rs1337720806 445 dbSNP
rs1302798928 452 dbSNP
rs758470732 455 dbSNP
rs761048454 456 dbSNP
rs929478243 457 dbSNP
rs1474723071 460 dbSNP
rs1389532811 465 dbSNP
rs376324020 478 dbSNP
rs890217127 484 dbSNP
rs1170511077 486 dbSNP
rs1379396279 487 dbSNP
rs943100716 487 dbSNP
rs1199647126 488 dbSNP
rs146639575 492 dbSNP
rs776926567 492 dbSNP
rs779662046 492 dbSNP
rs1039176345 493 dbSNP
rs1180758313 494 dbSNP
rs557239445 495 dbSNP
rs1195982280 496 dbSNP
rs1197876785 496 dbSNP
rs1026352482 498 dbSNP
rs202011142 498 dbSNP
rs373960358 498 dbSNP
rs765424568 498 dbSNP
rs777401870 498 dbSNP
rs1160162513 499 dbSNP
rs879016634 499 dbSNP
rs199602253 500 dbSNP
rs1331127756 501 dbSNP
rs1378063549 501 dbSNP
rs200361238 501 dbSNP
rs1344830533 502 dbSNP
rs1173743256 503 dbSNP
rs1464438782 503 dbSNP
rs201472247 503 dbSNP
rs1328367514 504 dbSNP
rs1372095400 505 dbSNP
rs1376001610 505 dbSNP
rs1180700793 506 dbSNP
rs1440857023 507 dbSNP
rs796286916 508 dbSNP
rs1491356209 509 dbSNP
rs1224934902 510 dbSNP
rs1491093036 510 dbSNP
rs571445307 511 dbSNP
rs77903511 511 dbSNP
rs893503724 511 dbSNP
rs1241810450 512 dbSNP
rs1353947412 514 dbSNP
rs1308132069 518 dbSNP
rs113519837 522 dbSNP
rs1307344349 524 dbSNP
rs1328033811 525 dbSNP
rs1206374002 528 dbSNP
rs1020912698 534 dbSNP
rs1274849133 539 dbSNP
rs902394767 545 dbSNP
rs1400095350 556 dbSNP
rs1160508030 563 dbSNP
rs1042489 572 dbSNP
rs1379911844 580 dbSNP
rs1157140141 583 dbSNP
rs564831547 588 dbSNP
rs144790144 591 dbSNP
rs755735160 594 dbSNP
rs1369986996 630 dbSNP
rs990560274 631 dbSNP
rs1441795932 641 dbSNP
rs1255382125 648 dbSNP
rs1212377071 676 dbSNP
rs779690467 677 dbSNP
rs1488370927 680 dbSNP
rs1284852327 683 dbSNP
rs748880179 689 dbSNP
rs1013030310 690 dbSNP
rs777306171 693 dbSNP
rs758812176 698 dbSNP
rs1045868477 701 dbSNP
rs1300660150 706 dbSNP
rs1400674329 709 dbSNP
rs1167313413 717 dbSNP
rs963449326 717 dbSNP
rs1407330006 718 dbSNP
rs907503797 722 dbSNP
rs1163602155 728 dbSNP
rs138703176 737 dbSNP
rs1415578401 738 dbSNP
rs1405114121 743 dbSNP
rs1477829272 746 dbSNP
rs1261874635 751 dbSNP
rs542205905 753 dbSNP
rs1053538596 755 dbSNP
rs1213151279 757 dbSNP
rs893108510 761 dbSNP
rs762447826 783 dbSNP
rs1012093533 785 dbSNP
rs919517164 792 dbSNP
rs1356782403 793 dbSNP
rs79824097 794 dbSNP
rs900576494 795 dbSNP
rs997387693 798 dbSNP
rs1349263111 801 dbSNP
rs1268517653 809 dbSNP
rs191250920 810 dbSNP
rs1350657785 811 dbSNP
rs1323222462 819 dbSNP
rs1460718361 822 dbSNP
rs1384284448 832 dbSNP
rs1466098126 841 dbSNP
rs1184224577 850 dbSNP
rs912086476 850 dbSNP
rs1478762406 855 dbSNP
rs950616764 862 dbSNP
rs983356888 864 dbSNP
rs17878624 865 dbSNP
rs914973884 867 dbSNP
rs1365634434 868 dbSNP
rs946408509 872 dbSNP
rs963096671 873 dbSNP
rs902447228 891 dbSNP
rs1368473801 899 dbSNP
rs1346750299 900 dbSNP
rs1431123922 908 dbSNP
rs1368454595 910 dbSNP
rs1003483061 923 dbSNP
rs1406337098 925 dbSNP
rs990876839 933 dbSNP
rs181761491 934 dbSNP
rs1168304776 937 dbSNP
rs533200033 944 dbSNP
rs895013059 945 dbSNP
rs949137157 949 dbSNP
rs1239677187 954 dbSNP
rs981576831 955 dbSNP
rs928772680 956 dbSNP
rs1231659723 962 dbSNP
rs771381579 963 dbSNP
rs1312780059 968 dbSNP
rs540147173 974 dbSNP
rs150652785 975 dbSNP
rs377708686 980 dbSNP
rs947440223 985 dbSNP
rs1026250789 987 dbSNP
rs950701086 989 dbSNP
rs987713248 993 dbSNP
rs1039441081 995 dbSNP
rs912140353 997 dbSNP
rs1470759105 999 dbSNP
rs1311725993 1000 dbSNP
rs776591534 1002 dbSNP
rs2856269 1003 dbSNP
rs1381778918 1011 dbSNP
rs1158939384 1017 dbSNP
rs997564367 1018 dbSNP
rs1442446145 1020 dbSNP
rs1184999525 1022 dbSNP
rs1257479941 1023 dbSNP
rs1030180514 1026 dbSNP
rs1385346862 1027 dbSNP
rs886248212 1028 dbSNP
rs548543992 1029 dbSNP
rs1469122100 1038 dbSNP
rs1005104267 1039 dbSNP
rs1489344555 1044 dbSNP
rs1286934593 1053 dbSNP
rs915007427 1054 dbSNP
rs1016207767 1056 dbSNP
rs568529001 1064 dbSNP
rs17878377 1070 dbSNP
rs946433657 1071 dbSNP
rs1304622548 1073 dbSNP
rs17885994 1082 dbSNP
rs769764086 1084 dbSNP
rs1382660186 1085 dbSNP
rs191137126 1086 dbSNP
rs1361915385 1087 dbSNP
rs1298360982 1094 dbSNP
rs1452647167 1095 dbSNP
rs775843990 1096 dbSNP
rs1167308716 1097 dbSNP
rs1424828595 1098 dbSNP
rs1417755913 1100 dbSNP
rs573416645 1101 dbSNP
rs895024376 1109 dbSNP
rs138794504 1110 dbSNP
rs1204719700 1118 dbSNP
rs947921147 1120 dbSNP
rs1038581876 1132 dbSNP
rs928827133 1136 dbSNP
rs995355347 1143 dbSNP
rs1231385964 1149 dbSNP
rs1341792735 1151 dbSNP
rs1026344329 1158 dbSNP
rs886476628 1159 dbSNP
rs956256058 1167 dbSNP
rs989372038 1168 dbSNP
rs914864462 1174 dbSNP
rs1359423782 1179 dbSNP
rs947626750 1181 dbSNP
rs1218081983 1194 dbSNP
rs551857923 1195 dbSNP
rs764023319 1198 dbSNP
rs553301725 1199 dbSNP
rs1394207548 1205 dbSNP
rs567125434 1207 dbSNP
rs1019159702 1214 dbSNP
rs111816792 1224 dbSNP
rs751746692 1235 dbSNP
rs17885394 1236 dbSNP
rs1269724351 1238 dbSNP
rs1388854151 1239 dbSNP
rs1427331962 1243 dbSNP
rs1192011930 1244 dbSNP
rs1468701875 1247 dbSNP
rs542525186 1249 dbSNP
rs923680925 1250 dbSNP
rs1402217355 1251 dbSNP
rs1251885786 1264 dbSNP
rs1051870530 1268 dbSNP
rs1226041794 1272 dbSNP
rs149352631 1273 dbSNP
rs886507243 1278 dbSNP
rs373191333 1280 dbSNP
rs1004751449 1281 dbSNP
rs1370647991 1287 dbSNP
rs916514584 1288 dbSNP
rs1037935807 1295 dbSNP
rs899082801 1296 dbSNP
rs1325849029 1297 dbSNP
rs1012544221 1299 dbSNP
rs575734434 1304 dbSNP
rs1362926022 1306 dbSNP
rs947942038 1309 dbSNP
rs761865439 1311 dbSNP
rs970344304 1313 dbSNP
rs1236327211 1316 dbSNP
rs898351459 1321 dbSNP
rs1003144497 1322 dbSNP
rs1198999230 1328 dbSNP
rs1030738120 1332 dbSNP
rs537946622 1333 dbSNP
rs1191510402 1335 dbSNP
rs558271974 1337 dbSNP
rs1047842684 1340 dbSNP
rs956652269 1342 dbSNP
rs767505222 1343 dbSNP
rs1336831503 1355 dbSNP
rs1257262788 1362 dbSNP
rs1234443373 1364 dbSNP
rs2661694 1374 dbSNP
rs900480183 1375 dbSNP
rs1242753439 1378 dbSNP
rs996857526 1389 dbSNP
rs1022535363 1390 dbSNP
rs969008020 1400 dbSNP
rs1404385056 1409 dbSNP
rs1303479246 1411 dbSNP
rs1434228718 1412 dbSNP
rs1194766408 1413 dbSNP
rs968658199 1416 dbSNP
rs540375331 1426 dbSNP
rs1364195389 1429 dbSNP
rs183312799 1442 dbSNP
rs1435981647 1454 dbSNP
rs1258225767 1461 dbSNP
rs1210970387 1467 dbSNP
rs1030763124 1469 dbSNP
rs1277681178 1482 dbSNP
rs186938477 1494 dbSNP
rs1351803887 1495 dbSNP
rs1279363154 1515 dbSNP
rs542549013 1516 dbSNP
rs991842254 1520 dbSNP
rs916256554 1523 dbSNP
rs1486385100 1524 dbSNP
rs947733911 1525 dbSNP
rs974432097 1526 dbSNP
rs919852507 1530 dbSNP
rs1301836172 1546 dbSNP
rs1420558392 1549 dbSNP
rs1384581259 1550 dbSNP
rs370504799 1552 dbSNP
rs1051757370 1561 dbSNP
rs1468467133 1566 dbSNP
rs1231156897 1568 dbSNP
rs907989868 1569 dbSNP
rs1330101482 1573 dbSNP
rs1254821882 1578 dbSNP
rs1208276818 1579 dbSNP
rs1266665503 1592 dbSNP
rs760290396 1593 dbSNP
rs1203751555 1607 dbSNP
rs562122968 1610 dbSNP
rs17884909 1611 dbSNP
rs1214911037 1615 dbSNP
rs531384589 1616 dbSNP
rs1267231539 1619 dbSNP
rs1432157819 1620 dbSNP
rs907980920 1622 dbSNP
rs1037547821 1625 dbSNP
rs1431619815 1626 dbSNP
rs898964520 1632 dbSNP
rs753566198 1633 dbSNP
rs575572774 1639 dbSNP
rs1316570116 1652 dbSNP
rs17883788 1668 dbSNP
rs17879923 1669 dbSNP
rs904070308 1671 dbSNP
rs1195174264 1673 dbSNP
rs1475495704 1678 dbSNP
rs140212651 1682 dbSNP
rs764467639 1683 dbSNP
rs1453643303 1687 dbSNP
rs1030623659 1688 dbSNP
rs17879624 1691 dbSNP
rs547179362 1692 dbSNP
rs1021809768 1708 dbSNP
rs969313642 1709 dbSNP
rs533509901 1711 dbSNP
rs1268572377 1724 dbSNP
rs1438920610 1729 dbSNP
rs1372854025 1732 dbSNP
rs1042541 1736 dbSNP
rs1439946658 1739 dbSNP
rs1392200542 1742 dbSNP
rs954938046 1743 dbSNP
rs1172518621 1752 dbSNP
rs1409972857 1753 dbSNP
rs536131529 1757 dbSNP
rs907832091 1758 dbSNP
rs973726375 1769 dbSNP
rs1253278961 1774 dbSNP
rs1265425603 1776 dbSNP
rs1487797861 1777 dbSNP
rs549741429 1782 dbSNP
rs569264880 1783 dbSNP
rs1205843024 1786 dbSNP
rs1437277400 1789 dbSNP
rs1271003255 1791 dbSNP
rs1221067086 1793 dbSNP
rs1042542 1794 dbSNP
rs920672627 1795 dbSNP
rs1233277915 1796 dbSNP
rs769970019 1799 dbSNP
rs947919270 1800 dbSNP
rs145698232 1801 dbSNP
rs1181074026 1806 dbSNP
rs1044869906 1807 dbSNP
rs1436113251 1807 dbSNP
rs17885897 1811 dbSNP
rs779969178 1816 dbSNP
rs749556101 1823 dbSNP
rs1178235573 1826 dbSNP
rs1470058345 1827 dbSNP
rs4789560 1828 dbSNP
rs1367611102 1829 dbSNP
rs1486073579 1851 dbSNP
rs1010676576 1853 dbSNP
rs1345409352 1854 dbSNP
rs1022489973 1856 dbSNP
rs553536085 1863 dbSNP
rs1308851702 1865 dbSNP
rs899573735 1877 dbSNP
rs1169531292 1883 dbSNP
rs1372516689 1885 dbSNP
rs1277758366 1889 dbSNP
rs548444908 1891 dbSNP
rs1375524057 1900 dbSNP
rs1311858992 1909 dbSNP
rs542510240 1915 dbSNP
rs761634424 1921 dbSNP
rs926757320 1923 dbSNP
rs1160255149 1924 dbSNP
rs1418929929 1929 dbSNP
rs896691159 1930 dbSNP
rs1029124721 1934 dbSNP
rs562486606 1935 dbSNP
rs1185958851 1940 dbSNP
rs1486954002 1947 dbSNP
rs1261598860 1960 dbSNP
rs1216218127 1962 dbSNP
rs1306474014 1963 dbSNP
rs17882360 1968 dbSNP
rs1396760545 1974 dbSNP
rs1014944217 1975 dbSNP
rs995595893 1975 dbSNP
rs59214380 1978 dbSNP
rs951035528 1979 dbSNP
rs982695283 1988 dbSNP
rs1289147660 1989 dbSNP
rs912474162 1990 dbSNP
rs1343810502 2000 dbSNP
rs1167667561 2003 dbSNP
rs537041613 2004 dbSNP
rs1417825207 2008 dbSNP
rs973415650 2008 dbSNP
rs1162873582 2009 dbSNP
rs1430432939 2010 dbSNP
rs920712159 2018 dbSNP
rs1186148786 2026 dbSNP
rs948137080 2027 dbSNP
rs550209052 2030 dbSNP
rs980577156 2033 dbSNP
rs1248911846 2045 dbSNP
rs760497819 2049 dbSNP
rs1182045549 2050 dbSNP
rs879453340 2051 dbSNP
rs74532139 2058 dbSNP
rs1308763489 2063 dbSNP
rs11655530 2064 dbSNP
rs1255247369 2067 dbSNP
rs1421815150 2068 dbSNP
rs1195295875 2069 dbSNP
rs1390703293 2078 dbSNP
rs1429251582 2082 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAG-UGUGAGgu 5'
             || |||   || ::||||  
Target 5' ---ACUCCAGCCUCUGUACUCau 3'
1 - 20
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' ---------------CACUCCa 3'
1 - 7
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000301633.4 | 3UTR | ACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000301633.4 | 3UTR | CACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000301633.4 | 3UTR | CACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*