Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT524517 [miRNA, hsa-miR-122-5p :: CDK19, target gene]
miRTarBase - #MIRT524517 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDK19   
Synonyms CDC2L6, CDK11, bA346C16.3
Description cyclin dependent kinase 19
Transcript NM_015076   
Putative miRNA Targets on CDK19
3'UTR of CDK19
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guuugugGUAACAGUGUGAGgu 5'
                 ||| || ||||||  
Target 5' aagtctgCATAGTGACACTCat 3'
1718 - 1739 139.00 -13.30
            ::||| |  ||| | |||||| 
2788 - 2811 134.00 -16.20
            ||| :|| |  |||| |:|:||| 
4226 - 4250 125.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30135643 10 COSMIC
COSN31583885 28 COSMIC
COSN30509507 34 COSMIC
COSN31507779 51 COSMIC
COSN30182057 58 COSMIC
COSN19696578 71 COSMIC
COSN30607091 74 COSMIC
COSN31581785 90 COSMIC
COSN31516460 289 COSMIC
COSN31547046 558 COSMIC
COSN31571136 632 COSMIC
COSN31568734 683 COSMIC
COSN6720650 724 COSMIC
COSN31607032 808 COSMIC
COSN31515633 820 COSMIC
COSN30387385 838 COSMIC
COSN31552528 992 COSMIC
COSN31515458 1235 COSMIC
COSN5082117 1300 COSMIC
COSN5617641 1406 COSMIC
COSN31482797 1503 COSMIC
COSN9290499 1509 COSMIC
COSN28201389 1523 COSMIC
COSN31489361 1569 COSMIC
COSN31589534 1587 COSMIC
COSN31533029 1594 COSMIC
COSN30544691 1596 COSMIC
COSN31479815 1655 COSMIC
COSN8493470 1773 COSMIC
COSN14768890 1837 COSMIC
COSN30109683 1847 COSMIC
COSN2840863 1884 COSMIC
COSN5617640 1968 COSMIC
COSN26544877 2039 COSMIC
COSN31602584 2050 COSMIC
COSN29212466 2138 COSMIC
COSN31566146 2217 COSMIC
COSN14904273 2873 COSMIC
COSN7593800 3520 COSMIC
COSN9963871 3739 COSMIC
COSN14727452 3974 COSMIC
COSN26583789 4283 COSMIC
COSN30177231 4298 COSMIC
COSN24910037 4383 COSMIC
COSN24294941 4543 COSMIC
COSN9290498 4551 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776013864 4 dbSNP
rs539810221 7 dbSNP
rs746173091 8 dbSNP
rs112980396 9 dbSNP
rs757754206 10 dbSNP
rs1222109321 11 dbSNP
rs1372707375 14 dbSNP
rs948916514 15 dbSNP
rs199678603 18 dbSNP
rs778179892 20 dbSNP
rs756223912 22 dbSNP
rs762462429 25 dbSNP
rs752848644 26 dbSNP
rs779984672 27 dbSNP
rs373584668 30 dbSNP
rs1299934797 35 dbSNP
rs1339907332 42 dbSNP
rs1359630914 44 dbSNP
rs774897911 48 dbSNP
rs750445033 50 dbSNP
rs1406587267 51 dbSNP
rs1409698406 59 dbSNP
rs757735086 60 dbSNP
rs1347697988 62 dbSNP
rs570847232 64 dbSNP
rs1222057568 69 dbSNP
rs1357431859 81 dbSNP
rs1283103742 82 dbSNP
rs1311222322 84 dbSNP
rs950526035 89 dbSNP
rs982937091 115 dbSNP
rs1336896512 124 dbSNP
rs975834276 161 dbSNP
rs1269511800 170 dbSNP
rs1196985754 176 dbSNP
rs767054669 176 dbSNP
rs1266457609 180 dbSNP
rs1373726225 184 dbSNP
rs1017383130 197 dbSNP
rs930122850 198 dbSNP
rs1371347321 208 dbSNP
rs547941787 209 dbSNP
rs534285641 216 dbSNP
rs773385922 221 dbSNP
rs1403685401 228 dbSNP
rs1055322 229 dbSNP
rs1363119673 241 dbSNP
rs748382313 248 dbSNP
rs80057960 249 dbSNP
rs1339717619 250 dbSNP
rs1227008328 256 dbSNP
rs1291928334 260 dbSNP
rs948752247 263 dbSNP
rs758193808 265 dbSNP
rs954475151 267 dbSNP
rs1030061075 269 dbSNP
rs1188432529 272 dbSNP
rs1363206713 273 dbSNP
rs1449148380 282 dbSNP
rs894683147 295 dbSNP
rs117102226 308 dbSNP
rs182483602 310 dbSNP
rs1021543653 311 dbSNP
rs1011947239 312 dbSNP
rs1157183889 318 dbSNP
rs983026707 319 dbSNP
rs1287544324 320 dbSNP
rs928982920 323 dbSNP
rs1433956623 324 dbSNP
rs922923969 336 dbSNP
rs1469995641 357 dbSNP
rs1226475189 362 dbSNP
rs1269838897 380 dbSNP
rs1201910438 381 dbSNP
rs1489868118 394 dbSNP
rs1268295484 395 dbSNP
rs1317514135 399 dbSNP
rs894384537 407 dbSNP
rs1217654715 419 dbSNP
rs1056226337 420 dbSNP
rs964425849 428 dbSNP
rs1204576173 431 dbSNP
rs1244983410 434 dbSNP
rs1317450644 435 dbSNP
rs1286329156 465 dbSNP
rs1221838227 466 dbSNP
rs1017414137 467 dbSNP
rs1283483576 472 dbSNP
rs1224990933 475 dbSNP
rs1002809745 485 dbSNP
rs1388406346 486 dbSNP
rs1343031328 489 dbSNP
rs907316024 492 dbSNP
rs1032022392 494 dbSNP
rs1407564107 495 dbSNP
rs764928871 509 dbSNP
rs1301997853 515 dbSNP
rs1047107409 517 dbSNP
rs998742317 529 dbSNP
rs1430919815 538 dbSNP
rs907208113 539 dbSNP
rs1225426396 545 dbSNP
rs758206947 545 dbSNP
rs1224285647 549 dbSNP
rs144165833 550 dbSNP
rs894547413 554 dbSNP
rs1038578205 558 dbSNP
rs1233562588 561 dbSNP
rs1430464067 577 dbSNP
rs1038535363 589 dbSNP
rs532792084 591 dbSNP
rs1480968305 592 dbSNP
rs1178792214 600 dbSNP
rs942982227 600 dbSNP
rs563733912 602 dbSNP
rs1412446412 605 dbSNP
rs576117735 617 dbSNP
rs527338051 626 dbSNP
rs1444229926 627 dbSNP
rs1306113908 629 dbSNP
rs1349867331 630 dbSNP
rs1428603274 631 dbSNP
rs1047765283 636 dbSNP
rs934252807 638 dbSNP
rs911468234 650 dbSNP
rs556450892 651 dbSNP
rs1187171830 657 dbSNP
rs1273740951 658 dbSNP
rs1309347595 669 dbSNP
rs1203541982 676 dbSNP
rs745849640 699 dbSNP
rs1243746434 712 dbSNP
rs1213598587 721 dbSNP
rs1202010316 729 dbSNP
rs975701753 732 dbSNP
rs943151389 744 dbSNP
rs1263547568 753 dbSNP
rs1224901849 756 dbSNP
rs1171656960 758 dbSNP
rs910314122 759 dbSNP
rs1320972624 770 dbSNP
rs1411152257 771 dbSNP
rs954329951 772 dbSNP
rs989834250 790 dbSNP
rs1300231647 795 dbSNP
rs561734082 801 dbSNP
rs543410973 803 dbSNP
rs1363501423 804 dbSNP
rs1405524950 806 dbSNP
rs1268889413 807 dbSNP
rs957201311 811 dbSNP
rs1304009657 813 dbSNP
rs1329155995 815 dbSNP
rs1435955307 818 dbSNP
rs923022908 820 dbSNP
rs1430668554 821 dbSNP
rs924433538 827 dbSNP
rs1274072275 832 dbSNP
rs1360749681 833 dbSNP
rs977128099 838 dbSNP
rs1426706055 839 dbSNP
rs1451401765 842 dbSNP
rs967116145 852 dbSNP
rs971338413 853 dbSNP
rs1339109486 864 dbSNP
rs1450998781 870 dbSNP
rs1186091223 872 dbSNP
rs1425167518 897 dbSNP
rs541982260 898 dbSNP
rs1404541612 899 dbSNP
rs1024752388 907 dbSNP
rs1012910747 908 dbSNP
rs576676794 919 dbSNP
rs1296908599 928 dbSNP
rs1383638772 932 dbSNP
rs1248726839 940 dbSNP
rs1282942645 942 dbSNP
rs1021910007 949 dbSNP
rs1011395965 950 dbSNP
rs1286831824 957 dbSNP
rs1465942209 967 dbSNP
rs528788913 968 dbSNP
rs1246814933 978 dbSNP
rs887282911 981 dbSNP
rs1430344680 992 dbSNP
rs1034247723 993 dbSNP
rs147475201 1003 dbSNP
rs907180022 1010 dbSNP
rs1158895929 1015 dbSNP
rs901410797 1021 dbSNP
rs1184650998 1026 dbSNP
rs546100868 1028 dbSNP
rs1039902866 1035 dbSNP
rs1047137904 1046 dbSNP
rs1448798964 1048 dbSNP
rs1320151606 1050 dbSNP
rs994253570 1054 dbSNP
rs191759520 1055 dbSNP
rs1038975184 1067 dbSNP
rs1205321013 1068 dbSNP
rs1459848914 1072 dbSNP
rs1054138296 1081 dbSNP
rs554199366 1082 dbSNP
rs1240431328 1087 dbSNP
rs924480883 1089 dbSNP
rs1408679999 1097 dbSNP
rs763542447 1103 dbSNP
rs911474480 1130 dbSNP
rs1308695200 1143 dbSNP
rs1267098250 1145 dbSNP
rs977265163 1158 dbSNP
rs1201648041 1165 dbSNP
rs1253509682 1179 dbSNP
rs1441729194 1180 dbSNP
rs1051311892 1182 dbSNP
rs188649494 1189 dbSNP
rs932974378 1200 dbSNP
rs755768167 1201 dbSNP
rs568496463 1202 dbSNP
rs1413820491 1223 dbSNP
rs971750949 1225 dbSNP
rs917185335 1227 dbSNP
rs922969109 1231 dbSNP
rs151338573 1235 dbSNP
rs183240054 1240 dbSNP
rs1170854445 1242 dbSNP
rs1178858576 1243 dbSNP
rs1317837756 1246 dbSNP
rs1401611241 1253 dbSNP
rs569087696 1255 dbSNP
rs1392420174 1256 dbSNP
rs1331462238 1260 dbSNP
rs967559939 1269 dbSNP
rs914308621 1278 dbSNP
rs1016911217 1279 dbSNP
rs1450872187 1281 dbSNP
rs1284378509 1283 dbSNP
rs990407353 1284 dbSNP
rs1005678027 1291 dbSNP
rs1378943227 1297 dbSNP
rs1253687515 1299 dbSNP
rs1195947634 1301 dbSNP
rs1343684289 1301 dbSNP
rs201908334 1309 dbSNP
rs5879077 1311 dbSNP
rs1026261047 1312 dbSNP
rs552497419 1320 dbSNP
rs1269374140 1326 dbSNP
rs148773159 1333 dbSNP
rs144315117 1334 dbSNP
rs1462557850 1336 dbSNP
rs1170627794 1338 dbSNP
rs971287156 1339 dbSNP
rs1369218607 1340 dbSNP
rs1429712958 1348 dbSNP
rs1370207902 1360 dbSNP
rs768707615 1377 dbSNP
rs994118295 1384 dbSNP
rs1330215096 1389 dbSNP
rs1442500683 1410 dbSNP
rs1276206439 1412 dbSNP
rs888813844 1417 dbSNP
rs1204378233 1422 dbSNP
rs1177365400 1425 dbSNP
rs755674873 1437 dbSNP
rs1481412600 1440 dbSNP
rs546939830 1444 dbSNP
rs898600239 1447 dbSNP
rs1054049030 1453 dbSNP
rs935775054 1456 dbSNP
rs752393765 1458 dbSNP
rs192336044 1459 dbSNP
rs1190558833 1464 dbSNP
rs1388432118 1465 dbSNP
rs767831740 1468 dbSNP
rs1359584111 1469 dbSNP
rs917048419 1470 dbSNP
rs1293360656 1471 dbSNP
rs1294538768 1474 dbSNP
rs1244452765 1475 dbSNP
rs991413296 1478 dbSNP
rs937234249 1490 dbSNP
rs1362421073 1493 dbSNP
rs1227486854 1495 dbSNP
rs1315636459 1497 dbSNP
rs909906574 1518 dbSNP
rs1219077283 1530 dbSNP
rs1264681256 1533 dbSNP
rs984124333 1557 dbSNP
rs759963278 1575 dbSNP
rs879598212 1576 dbSNP
rs977200698 1581 dbSNP
rs1051260526 1582 dbSNP
rs1371444161 1583 dbSNP
rs1307717664 1584 dbSNP
rs1405594992 1590 dbSNP
rs1164473573 1595 dbSNP
rs1364764422 1599 dbSNP
rs373604414 1601 dbSNP
rs561789959 1606 dbSNP
rs1322145036 1607 dbSNP
rs774790102 1608 dbSNP
rs1433691559 1638 dbSNP
rs1165337816 1640 dbSNP
rs767025013 1641 dbSNP
rs1381214716 1648 dbSNP
rs186327373 1660 dbSNP
rs1311684165 1666 dbSNP
rs1018388741 1681 dbSNP
rs1041427694 1690 dbSNP
rs894045277 1691 dbSNP
rs1032670724 1710 dbSNP
rs1204352090 1730 dbSNP
rs999879937 1731 dbSNP
rs541546538 1733 dbSNP
rs945707988 1734 dbSNP
rs773477597 1737 dbSNP
rs1251611129 1748 dbSNP
rs914320393 1755 dbSNP
rs1157475587 1756 dbSNP
rs989881588 1762 dbSNP
rs1456411457 1764 dbSNP
rs144320990 1765 dbSNP
rs1055617804 1773 dbSNP
rs562673074 1780 dbSNP
rs546159836 1782 dbSNP
rs180946367 1783 dbSNP
rs1241590488 1786 dbSNP
rs1315552614 1793 dbSNP
rs1286271506 1795 dbSNP
rs367972419 1796 dbSNP
rs927170146 1808 dbSNP
rs1287924258 1812 dbSNP
rs554211850 1814 dbSNP
rs540594911 1815 dbSNP
rs574724314 1817 dbSNP
rs1280760123 1822 dbSNP
rs2691197 1837 dbSNP
rs1301380882 1839 dbSNP
rs973165530 1840 dbSNP
rs537948722 1844 dbSNP
rs962706538 1848 dbSNP
rs1484349462 1860 dbSNP
rs1180427301 1865 dbSNP
rs1017435013 1866 dbSNP
rs569145344 1882 dbSNP
rs1007012638 1896 dbSNP
rs776897968 1899 dbSNP
rs1029864198 1902 dbSNP
rs998335424 1908 dbSNP
rs768702556 1909 dbSNP
rs1426576975 1911 dbSNP
rs902786045 1927 dbSNP
rs1389909240 1928 dbSNP
rs1042633836 1935 dbSNP
rs945711839 1941 dbSNP
rs892762936 1943 dbSNP
rs1174804715 1945 dbSNP
rs80158403 1947 dbSNP
rs1289423590 1948 dbSNP
rs1371056134 1954 dbSNP
rs1431586066 1959 dbSNP
rs1455116138 1962 dbSNP
rs1054527925 1963 dbSNP
rs937141740 1973 dbSNP
rs965428378 1980 dbSNP
rs1276827884 1981 dbSNP
rs927034192 1983 dbSNP
rs981267073 1989 dbSNP
rs949865743 1994 dbSNP
rs1344882573 1995 dbSNP
rs1203664008 1998 dbSNP
rs1274295594 2000 dbSNP
rs1452552103 2000 dbSNP
rs918509000 2002 dbSNP
rs1224324051 2006 dbSNP
rs1248073474 2012 dbSNP
rs745663007 2018 dbSNP
rs189753934 2020 dbSNP
rs962943794 2021 dbSNP
rs1431056919 2028 dbSNP
rs1451194540 2031 dbSNP
rs538948048 2034 dbSNP
rs1000147039 2036 dbSNP
rs1369949375 2041 dbSNP
rs1432138589 2061 dbSNP
rs1405728152 2063 dbSNP
rs1325333630 2068 dbSNP
rs1263000839 2072 dbSNP
rs1016968575 2073 dbSNP
rs985851182 2078 dbSNP
rs954132755 2081 dbSNP
rs1267912554 2097 dbSNP
rs1297502424 2107 dbSNP
rs1029728409 2110 dbSNP
rs1230358635 2126 dbSNP
rs1288207544 2130 dbSNP
rs1449468208 2135 dbSNP
rs1212701130 2137 dbSNP
rs1248038377 2155 dbSNP
rs1465860624 2160 dbSNP
rs1186192320 2165 dbSNP
rs566794797 2170 dbSNP
rs1281682584 2171 dbSNP
rs749199446 2178 dbSNP
rs1164735284 2179 dbSNP
rs1411381070 2182 dbSNP
rs1055522077 2184 dbSNP
rs11756279 2187 dbSNP
rs1432972373 2197 dbSNP
rs1296145733 2203 dbSNP
rs1341554789 2204 dbSNP
rs112160556 2205 dbSNP
rs1282728981 2219 dbSNP
rs541971296 2220 dbSNP
rs1229474372 2223 dbSNP
rs1054158380 2224 dbSNP
rs1330838123 2225 dbSNP
rs1319634491 2248 dbSNP
rs1442879267 2255 dbSNP
rs1470175868 2255 dbSNP
rs527320093 2259 dbSNP
rs1235454805 2261 dbSNP
rs1474754395 2262 dbSNP
rs758731510 2264 dbSNP
rs1414429077 2265 dbSNP
rs1455873097 2272 dbSNP
rs929873119 2276 dbSNP
rs1403020227 2287 dbSNP
rs1398239716 2291 dbSNP
rs905641459 2311 dbSNP
rs1407813716 2312 dbSNP
rs918633489 2317 dbSNP
rs574967667 2324 dbSNP
rs146329157 2330 dbSNP
rs944156535 2341 dbSNP
rs911322735 2342 dbSNP
rs1195886535 2347 dbSNP
rs1259567646 2349 dbSNP
rs1448211740 2359 dbSNP
rs918456568 2362 dbSNP
rs1201742669 2363 dbSNP
rs1276398526 2370 dbSNP
rs531297465 2373 dbSNP
rs1485331424 2388 dbSNP
rs1182584750 2390 dbSNP
rs1037263930 2406 dbSNP
rs941315466 2407 dbSNP
rs1485589215 2409 dbSNP
rs1181367663 2422 dbSNP
rs1261464651 2425 dbSNP
rs1378498175 2435 dbSNP
rs1200115756 2436 dbSNP
rs1467640214 2450 dbSNP
rs562683293 2450 dbSNP
rs1375344514 2457 dbSNP
rs752093159 2458 dbSNP
rs185834248 2459 dbSNP
rs1225418650 2463 dbSNP
rs532472148 2464 dbSNP
rs1305845869 2472 dbSNP
rs141981887 2476 dbSNP
rs1331384548 2481 dbSNP
rs1543992 2483 dbSNP
rs1272605390 2488 dbSNP
rs138718283 2492 dbSNP
rs967363376 2496 dbSNP
rs1205802112 2508 dbSNP
rs1276428673 2509 dbSNP
rs561116360 2515 dbSNP
rs1195073589 2518 dbSNP
rs1013941212 2519 dbSNP
rs1384760534 2523 dbSNP
rs1196793577 2524 dbSNP
rs1394578480 2527 dbSNP
rs541436459 2530 dbSNP
rs771384049 2537 dbSNP
rs577252936 2538 dbSNP
rs1461785182 2547 dbSNP
rs1011479905 2556 dbSNP
rs1001248124 2558 dbSNP
rs544699335 2559 dbSNP
rs1388176539 2562 dbSNP
rs1169141635 2571 dbSNP
rs1323242042 2571 dbSNP
rs888312213 2573 dbSNP
rs1228589332 2584 dbSNP
rs1048699125 2588 dbSNP
rs958340830 2598 dbSNP
rs1427331710 2599 dbSNP
rs994120355 2603 dbSNP
rs1390079680 2614 dbSNP
rs1164818173 2620 dbSNP
rs1489558352 2629 dbSNP
rs1208296687 2637 dbSNP
rs1034325632 2642 dbSNP
rs1222523275 2648 dbSNP
rs1252378231 2653 dbSNP
rs558589274 2659 dbSNP
rs1040940645 2662 dbSNP
rs944063229 2663 dbSNP
rs1236098953 2676 dbSNP
rs1165870203 2681 dbSNP
rs905495611 2707 dbSNP
rs911184969 2736 dbSNP
rs1459063696 2744 dbSNP
rs1322023980 2750 dbSNP
rs1435164947 2750 dbSNP
rs879868984 2750 dbSNP
rs1187022580 2751 dbSNP
rs1359734817 2751 dbSNP
rs1381599491 2754 dbSNP
rs575285295 2755 dbSNP
rs1242421545 2763 dbSNP
rs1272766737 2766 dbSNP
rs1045368832 2783 dbSNP
rs1330135773 2786 dbSNP
rs558746165 2794 dbSNP
rs936750114 2798 dbSNP
rs896895956 2805 dbSNP
rs1036889622 2808 dbSNP
rs1194125792 2809 dbSNP
rs941166425 2814 dbSNP
rs141765019 2823 dbSNP
rs978647937 2824 dbSNP
rs1422422491 2825 dbSNP
rs1164723309 2834 dbSNP
rs1246655740 2842 dbSNP
rs1416678811 2853 dbSNP
rs747548761 2856 dbSNP
rs1160681312 2869 dbSNP
rs370961646 2872 dbSNP
rs2817802 2873 dbSNP
rs373975135 2875 dbSNP
rs922637120 2878 dbSNP
rs796393149 2879 dbSNP
rs1381320353 2880 dbSNP
rs1412675708 2882 dbSNP
rs1351297030 2885 dbSNP
rs536544272 2888 dbSNP
rs568090569 2889 dbSNP
rs1210985541 2896 dbSNP
rs375442353 2908 dbSNP
rs992371620 2913 dbSNP
rs1482587147 2917 dbSNP
rs1187635604 2918 dbSNP
rs959702097 2924 dbSNP
rs1407420459 2931 dbSNP
rs966814037 2932 dbSNP
rs1183899394 2936 dbSNP
rs913959031 2937 dbSNP
rs989685056 2938 dbSNP
rs958420164 2946 dbSNP
rs1034005595 2958 dbSNP
rs547836804 2960 dbSNP
rs1033945578 2961 dbSNP
rs1417983193 2963 dbSNP
rs1176215778 2967 dbSNP
rs1360792829 2968 dbSNP
rs1432817381 2969 dbSNP
rs537943485 2974 dbSNP
rs1370945904 2975 dbSNP
rs970943296 2982 dbSNP
rs181267020 2983 dbSNP
rs1013855717 2984 dbSNP
rs60069055 2991 dbSNP
rs1015729942 2992 dbSNP
rs1412348492 3003 dbSNP
rs532374039 3010 dbSNP
rs1470743968 3011 dbSNP
rs888238257 3018 dbSNP
rs1365721174 3020 dbSNP
rs1215947363 3021 dbSNP
rs59730719 3022 dbSNP
rs896965676 3025 dbSNP
rs932590628 3027 dbSNP
rs1426691419 3032 dbSNP
rs1452435098 3036 dbSNP
rs1172931065 3040 dbSNP
rs138753568 3055 dbSNP
rs9386926 3056 dbSNP
rs1049716450 3061 dbSNP
rs945336643 3062 dbSNP
rs1295309013 3065 dbSNP
rs773849653 3066 dbSNP
rs561335167 3072 dbSNP
rs765289640 3073 dbSNP
rs936764033 3087 dbSNP
rs1298971467 3091 dbSNP
rs1344997060 3092 dbSNP
rs926815508 3093 dbSNP
rs1287715935 3098 dbSNP
rs936782635 3100 dbSNP
rs1436814737 3104 dbSNP
rs1221866468 3113 dbSNP
rs903948744 3115 dbSNP
rs980890838 3127 dbSNP
rs1192519584 3132 dbSNP
rs1248538058 3135 dbSNP
rs1351184875 3136 dbSNP
rs1165893527 3172 dbSNP
rs1280888778 3174 dbSNP
rs1226202766 3175 dbSNP
rs945538548 3177 dbSNP
rs1167164989 3178 dbSNP
rs1392623912 3184 dbSNP
rs1440231657 3186 dbSNP
rs761964630 3191 dbSNP
rs1349263066 3192 dbSNP
rs918057709 3199 dbSNP
rs1303222738 3203 dbSNP
rs1429263872 3204 dbSNP
rs1406302285 3207 dbSNP
rs1230444614 3209 dbSNP
rs544250626 3212 dbSNP
rs970975800 3225 dbSNP
rs752192438 3226 dbSNP
rs776507542 3236 dbSNP
rs1025156637 3239 dbSNP
rs1332280540 3242 dbSNP
rs992465693 3245 dbSNP
rs575348577 3250 dbSNP
rs1401605512 3254 dbSNP
rs768949364 3261 dbSNP
rs190164812 3264 dbSNP
rs1241510729 3267 dbSNP
rs1157146806 3277 dbSNP
rs1472994582 3279 dbSNP
rs545078709 3282 dbSNP
rs952386116 3288 dbSNP
rs573150040 3295 dbSNP
rs1472392193 3304 dbSNP
rs367846327 3317 dbSNP
rs553285064 3321 dbSNP
rs145868317 3326 dbSNP
rs888195253 3329 dbSNP
rs972472787 3339 dbSNP
rs1477110786 3341 dbSNP
rs1399395860 3346 dbSNP
rs1028190291 3365 dbSNP
rs1341643468 3367 dbSNP
rs1220784015 3370 dbSNP
rs1019398818 3382 dbSNP
rs1447314982 3389 dbSNP
rs1008139509 3392 dbSNP
rs149043951 3402 dbSNP
rs901109346 3403 dbSNP
rs1206659232 3405 dbSNP
rs1202907386 3407 dbSNP
rs35656940 3412 dbSNP
rs1040956563 3414 dbSNP
rs1283581716 3418 dbSNP
rs1212700508 3419 dbSNP
rs945407488 3425 dbSNP
rs1255163217 3433 dbSNP
rs1474969382 3434 dbSNP
rs1220421095 3437 dbSNP
rs760833754 3440 dbSNP
rs1364913773 3447 dbSNP
rs1028310302 3452 dbSNP
rs1158111082 3459 dbSNP
rs1001290970 3461 dbSNP
rs1274724703 3465 dbSNP
rs1416678503 3470 dbSNP
rs903812979 3488 dbSNP
rs1375231244 3500 dbSNP
rs1410902843 3501 dbSNP
rs4276543 3509 dbSNP
rs114885911 3519 dbSNP
rs1337208616 3530 dbSNP
rs1236210456 3531 dbSNP
rs1278473682 3536 dbSNP
rs865861511 3540 dbSNP
rs774177801 3544 dbSNP
rs926708463 3545 dbSNP
rs1485219667 3549 dbSNP
rs1398812879 3550 dbSNP
rs1205669530 3562 dbSNP
rs1407089780 3563 dbSNP
rs980923383 3564 dbSNP
rs949525743 3573 dbSNP
rs868745382 3574 dbSNP
rs1455916187 3575 dbSNP
rs1056627229 3576 dbSNP
rs1395077628 3581 dbSNP
rs938272454 3587 dbSNP
rs537807719 3593 dbSNP
rs1190493915 3596 dbSNP
rs972249222 3604 dbSNP
rs185286169 3614 dbSNP
rs552346196 3622 dbSNP
rs74927541 3624 dbSNP
rs77990092 3635 dbSNP
rs952594342 3641 dbSNP
rs1331183070 3642 dbSNP
rs919571351 3649 dbSNP
rs1301142693 3651 dbSNP
rs1347111711 3652 dbSNP
rs1464302371 3660 dbSNP
rs754651648 3665 dbSNP
rs753614069 3666 dbSNP
rs1263330627 3675 dbSNP
rs972928836 3676 dbSNP
rs1309869531 3681 dbSNP
rs961151641 3689 dbSNP
rs1195451233 3690 dbSNP
rs1019430209 3697 dbSNP
rs546428083 3698 dbSNP
rs1543991 3706 dbSNP
rs1252882990 3709 dbSNP
rs996697403 3711 dbSNP
rs1028198918 3717 dbSNP
rs1296111947 3724 dbSNP
rs1172923742 3725 dbSNP
rs1000755568 3728 dbSNP
rs1460092307 3739 dbSNP
rs1434787648 3740 dbSNP
rs968488180 3741 dbSNP
rs1384034634 3744 dbSNP
rs965175193 3750 dbSNP
rs1338889699 3751 dbSNP
rs1019548205 3755 dbSNP
rs1370095739 3756 dbSNP
rs144872213 3764 dbSNP
rs1010087436 3769 dbSNP
rs892368402 3771 dbSNP
rs202222620 3782 dbSNP
rs1054219434 3785 dbSNP
rs1226493605 3787 dbSNP
rs1266233923 3789 dbSNP
rs1000848662 3793 dbSNP
rs1211855833 3796 dbSNP
rs1272654861 3796 dbSNP
rs1171207382 3797 dbSNP
rs1465700813 3804 dbSNP
rs1188807727 3811 dbSNP
rs1260343628 3812 dbSNP
rs760585879 3815 dbSNP
rs1418073765 3818 dbSNP
rs905297922 3838 dbSNP
rs1162100067 3841 dbSNP
rs1045093153 3855 dbSNP
rs1393098697 3856 dbSNP
rs1002392841 3860 dbSNP
rs1290542396 3868 dbSNP
rs149853215 3872 dbSNP
rs1381414888 3882 dbSNP
rs1293716530 3885 dbSNP
rs1049787705 3889 dbSNP
rs1243539329 3894 dbSNP
rs930903871 3899 dbSNP
rs918124471 3912 dbSNP
rs1266383832 3928 dbSNP
rs1329930155 3930 dbSNP
rs1482070673 3931 dbSNP
rs919625717 3932 dbSNP
rs1036524623 3934 dbSNP
rs1036681896 3939 dbSNP
rs939795674 3940 dbSNP
rs940968940 3945 dbSNP
rs777783826 3947 dbSNP
rs1273061711 3951 dbSNP
rs1416787473 3957 dbSNP
rs4269406 3960 dbSNP
rs1419127492 3963 dbSNP
rs12216071 3967 dbSNP
rs13220055 3974 dbSNP
rs1360543601 3975 dbSNP
rs765725672 3976 dbSNP
rs564936439 3980 dbSNP
rs9386925 3981 dbSNP
rs1412778858 3989 dbSNP
rs1312486940 3994 dbSNP
rs1374395376 3995 dbSNP
rs953887461 4006 dbSNP
rs1378691307 4010 dbSNP
rs1299000120 4016 dbSNP
rs1235673126 4021 dbSNP
rs1411691576 4029 dbSNP
rs921088494 4034 dbSNP
rs528540059 4040 dbSNP
rs1306041978 4042 dbSNP
rs1429028440 4043 dbSNP
rs1385863731 4044 dbSNP
rs75284235 4045 dbSNP
rs559900270 4046 dbSNP
rs1480774890 4050 dbSNP
rs1405186357 4052 dbSNP
rs967970545 4052 dbSNP
rs1021400905 4054 dbSNP
rs1174183776 4055 dbSNP
rs1009582520 4056 dbSNP
rs1312094042 4056 dbSNP
rs1396877080 4056 dbSNP
rs34488411 4056 dbSNP
rs61570809 4056 dbSNP
rs1296456637 4059 dbSNP
rs1372693025 4064 dbSNP
rs960675137 4073 dbSNP
rs1412583817 4076 dbSNP
rs542826437 4078 dbSNP
rs574292356 4081 dbSNP
rs921025047 4087 dbSNP
rs905396827 4088 dbSNP
rs1206194010 4092 dbSNP
rs1230892144 4093 dbSNP
rs975122957 4103 dbSNP
rs1049226874 4114 dbSNP
rs1193774988 4114 dbSNP
rs200321443 4114 dbSNP
rs995520904 4117 dbSNP
rs965125339 4124 dbSNP
rs1419968815 4130 dbSNP
rs1411517851 4133 dbSNP
rs1036994417 4138 dbSNP
rs939691410 4138 dbSNP
rs754728950 4144 dbSNP
rs1461999187 4146 dbSNP
rs1328037718 4148 dbSNP
rs1019485921 4149 dbSNP
rs912194506 4151 dbSNP
rs1204993174 4170 dbSNP
rs1271072092 4171 dbSNP
rs1050834682 4175 dbSNP
rs932400850 4185 dbSNP
rs1490652211 4188 dbSNP
rs1009382884 4193 dbSNP
rs921117284 4194 dbSNP
rs1213730047 4200 dbSNP
rs547029875 4200 dbSNP
rs979273341 4206 dbSNP
rs968254876 4211 dbSNP
rs1242690482 4216 dbSNP
rs1476256830 4219 dbSNP
rs1184600783 4227 dbSNP
rs1419018609 4241 dbSNP
rs557404927 4243 dbSNP
rs913836829 4255 dbSNP
rs1243028469 4294 dbSNP
rs1321527891 4295 dbSNP
rs1307914725 4296 dbSNP
rs1230474850 4298 dbSNP
rs1348634983 4299 dbSNP
rs956853019 4306 dbSNP
rs10624 4307 dbSNP
rs1392386030 4309 dbSNP
rs1032230153 4310 dbSNP
rs544123098 4312 dbSNP
rs1405690581 4313 dbSNP
rs575351092 4314 dbSNP
rs1295264480 4315 dbSNP
rs538255208 4316 dbSNP
rs988426180 4317 dbSNP
rs1329139339 4324 dbSNP
rs1233527804 4333 dbSNP
rs905162184 4336 dbSNP
rs141083843 4351 dbSNP
rs946225110 4352 dbSNP
rs1013662929 4357 dbSNP
rs1473371534 4358 dbSNP
rs969442707 4363 dbSNP
rs1213320999 4364 dbSNP
rs538740188 4382 dbSNP
rs780630607 4383 dbSNP
rs1190329459 4388 dbSNP
rs1416038579 4391 dbSNP
rs1480500258 4393 dbSNP
rs897966707 4394 dbSNP
rs1410749264 4400 dbSNP
rs11754935 4401 dbSNP
rs1399490239 4403 dbSNP
rs1317992927 4408 dbSNP
rs940839302 4417 dbSNP
rs373293904 4420 dbSNP
rs566413531 4421 dbSNP
rs111427254 4440 dbSNP
rs930971256 4446 dbSNP
rs1015183119 4465 dbSNP
rs763051531 4469 dbSNP
rs1352675681 4472 dbSNP
rs181495289 4478 dbSNP
rs1488324561 4484 dbSNP
rs1261679795 4501 dbSNP
rs1212820291 4509 dbSNP
rs1009094805 4513 dbSNP
rs536090016 4518 dbSNP
rs1182557314 4526 dbSNP
rs1050700135 4529 dbSNP
rs943800534 4532 dbSNP
rs1288018781 4549 dbSNP
rs1158559760 4551 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuuguGGUAACA-GUGUGAGGu 5'
                |||   | ||| :||| 
Target 5' ------CCAACCUCCACCUUCCa 3'
1 - 17
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000368911.3 | 3UTR | CCAACCUCCACCUUCCAGGUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.55 3.3e-3 0.770 8.7e-6 23 Click to see details
GSE28544 Breast cancer -0.5 6.4e-3 -0.584 1.4e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.644 8.8e-3 0.758 1.3e-3 13 Click to see details
GSE27834 Pluripotent stem cells -0.385 7.0e-2 -0.324 1.1e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.24 1.2e-1 -0.166 2.1e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.238 1.3e-1 -0.054 4.0e-1 25 Click to see details
GSE38226 Liver fibrosis -0.225 1.6e-1 -0.030 4.5e-1 21 Click to see details
GSE17498 Multiple myeloma -0.159 1.6e-1 -0.168 1.5e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.166 2.4e-1 0.011 4.8e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.062 2.8e-1 -0.037 3.6e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.184 2.8e-1 0.559 2.9e-2 12 Click to see details
GSE21849 B cell lymphoma 0.108 2.9e-1 -0.146 2.2e-1 29 Click to see details
GSE32688 Pancreatic cancer -0.075 3.4e-1 -0.139 2.2e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.038 3.8e-1 0.002 4.9e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.147 3.9e-1 -0.086 4.4e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells -0.033 4.4e-1 -0.078 3.6e-1 24 Click to see details
GSE17306 Multiple myeloma 0.01 4.7e-1 0.150 1.5e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.476 0 -0.287 0.02 49 Click to see details
THCA -0.945 0.01 -0.800 0.05 5 Click to see details
KIRC 0.359 0.03 0.287 0.07 29 Click to see details
CHOL -0.334 0.19 -0.300 0.22 9 Click to see details
STAD -0.218 0.3 -0.048 0.46 8 Click to see details
ESCA -0.314 0.3 -0.200 0.37 5 Click to see details
HNSC 0.518 0.33 0.500 0.33 3 Click to see details
KICH -0.073 0.43 0.000 0.5 8 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
KIRP 0.029 0.47 -0.033 0.47 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*