miRTarBase - #MIRT521818 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POM121C   
Synonyms POM121-2
Description POM121 transmembrane nucleoporin C
Transcript NM_001099415   
Expression
Putative miRNA Targets on POM121C
3'UTR of POM121C
(miRNA target sites are highlighted)
>POM121C|NM_001099415|3'UTR
   1 CCTTTGTCCCCTGTCCCTGTTCCCCCCACCCCTTCCCTAAATCTGGACCTTGGCACGTGCTAGAAAGAGCCTTGGACCCT
  81 TCCAGCTGCGTAAAGCAAACCTACCCCGGATCTCTGGCTTCAGCCGCCAGGGGGCAGTGGCAGCCCTGGGGCCCTTTCCC
 161 TTCTGGAGGAAGCACAAGCCTCAGGGAAGGGGAAGCAGGATGCGGAGGGCCAAAGCCCGGGACCTCTACTTGAACAGTTC
 241 CACTGGGGAGGCTGGAGAACTAAGGACCTGTACATAGTGTCCGCTGCCCTGACTCCCGCTTAGCGCACCCTTAGGCAGGC
 321 GCCCCTTCCACCTTTCCCCGAGAGCCGTCGTCGCTGGAGGGGGCAGGGTCCAGCCCGCCTGGATCGGTGGTGTGCACCTG
 401 ATGGGATTTGGGAAATGGGTTATCCCTAAAGCTTTATCTTGCTTGGCTTAGCTGTGAGAAGTGGTTCTCTTCCTCTGGTC
 481 CCTTCTGGGGACTCTGTTTCCCCATTTCTTGCTGCTGTGTCCCTCACCGGTTCCTTGCAGGATTCCCTCCTTTTTAAATG
 561 CCCTTGAATCTAGCTTTGCCTTGGAGACCCCAGTGGGTGCTGCTCCTGCCGTTTTCTTCCTGCCAAGCCTGAATCAATGT
 641 TTCATCTCCAACCCTCTGCCAGTTTGGCCCCTCAGAGCTTGGTGGCTCAAGACTGTTAGCCTGGCAGAGCCAGGGGTGAA
 721 GGGAGAAGCTCTTGGAGCAGGCAGGATGCCCACTGCTGCTTCAGCTGCCTCCTCGCCCAGCTACCCTTTGGCCCCATTGG
 801 GCCCTCGTCTGCCTCTCCAGGATTGTATGTTTCAAGCCTTGTCCTGTGTTCCTTTGTCTGACGCTCTGTGTATTGCTCTT
 881 TGAATCGAGTTTGGAGGAAGAGTTGAGTTGTATGAGTGGCGGCATGTTGGTAGTGCCGGACTTCCTGTTTCAAGTTTTCT
 961 GGGGCCTCGCTAATTGAATGTGGAAAGTAGCACCACTTGACGGCTACAAGTGCCGACTCCTGAATTTTCCCATGGTGTTC
1041 TGACTTCAAGGGCTGGCAGCCAGGGAGAATGGGCCCAGGGGAAGCAAAGACCTCTTCCCTCTGCGGTTTCTGTCCCACTT
1121 AACTGACCTCACTGGAGGCTACGTCACCCAAAGTAGATGTTAGAAAACCTAAATTAATGAACCATATTTTTAAAATCCTA
1201 TTTTTCCCAAACAGGGCCCTCTGCAGCCCATCCTTTCCTTCCGTCCTTCTGAAACCACATACCCCAGGCCCAAGCGCCTT
1281 GCTGTCACGCCCAACCTCTTTGGGAGAAGTATGAATGCGTGTGTCTAAATTAAAAGAAAAAAATATTTAAACGTTTTTTA
1361 ACAAAAATTTATTTTTGTATTTAAGCTAAATTGCCTTTTAAATTCCTTCAAGCTTGGTTCATTGAGGTGGTTAAGTATAA
1441 ATGCTATTAACTAGGAATTAGCTGTATAGTTAAGTTATGCCTGTGCAAAGAAGAGGCTCAAATGCTGTCCCCGGCAGCTT
1521 TCCTGGGGGACTAGAGCTCCTTCTGGCCATGTTATATGAAATGTAATTCTTATTTTATAAATAATGTGATGTAGATGTAA
1601 CCGGTGCCCCCTCCCCGTTGTGACTGAGGGCGAGTGTTATACCTGGCTGCGTGTGCAGCTGAGGAGGGAGTGAACCTCAA
1681 GCCTAAATACCTGTTAGGATTGGAGGGTCTGGGTGGGCCTGGGCCTAGCAATCAAGCTTCTACCTGTACCTTATGTAAGG
1761 TAGACCCTCCTAGTGTCAGTACCTGAGCTTGTTTACCTCAGTTCCGCAGGCAGGACAGCCGGTCCGGGAACCCTGAGTGA
1841 GAGTGAGTGTGGATGTGTACAGTACACACACTGGACGGCAGCGGGAGGCTGGGACTTTCCATTACAAATAGAGACTTCAT
1921 TCCTGTTGAGTCTAGTTGGAATTTTTAGTATGAATGTGAGATTTTTCTCCTGCTTGTGACATTAAGAATAAAAAACTGTG
2001 ATCTATCGTAGAGTAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUU--GGUAAUACACGACGAu 5'
             |:|  ||| |: |||||||| 
Target 5' tggAGACCCCAGTGGGTGCTGCTc 3'
582 - 605 161.00 -15.90
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||||   ||||||| 
Target 5' gtttccCCATTTCTTGCTGCTg 3'
496 - 517 156.00 -15.60
3
miRNA  3' guGUUUGGUAAUAC-----ACGACGAu 5'
            ||:: ||  |||     ||||||| 
Target 5' agCAGG-CAGGATGCCCACTGCTGCTt 3'
736 - 761 147.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30178013 9 COSMIC
COSN30542165 73 COSMIC
COSN31563944 89 COSMIC
COSN30143123 90 COSMIC
COSN20091619 135 COSMIC
COSN31577697 184 COSMIC
COSN31550550 198 COSMIC
COSN9317320 274 COSMIC
COSN8039343 321 COSMIC
COSN31570248 467 COSMIC
COSN31611309 504 COSMIC
COSN19663514 529 COSMIC
COSN21393864 879 COSMIC
COSN20091616 1183 COSMIC
COSN31585462 1198 COSMIC
COSN31485568 1211 COSMIC
COSN31603222 1245 COSMIC
COSN20091615 1578 COSMIC
COSN20104349 1729 COSMIC
COSN31523993 1942 COSMIC
COSN31604967 1960 COSMIC
COSN31567036 1962 COSMIC
COSN31479601 1986 COSMIC
COSN30145378 2003 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1469869938 8 dbSNP
rs781928808 9 dbSNP
rs1194578892 11 dbSNP
rs1379926613 13 dbSNP
rs1438000913 16 dbSNP
rs1156619066 19 dbSNP
rs1409840385 22 dbSNP
rs1322795661 24 dbSNP
rs1401265725 24 dbSNP
rs587685002 27 dbSNP
rs1442468496 28 dbSNP
rs1375717594 35 dbSNP
rs1236380918 47 dbSNP
rs1281679627 49 dbSNP
rs1351826416 56 dbSNP
rs1337504397 57 dbSNP
rs1214412549 59 dbSNP
rs1237592151 63 dbSNP
rs1436324475 64 dbSNP
rs1184216741 66 dbSNP
rs1234450404 69 dbSNP
rs1470387215 70 dbSNP
rs1162362052 80 dbSNP
rs1415599062 86 dbSNP
rs587634020 89 dbSNP
rs1165047033 90 dbSNP
rs1398878469 100 dbSNP
rs1389365309 102 dbSNP
rs1330462271 104 dbSNP
rs587773219 104 dbSNP
rs1447772372 107 dbSNP
rs1291761415 108 dbSNP
rs58148454 108 dbSNP
rs1357939795 109 dbSNP
rs1234394672 125 dbSNP
rs1257551410 126 dbSNP
rs1337514210 130 dbSNP
rs1197845173 133 dbSNP
rs376495903 135 dbSNP
rs1442000190 136 dbSNP
rs1255083019 151 dbSNP
rs1476168084 156 dbSNP
rs1188538553 160 dbSNP
rs1372059275 189 dbSNP
rs1460023872 197 dbSNP
rs1169078805 203 dbSNP
rs1396789144 204 dbSNP
rs1413505143 213 dbSNP
rs1357727939 215 dbSNP
rs1415993041 216 dbSNP
rs1278116616 218 dbSNP
rs1325128716 219 dbSNP
rs1270796239 228 dbSNP
rs587639526 232 dbSNP
rs587766232 241 dbSNP
rs1277981683 252 dbSNP
rs1486521168 265 dbSNP
rs1211595812 267 dbSNP
rs1260964511 277 dbSNP
rs1426605940 280 dbSNP
rs1194723499 282 dbSNP
rs1373116060 283 dbSNP
rs3973323 286 dbSNP
rs1171343154 293 dbSNP
rs587624974 295 dbSNP
rs587739606 296 dbSNP
rs1435730655 297 dbSNP
rs587655513 298 dbSNP
rs1383460853 300 dbSNP
rs1384380228 304 dbSNP
rs587608142 305 dbSNP
rs1330571413 316 dbSNP
rs1232440363 320 dbSNP
rs1305897159 321 dbSNP
rs1348788404 328 dbSNP
rs1234765658 332 dbSNP
rs1259878770 334 dbSNP
rs1484873334 336 dbSNP
rs1467632152 337 dbSNP
rs1396517872 339 dbSNP
rs1454406446 340 dbSNP
rs1455849879 344 dbSNP
rs782809707 345 dbSNP
rs1393921306 349 dbSNP
rs1438810377 350 dbSNP
rs1327943416 352 dbSNP
rs1372029337 353 dbSNP
rs1446273027 355 dbSNP
rs587710140 359 dbSNP
rs1306079964 364 dbSNP
rs1314891104 365 dbSNP
rs1241173190 374 dbSNP
rs1261238632 375 dbSNP
rs1333994063 376 dbSNP
rs1211300393 377 dbSNP
rs1254285754 378 dbSNP
rs1468675137 379 dbSNP
rs782450940 385 dbSNP
rs587671171 386 dbSNP
rs1421244216 395 dbSNP
rs1160208333 411 dbSNP
rs192318619 412 dbSNP
rs1460292608 415 dbSNP
rs1167230529 419 dbSNP
rs1395274383 420 dbSNP
rs1461719250 426 dbSNP
rs1296658951 430 dbSNP
rs372176893 432 dbSNP
rs187846627 435 dbSNP
rs1288693038 463 dbSNP
rs1354772645 476 dbSNP
rs1231342994 483 dbSNP
rs587638248 495 dbSNP
rs1334903688 498 dbSNP
rs1203460052 508 dbSNP
rs1249264857 516 dbSNP
rs1481378817 520 dbSNP
rs1178162401 529 dbSNP
rs1257207739 534 dbSNP
rs1474536083 535 dbSNP
rs1190672231 536 dbSNP
rs1418744458 538 dbSNP
rs587764839 543 dbSNP
rs587712827 547 dbSNP
rs1356513694 550 dbSNP
rs1462648814 553 dbSNP
rs1308446964 556 dbSNP
rs587651267 560 dbSNP
rs1412920122 568 dbSNP
rs1295046407 572 dbSNP
rs1379713214 580 dbSNP
rs1213493525 587 dbSNP
rs1292762883 588 dbSNP
rs1308925634 597 dbSNP
rs1204739766 598 dbSNP
rs587773417 598 dbSNP
rs1484890095 599 dbSNP
rs1213731860 605 dbSNP
rs1258836496 611 dbSNP
rs1475344452 614 dbSNP
rs1184886277 615 dbSNP
rs1421697336 616 dbSNP
rs1429385490 629 dbSNP
rs1173233627 632 dbSNP
rs587719404 643 dbSNP
rs1432631777 644 dbSNP
rs587662399 652 dbSNP
rs1314421052 653 dbSNP
rs1359695225 655 dbSNP
rs1286652819 656 dbSNP
rs1363426334 657 dbSNP
rs1228765124 665 dbSNP
rs1302236303 672 dbSNP
rs1345215274 673 dbSNP
rs1236979297 683 dbSNP
rs1279731652 693 dbSNP
rs587775442 695 dbSNP
rs112617808 703 dbSNP
rs1243975281 704 dbSNP
rs1486232601 707 dbSNP
rs1193012200 710 dbSNP
rs1393513857 725 dbSNP
rs1455709200 728 dbSNP
rs1175319754 733 dbSNP
rs1425569702 737 dbSNP
rs587683385 738 dbSNP
rs1156826587 745 dbSNP
rs376214382 754 dbSNP
rs1324574415 755 dbSNP
rs1368368404 757 dbSNP
rs1442606669 762 dbSNP
rs1275857238 768 dbSNP
rs1350389282 774 dbSNP
rs1222629086 775 dbSNP
rs1286961317 785 dbSNP
rs1330351916 798 dbSNP
rs1213166697 799 dbSNP
rs1251177401 800 dbSNP
rs1470027050 804 dbSNP
rs1199824364 806 dbSNP
rs1247127987 807 dbSNP
rs1175202860 811 dbSNP
rs587736441 812 dbSNP
rs1410090096 816 dbSNP
rs1457660270 819 dbSNP
rs1163630205 829 dbSNP
rs1391621135 833 dbSNP
rs1462739186 838 dbSNP
rs1323803942 842 dbSNP
rs1334737420 844 dbSNP
rs1440482672 848 dbSNP
rs1281585610 861 dbSNP
rs201767294 862 dbSNP
rs1233179228 863 dbSNP
rs1271402543 865 dbSNP
rs1210736694 868 dbSNP
rs1337025700 868 dbSNP
rs1272571206 872 dbSNP
rs1436237239 872 dbSNP
rs1179428657 878 dbSNP
rs1253662456 886 dbSNP
rs1472903730 887 dbSNP
rs1187116284 891 dbSNP
rs1415105203 896 dbSNP
rs1475904877 897 dbSNP
rs1395351325 900 dbSNP
rs1331343047 905 dbSNP
rs1407816367 905 dbSNP
rs1371536810 911 dbSNP
rs1414778107 912 dbSNP
rs1291975621 920 dbSNP
rs1357845753 921 dbSNP
rs1245634161 924 dbSNP
rs1269623125 925 dbSNP
rs1337736091 930 dbSNP
rs1197750039 931 dbSNP
rs1276578785 934 dbSNP
rs1483255733 937 dbSNP
rs1209798970 938 dbSNP
rs1255334969 941 dbSNP
rs1444016113 947 dbSNP
rs1187674942 959 dbSNP
rs1371968574 961 dbSNP
rs1474251668 962 dbSNP
rs1170081688 964 dbSNP
rs1391240095 965 dbSNP
rs1434496776 968 dbSNP
rs1311384743 969 dbSNP
rs1377824773 975 dbSNP
rs1397085237 979 dbSNP
rs1317779982 980 dbSNP
rs1324744113 982 dbSNP
rs1229973259 997 dbSNP
rs1298611561 1001 dbSNP
rs1347351122 1012 dbSNP
rs1233319620 1021 dbSNP
rs1277875675 1022 dbSNP
rs1347088293 1029 dbSNP
rs1200942825 1031 dbSNP
rs1260502356 1032 dbSNP
rs1444777257 1034 dbSNP
rs1189863695 1044 dbSNP
rs1248277189 1046 dbSNP
rs1453373307 1051 dbSNP
rs1172203709 1064 dbSNP
rs1379705899 1072 dbSNP
rs587686008 1073 dbSNP
rs1158488005 1080 dbSNP
rs761085976 1089 dbSNP
rs1384006291 1092 dbSNP
rs1321245183 1094 dbSNP
rs1370571468 1097 dbSNP
rs1438941424 1103 dbSNP
rs1313728008 1104 dbSNP
rs1260080481 1105 dbSNP
rs1348387607 1127 dbSNP
rs1210081431 1133 dbSNP
rs1268168544 1141 dbSNP
rs1467786939 1142 dbSNP
rs1191340520 1143 dbSNP
rs782768743 1147 dbSNP
rs1434121208 1152 dbSNP
rs1181461910 1153 dbSNP
rs587630464 1161 dbSNP
rs1362591913 1169 dbSNP
rs1459247925 1170 dbSNP
rs1160050731 1173 dbSNP
rs1393800762 1178 dbSNP
rs1295501504 1182 dbSNP
rs1368494406 1183 dbSNP
rs587671507 1184 dbSNP
rs1305969094 1197 dbSNP
rs587597096 1199 dbSNP
rs1230123810 1200 dbSNP
rs1288488312 1201 dbSNP
rs1333514082 1204 dbSNP
rs1211200625 1223 dbSNP
rs1266854892 1226 dbSNP
rs1488573539 1230 dbSNP
rs1195617977 1231 dbSNP
rs1248819748 1236 dbSNP
rs1473885554 1242 dbSNP
rs374207039 1243 dbSNP
rs1417327324 1246 dbSNP
rs1474270841 1248 dbSNP
rs1166932705 1249 dbSNP
rs1350712210 1256 dbSNP
rs1461637200 1260 dbSNP
rs1368450862 1262 dbSNP
rs1411653311 1264 dbSNP
rs1288910424 1275 dbSNP
rs1354673784 1276 dbSNP
rs1226136222 1285 dbSNP
rs1314195600 1288 dbSNP
rs1321988236 1288 dbSNP
rs1226210937 1289 dbSNP
rs1250036236 1293 dbSNP
rs8726 1294 dbSNP
rs1257451283 1295 dbSNP
rs1484949830 1298 dbSNP
rs1183705687 1301 dbSNP
rs1414590257 1311 dbSNP
rs1428196723 1316 dbSNP
rs376074918 1318 dbSNP
rs1392179975 1319 dbSNP
rs1431410198 1320 dbSNP
rs1308353310 1325 dbSNP
rs1374803977 1332 dbSNP
rs1445689138 1334 dbSNP
rs1304126462 1339 dbSNP
rs1379247973 1343 dbSNP
rs1294952369 1344 dbSNP
rs1381369184 1344 dbSNP
rs587673124 1353 dbSNP
rs1229633854 1362 dbSNP
rs1280015351 1368 dbSNP
rs1346394798 1372 dbSNP
rs1212835577 1377 dbSNP
rs1238185681 1394 dbSNP
rs1485585290 1401 dbSNP
rs1184795089 1405 dbSNP
rs1250156408 1421 dbSNP
rs1450278992 1429 dbSNP
rs1169027590 1437 dbSNP
rs773689077 1438 dbSNP
rs1412745699 1445 dbSNP
rs1178133973 1446 dbSNP
rs1359604874 1448 dbSNP
rs1317900062 1450 dbSNP
rs1429430099 1450 dbSNP
rs1366959091 1451 dbSNP
rs1435328346 1467 dbSNP
rs1303197803 1468 dbSNP
rs1365916004 1472 dbSNP
rs1221502465 1473 dbSNP
rs1279964847 1474 dbSNP
rs1316790727 1475 dbSNP
rs1206934323 1478 dbSNP
rs1270056234 1479 dbSNP
rs1465551685 1485 dbSNP
rs113975841 1487 dbSNP
rs1252216255 1490 dbSNP
rs1476921184 1492 dbSNP
rs1192653643 1495 dbSNP
rs1425815754 1499 dbSNP
rs1156371474 1512 dbSNP
rs1457501069 1513 dbSNP
rs150748305 1513 dbSNP
rs1324804095 1514 dbSNP
rs1347691251 1521 dbSNP
rs1439075308 1529 dbSNP
rs1275767655 1531 dbSNP
rs1373298507 1532 dbSNP
rs1227069716 1535 dbSNP
rs1290355222 1540 dbSNP
rs1329927914 1547 dbSNP
rs1213075102 1554 dbSNP
rs1288009783 1555 dbSNP
rs1453494487 1557 dbSNP
rs1223536767 1560 dbSNP
rs1247037646 1567 dbSNP
rs1469609999 1568 dbSNP
rs1179914052 1572 dbSNP
rs1413623365 1578 dbSNP
rs1472638348 1579 dbSNP
rs1163514076 1585 dbSNP
rs1388167151 1591 dbSNP
rs2868107 1594 dbSNP
rs1324674276 1599 dbSNP
rs894221811 1602 dbSNP
rs1408608434 1607 dbSNP
rs1310392856 1612 dbSNP
rs1351578884 1613 dbSNP
rs1232775564 1615 dbSNP
rs1282462004 1617 dbSNP
rs2868105 1618 dbSNP
rs1229084523 1629 dbSNP
rs2868104 1631 dbSNP
rs772507848 1632 dbSNP
rs1202684110 1635 dbSNP
rs587664426 1639 dbSNP
rs587771120 1640 dbSNP
rs1186273708 1642 dbSNP
rs1366175822 1650 dbSNP
rs1473606858 1651 dbSNP
rs1163474244 1655 dbSNP
rs1418265735 1657 dbSNP
rs1428237599 1659 dbSNP
rs1170820825 1662 dbSNP
rs1371749050 1666 dbSNP
rs1414675176 1683 dbSNP
rs1332332423 1686 dbSNP
rs1342331240 1691 dbSNP
rs1449120000 1696 dbSNP
rs1269836967 1708 dbSNP
rs868932894 1709 dbSNP
rs587692619 1721 dbSNP
rs1199790615 1725 dbSNP
rs1342840248 1725 dbSNP
rs1253545838 1731 dbSNP
rs1443645980 1734 dbSNP
rs1187567396 1735 dbSNP
rs587629187 1735 dbSNP
rs1428167432 1736 dbSNP
rs1190954684 1754 dbSNP
rs1391148833 1761 dbSNP
rs1466031591 1766 dbSNP
rs1171335069 1768 dbSNP
rs1404881492 1771 dbSNP
rs1415238550 1775 dbSNP
rs1363075270 1777 dbSNP
rs1437399283 1778 dbSNP
rs3973318 1780 dbSNP
rs779238746 1782 dbSNP
rs3973317 1790 dbSNP
rs1254014331 1797 dbSNP
rs1346921605 1800 dbSNP
rs1200644952 1805 dbSNP
rs1463123290 1806 dbSNP
rs1189954056 1808 dbSNP
rs1249113992 1809 dbSNP
rs1433106204 1814 dbSNP
rs1197438986 1816 dbSNP
rs1379707110 1820 dbSNP
rs1478581618 1821 dbSNP
rs587759511 1825 dbSNP
rs587681078 1826 dbSNP
rs11538591 1828 dbSNP
rs1321296078 1829 dbSNP
rs1458829831 1829 dbSNP
rs1393911977 1830 dbSNP
rs1386122343 1831 dbSNP
rs587628689 1833 dbSNP
rs1299156806 1834 dbSNP
rs1332564913 1838 dbSNP
rs1233734099 1840 dbSNP
rs1287256575 1841 dbSNP
rs2868103 1842 dbSNP
rs387740 1843 dbSNP
rs1268189099 1846 dbSNP
rs1487899111 1847 dbSNP
rs1208539714 1861 dbSNP
rs1270127477 1867 dbSNP
rs3973316 1868 dbSNP
rs1181917563 1871 dbSNP
rs782091630 1876 dbSNP
rs183511957 1877 dbSNP
rs1160246551 1879 dbSNP
rs1456484393 1882 dbSNP
rs1291665110 1883 dbSNP
rs1392809822 1899 dbSNP
rs1307171564 1901 dbSNP
rs1348459775 1905 dbSNP
rs1229824111 1911 dbSNP
rs1288627958 1913 dbSNP
rs1242004558 1915 dbSNP
rs1320544076 1915 dbSNP
rs1267687625 1922 dbSNP
rs1489092277 1925 dbSNP
rs1205149242 1956 dbSNP
rs1250038623 1961 dbSNP
rs1484264724 1969 dbSNP
rs1183116750 1976 dbSNP
rs1255765488 1981 dbSNP
rs1422071904 1982 dbSNP
rs587622152 1983 dbSNP
rs1167004177 1997 dbSNP
rs1369194690 1999 dbSNP
rs587740294 2005 dbSNP
rs1368432134 2007 dbSNP
rs587664885 2008 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||||   ||||||| 
Target 5' guuuccCCAUUUCUUGCUGCUg 3'
17 - 38
2
miRNA  3' guguuugguaauacACGACgau 5'
                        | |||   
Target 5' -----------cccUUCUGggg 3'
1 - 11
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000257665.5 | 3UTR | CCCUUCUGGGGACUCUGUUUCCCCAUUUCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.33 3.9e-3 -0.320 5.0e-3 64 Click to see details
GSE32688 Pancreatic cancer -0.166 1.8e-1 0.002 5.0e-1 32 Click to see details
GSE28260 Renal cortex and medulla 0.237 2.2e-1 0.071 4.1e-1 13 Click to see details
GSE21032 Prostate cancer 0.071 2.6e-1 0.073 2.6e-1 83 Click to see details
GSE19350 CNS germ cell tumors -0.154 3.2e-1 -0.091 3.9e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.075 3.7e-1 0.056 4.0e-1 23 Click to see details
GSE17306 Multiple myeloma -0.017 4.5e-1 -0.135 1.8e-1 49 Click to see details
GSE28544 Breast cancer 0.004 4.9e-1 -0.150 2.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.261 0.02 -0.229 0.04 59 Click to see details
COAD 0.657 0.04 0.833 0.01 8 Click to see details
KIRC -0.204 0.05 -0.214 0.04 68 Click to see details
HNSC 0.247 0.06 0.224 0.08 42 Click to see details
PAAD 0.843 0.08 0.400 0.3 4 Click to see details
LIHC 0.198 0.09 0.183 0.1 49 Click to see details
STAD -0.24 0.09 -0.349 0.03 32 Click to see details
PRAD 0.187 0.1 0.288 0.02 50 Click to see details
CHOL -0.422 0.13 -0.267 0.24 9 Click to see details
LUAD 0.334 0.14 0.280 0.19 12 Click to see details
CESC -0.778 0.22 -0.500 0.33 3 Click to see details
KIRP -0.132 0.24 -0.173 0.17 32 Click to see details
ESCA 0.219 0.26 0.073 0.42 11 Click to see details
UCEC -0.139 0.29 -0.242 0.16 19 Click to see details
BLCA -0.119 0.32 -0.183 0.23 18 Click to see details
PCPG -0.487 0.34 -0.500 0.33 3 Click to see details
BRCA -0.036 0.37 -0.020 0.43 84 Click to see details
LUSC 0.043 0.4 0.032 0.42 38 Click to see details
KICH -0.027 0.45 0.126 0.27 25 Click to see details
KICH -0.027 0.45 0.126 0.27 25 Click to see details
KICH -0.027 0.45 0.126 0.27 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*