miRTarBase - #MIRT518095 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TRIM35   
Synonyms HLS5, MAIR
Description tripartite motif containing 35
Transcript NM_171982   
Putative miRNA Targets on TRIM35
3'UTR of TRIM35
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguUUGGUAAUA-----CACGACGAu 5'
              :||:|||||      ||||||| 
2108 - 2134 158.00 -14.30
miRNA  3' guguuuGGUAAUA-C-ACGACGau 5'
                |::|||| | |||||:  
Target 5' gatgtcCTGTTATAGTTGCTGTgg 3'
1043 - 1066 120.00 -9.90
            |||||||    |||| |||  
Target 5' ggCAAACCA----GTGCATGCac 3'
1643 - 1661 114.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30118416 19 COSMIC
COSN28850349 28 COSMIC
COSN28868470 89 COSMIC
COSN30526890 117 COSMIC
COSN30538084 134 COSMIC
COSN1363259 288 COSMIC
COSN505886 1072 COSMIC
COSN22052754 1075 COSMIC
COSN18719708 1412 COSMIC
COSN26785222 1645 COSMIC
COSN15664599 1648 COSMIC
COSN20091775 1837 COSMIC
COSN20105323 1872 COSMIC
COSN9260245 2324 COSMIC
COSN21751313 2418 COSMIC
COSN21332277 2559 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1412840513 2 dbSNP
rs529692872 5 dbSNP
rs749203501 6 dbSNP
rs777679871 7 dbSNP
rs188399705 8 dbSNP
rs372337575 9 dbSNP
rs1175234838 11 dbSNP
rs780152117 12 dbSNP
rs1387200552 15 dbSNP
rs758641007 16 dbSNP
rs1222405158 17 dbSNP
rs112723421 19 dbSNP
rs368728206 20 dbSNP
rs373750792 23 dbSNP
rs989709614 24 dbSNP
rs754299484 34 dbSNP
rs764597989 38 dbSNP
rs760964927 39 dbSNP
rs1373335234 40 dbSNP
rs758027068 48 dbSNP
rs1275893992 51 dbSNP
rs1223562978 53 dbSNP
rs374039704 55 dbSNP
rs1450197807 61 dbSNP
rs954444391 62 dbSNP
rs1030152247 65 dbSNP
rs1281155191 68 dbSNP
rs1472336726 71 dbSNP
rs1001899902 73 dbSNP
rs995959683 82 dbSNP
rs900467676 84 dbSNP
rs559141942 88 dbSNP
rs867540583 89 dbSNP
rs562895274 90 dbSNP
rs1392848725 91 dbSNP
rs1045741551 92 dbSNP
rs1349793936 93 dbSNP
rs1407501553 95 dbSNP
rs946118592 96 dbSNP
rs1294573202 98 dbSNP
rs1047038414 101 dbSNP
rs1307036808 105 dbSNP
rs1224582461 108 dbSNP
rs913349759 111 dbSNP
rs1263250419 117 dbSNP
rs1354706928 122 dbSNP
rs747515049 125 dbSNP
rs936203254 127 dbSNP
rs546373401 133 dbSNP
rs1046638550 134 dbSNP
rs1180165594 140 dbSNP
rs1259725214 147 dbSNP
rs1424430197 148 dbSNP
rs975031031 151 dbSNP
rs577060739 156 dbSNP
rs966729760 157 dbSNP
rs990152546 167 dbSNP
rs527452889 171 dbSNP
rs1291583949 174 dbSNP
rs1168958473 184 dbSNP
rs1457285413 190 dbSNP
rs1369928422 195 dbSNP
rs936915887 203 dbSNP
rs1345743274 204 dbSNP
rs912229342 205 dbSNP
rs1455687502 206 dbSNP
rs1411375400 207 dbSNP
rs1231122905 209 dbSNP
rs977715725 212 dbSNP
rs1481551251 215 dbSNP
rs986487938 216 dbSNP
rs951096169 231 dbSNP
rs554026480 232 dbSNP
rs534246820 233 dbSNP
rs1199937717 237 dbSNP
rs574464084 238 dbSNP
rs1430500442 242 dbSNP
rs1189403205 244 dbSNP
rs962574601 245 dbSNP
rs1326453706 252 dbSNP
rs1267002060 253 dbSNP
rs1447369092 259 dbSNP
rs866711173 260 dbSNP
rs138361672 270 dbSNP
rs1359661625 271 dbSNP
rs1223684504 281 dbSNP
rs778199691 294 dbSNP
rs1300531965 296 dbSNP
rs1386743724 297 dbSNP
rs1435388953 299 dbSNP
rs1347008471 300 dbSNP
rs1298868263 309 dbSNP
rs1364928991 320 dbSNP
rs1226572235 327 dbSNP
rs1304126981 329 dbSNP
rs1386029640 332 dbSNP
rs974427211 334 dbSNP
rs4279551 335 dbSNP
rs1466280427 337 dbSNP
rs1209605926 340 dbSNP
rs569335460 344 dbSNP
rs1006572464 352 dbSNP
rs950648259 358 dbSNP
rs1024249554 360 dbSNP
rs150694781 361 dbSNP
rs906492212 373 dbSNP
rs1046524358 383 dbSNP
rs1457246874 385 dbSNP
rs538821478 390 dbSNP
rs1177254335 397 dbSNP
rs1433401267 397 dbSNP
rs1010207829 398 dbSNP
rs891860447 406 dbSNP
rs141973146 408 dbSNP
rs1175687892 417 dbSNP
rs936134076 419 dbSNP
rs184062056 420 dbSNP
rs1264384412 421 dbSNP
rs1187208393 426 dbSNP
rs1039650565 433 dbSNP
rs944922027 434 dbSNP
rs924209731 442 dbSNP
rs1246802496 445 dbSNP
rs1042078431 448 dbSNP
rs1253811901 449 dbSNP
rs530035616 454 dbSNP
rs986435710 458 dbSNP
rs929646249 461 dbSNP
rs191835953 463 dbSNP
rs1307853129 465 dbSNP
rs1164988986 466 dbSNP
rs1350841450 468 dbSNP
rs918298709 483 dbSNP
rs148165351 484 dbSNP
rs1352860169 489 dbSNP
rs962810382 490 dbSNP
rs1034182324 491 dbSNP
rs373657290 512 dbSNP
rs529375631 516 dbSNP
rs971260862 520 dbSNP
rs1290779617 523 dbSNP
rs1454629730 532 dbSNP
rs964472310 549 dbSNP
rs564981621 553 dbSNP
rs1483329313 558 dbSNP
rs1249022754 566 dbSNP
rs112570847 572 dbSNP
rs1462737195 575 dbSNP
rs1375079534 576 dbSNP
rs1182097110 588 dbSNP
rs1412599555 589 dbSNP
rs1405206609 590 dbSNP
rs1162019397 597 dbSNP
rs1167100972 597 dbSNP
rs1010155577 601 dbSNP
rs891806823 610 dbSNP
rs1033461691 613 dbSNP
rs1000284089 614 dbSNP
rs1386434285 616 dbSNP
rs1186016518 620 dbSNP
rs900608344 624 dbSNP
rs1253545842 636 dbSNP
rs190210415 640 dbSNP
rs375121287 649 dbSNP
rs890688192 652 dbSNP
rs1048011281 661 dbSNP
rs1276465868 664 dbSNP
rs11557589 668 dbSNP
rs1272312660 670 dbSNP
rs562078340 670 dbSNP
rs1443696883 688 dbSNP
rs1210198133 689 dbSNP
rs540491106 691 dbSNP
rs574801244 692 dbSNP
rs185366880 694 dbSNP
rs970729815 695 dbSNP
rs1024955869 697 dbSNP
rs1392455888 697 dbSNP
rs145840743 699 dbSNP
rs895218883 700 dbSNP
rs1312107929 717 dbSNP
rs941099623 720 dbSNP
rs543676316 724 dbSNP
rs1306503632 727 dbSNP
rs1322730167 728 dbSNP
rs1227375449 729 dbSNP
rs1295397550 732 dbSNP
rs1429487736 734 dbSNP
rs1001040228 742 dbSNP
rs1219352616 744 dbSNP
rs1366625018 760 dbSNP
rs558988975 761 dbSNP
rs971210099 767 dbSNP
rs1248200542 772 dbSNP
rs539158141 784 dbSNP
rs1371892499 788 dbSNP
rs1472128373 788 dbSNP
rs933547811 790 dbSNP
rs576377223 792 dbSNP
rs955996650 794 dbSNP
rs867664624 805 dbSNP
rs1172682746 806 dbSNP
rs193209865 808 dbSNP
rs1253498417 809 dbSNP
rs1202641973 812 dbSNP
rs1434140707 819 dbSNP
rs553216319 824 dbSNP
rs536506959 830 dbSNP
rs1332553127 836 dbSNP
rs964795149 846 dbSNP
rs1437151676 852 dbSNP
rs1274111782 855 dbSNP
rs1292305668 867 dbSNP
rs984907492 880 dbSNP
rs1268443179 881 dbSNP
rs929161534 887 dbSNP
rs1208549164 889 dbSNP
rs919062860 899 dbSNP
rs981374357 905 dbSNP
rs971285205 908 dbSNP
rs879193702 910 dbSNP
rs1479534553 914 dbSNP
rs1239884054 919 dbSNP
rs1018124409 920 dbSNP
rs1286648831 924 dbSNP
rs990828789 926 dbSNP
rs1392626871 938 dbSNP
rs1405682666 939 dbSNP
rs959761896 945 dbSNP
rs1343562812 960 dbSNP
rs1032431779 963 dbSNP
rs761455947 964 dbSNP
rs1288406039 972 dbSNP
rs111339400 973 dbSNP
rs188815263 974 dbSNP
rs111738517 975 dbSNP
rs1358973933 976 dbSNP
rs550643465 979 dbSNP
rs28517329 981 dbSNP
rs1489995749 982 dbSNP
rs902093758 987 dbSNP
rs1038013375 993 dbSNP
rs941043604 995 dbSNP
rs762613503 998 dbSNP
rs1044135205 1003 dbSNP
rs1038712886 1004 dbSNP
rs949837917 1008 dbSNP
rs571180882 1009 dbSNP
rs1473043831 1010 dbSNP
rs1453819959 1012 dbSNP
rs1413623268 1015 dbSNP
rs917078263 1026 dbSNP
rs988629228 1037 dbSNP
rs1179556984 1055 dbSNP
rs1431577241 1055 dbSNP
rs955970154 1058 dbSNP
rs1472069317 1075 dbSNP
rs1389160831 1078 dbSNP
rs774954238 1083 dbSNP
rs925874889 1092 dbSNP
rs1246046408 1093 dbSNP
rs1269248677 1095 dbSNP
rs978761172 1096 dbSNP
rs1200769589 1097 dbSNP
rs1485015030 1099 dbSNP
rs1482804946 1131 dbSNP
rs965075448 1134 dbSNP
rs373700110 1145 dbSNP
rs1449745291 1150 dbSNP
rs551031134 1157 dbSNP
rs1443195203 1158 dbSNP
rs1048816267 1161 dbSNP
rs769330851 1166 dbSNP
rs868048088 1167 dbSNP
rs1389474428 1168 dbSNP
rs954813329 1171 dbSNP
rs1460060776 1175 dbSNP
rs182146891 1178 dbSNP
rs993694074 1179 dbSNP
rs1266376762 1191 dbSNP
rs1227953472 1198 dbSNP
rs1334205260 1202 dbSNP
rs949982724 1206 dbSNP
rs796862323 1210 dbSNP
rs560272491 1211 dbSNP
rs1038363304 1217 dbSNP
rs1005185617 1225 dbSNP
rs112213072 1226 dbSNP
rs1257859955 1228 dbSNP
rs1345760254 1232 dbSNP
rs140657160 1238 dbSNP
rs1330928787 1247 dbSNP
rs1319557794 1259 dbSNP
rs1384484920 1265 dbSNP
rs1032867362 1266 dbSNP
rs1188930186 1268 dbSNP
rs1156319231 1272 dbSNP
rs905520772 1274 dbSNP
rs1456341267 1288 dbSNP
rs979436413 1289 dbSNP
rs1465061239 1292 dbSNP
rs1044079458 1299 dbSNP
rs1390382206 1311 dbSNP
rs949787438 1314 dbSNP
rs1437778180 1316 dbSNP
rs917026067 1320 dbSNP
rs1321618805 1322 dbSNP
rs1476900612 1327 dbSNP
rs76599809 1330 dbSNP
rs1193791009 1331 dbSNP
rs1466208607 1338 dbSNP
rs530276761 1344 dbSNP
rs1222978596 1351 dbSNP
rs1261542058 1357 dbSNP
rs934506832 1361 dbSNP
rs775878989 1363 dbSNP
rs997728539 1364 dbSNP
rs1484730195 1365 dbSNP
rs1363112297 1366 dbSNP
rs1302184138 1367 dbSNP
rs1284910194 1371 dbSNP
rs1419973548 1381 dbSNP
rs1362041738 1383 dbSNP
rs561612745 1385 dbSNP
rs902144577 1386 dbSNP
rs1156748305 1388 dbSNP
rs1418222106 1390 dbSNP
rs1267961166 1392 dbSNP
rs1425800210 1395 dbSNP
rs1017765706 1398 dbSNP
rs1481476469 1407 dbSNP
rs1413786233 1408 dbSNP
rs752293106 1408 dbSNP
rs1457464129 1411 dbSNP
rs979094564 1412 dbSNP
rs943331972 1416 dbSNP
rs1350033630 1417 dbSNP
rs1198757478 1420 dbSNP
rs1488771087 1437 dbSNP
rs1344978117 1441 dbSNP
rs1262713887 1443 dbSNP
rs1214100157 1444 dbSNP
rs771743628 1446 dbSNP
rs1316645325 1450 dbSNP
rs910551089 1451 dbSNP
rs759157646 1453 dbSNP
rs1344139262 1458 dbSNP
rs1282144192 1461 dbSNP
rs1400075415 1463 dbSNP
rs60238110 1466 dbSNP
rs1404461997 1467 dbSNP
rs987491307 1468 dbSNP
rs1286696998 1469 dbSNP
rs887517078 1470 dbSNP
rs1271155363 1477 dbSNP
rs761234731 1480 dbSNP
rs1049303877 1487 dbSNP
rs993134940 1496 dbSNP
rs191519722 1512 dbSNP
rs1490160667 1521 dbSNP
rs75849721 1522 dbSNP
rs1433678976 1523 dbSNP
rs1359273567 1527 dbSNP
rs1472595189 1529 dbSNP
rs1026420449 1533 dbSNP
rs1335775094 1541 dbSNP
rs949945038 1544 dbSNP
rs915863184 1548 dbSNP
rs112774263 1550 dbSNP
rs1055617580 1554 dbSNP
rs1424616116 1555 dbSNP
rs972221547 1557 dbSNP
rs545480663 1562 dbSNP
rs935854619 1583 dbSNP
rs1372500168 1587 dbSNP
rs1410498286 1588 dbSNP
rs138892684 1597 dbSNP
rs112061779 1598 dbSNP
rs1388225830 1614 dbSNP
rs540251112 1619 dbSNP
rs1229873842 1623 dbSNP
rs1461824087 1628 dbSNP
rs558100728 1629 dbSNP
rs1013890113 1632 dbSNP
rs913903378 1638 dbSNP
rs1483131290 1650 dbSNP
rs557197090 1653 dbSNP
rs1230869907 1657 dbSNP
rs1484041946 1659 dbSNP
rs868496392 1662 dbSNP
rs1386250305 1675 dbSNP
rs1444328330 1677 dbSNP
rs772641088 1680 dbSNP
rs1052805201 1684 dbSNP
rs934477033 1687 dbSNP
rs1207765178 1688 dbSNP
rs186906901 1694 dbSNP
rs1042931372 1695 dbSNP
rs1381788211 1699 dbSNP
rs943260358 1705 dbSNP
rs571185713 1717 dbSNP
rs1379247936 1721 dbSNP
rs1299781897 1723 dbSNP
rs1342756006 1726 dbSNP
rs1213869046 1731 dbSNP
rs1027372513 1732 dbSNP
rs1313369994 1737 dbSNP
rs1285461477 1738 dbSNP
rs1445269283 1744 dbSNP
rs76851225 1745 dbSNP
rs1308311992 1747 dbSNP
rs773679812 1748 dbSNP
rs1368548701 1754 dbSNP
rs1250497393 1756 dbSNP
rs1476042619 1760 dbSNP
rs1167807237 1765 dbSNP
rs1417468415 1770 dbSNP
rs987438996 1775 dbSNP
rs141234666 1777 dbSNP
rs1045416962 1789 dbSNP
rs1450242846 1799 dbSNP
rs1322326285 1803 dbSNP
rs1365609986 1811 dbSNP
rs1415971336 1819 dbSNP
rs1268284578 1821 dbSNP
rs145155391 1822 dbSNP
rs1262166941 1829 dbSNP
rs1472561670 1830 dbSNP
rs1013956176 1833 dbSNP
rs1233643810 1837 dbSNP
rs894371564 1841 dbSNP
rs1240852687 1842 dbSNP
rs77203675 1843 dbSNP
rs368531184 1853 dbSNP
rs1225508915 1861 dbSNP
rs1482273952 1862 dbSNP
rs972553185 1862 dbSNP
rs548708187 1863 dbSNP
rs1161558313 1864 dbSNP
rs1399878880 1866 dbSNP
rs530294208 1866 dbSNP
rs935817519 1867 dbSNP
rs1324032355 1868 dbSNP
rs1351512673 1868 dbSNP
rs561345805 1869 dbSNP
rs1343053797 1871 dbSNP
rs925784113 1871 dbSNP
rs1041574510 1872 dbSNP
rs538994660 1873 dbSNP
rs551221354 1873 dbSNP
rs1226096636 1880 dbSNP
rs1377863730 1882 dbSNP
rs1288583274 1883 dbSNP
rs1184677300 1884 dbSNP
rs1223824493 1884 dbSNP
rs1268275690 1884 dbSNP
rs1348781420 1884 dbSNP
rs1453856713 1884 dbSNP
rs1469472021 1884 dbSNP
rs1479462025 1884 dbSNP
rs34388696 1884 dbSNP
rs374374994 1884 dbSNP
rs397891279 1884 dbSNP
rs397892940 1884 dbSNP
rs770339097 1884 dbSNP
rs778357845 1884 dbSNP
rs1329209924 1885 dbSNP
rs1236369453 1886 dbSNP
rs1334775352 1886 dbSNP
rs1278174294 1887 dbSNP
rs1358829448 1889 dbSNP
rs1411340932 1890 dbSNP
rs531120202 1892 dbSNP
rs10098291 1893 dbSNP
rs1489898314 1894 dbSNP
rs1207339288 1901 dbSNP
rs1251573349 1906 dbSNP
rs1437489861 1910 dbSNP
rs141707933 1924 dbSNP
rs976037725 1924 dbSNP
rs1162916416 1925 dbSNP
rs1383300459 1927 dbSNP
rs966036678 1928 dbSNP
rs1167968692 1929 dbSNP
rs986797045 1940 dbSNP
rs1335715453 1945 dbSNP
rs1385505700 1952 dbSNP
rs1453828218 1958 dbSNP
rs774879974 1974 dbSNP
rs980992921 1979 dbSNP
rs1357894565 1980 dbSNP
rs1162652643 1982 dbSNP
rs952206956 1990 dbSNP
rs1412873788 2011 dbSNP
rs768979153 2015 dbSNP
rs1025197542 2020 dbSNP
rs993699143 2021 dbSNP
rs545420675 2024 dbSNP
rs1024083137 2025 dbSNP
rs1013902828 2034 dbSNP
rs894144197 2036 dbSNP
rs1200640072 2037 dbSNP
rs749562422 2040 dbSNP
rs1460013868 2045 dbSNP
rs182616617 2046 dbSNP
rs1013834695 2047 dbSNP
rs1221566334 2049 dbSNP
rs1380990080 2050 dbSNP
rs150167981 2052 dbSNP
rs1384427787 2053 dbSNP
rs1296853863 2054 dbSNP
rs542779786 2056 dbSNP
rs1000520111 2058 dbSNP
rs895493036 2061 dbSNP
rs1225329394 2062 dbSNP
rs1265275015 2068 dbSNP
rs140907839 2079 dbSNP
rs999005180 2096 dbSNP
rs1041519913 2099 dbSNP
rs1466041819 2104 dbSNP
rs1187095796 2105 dbSNP
rs1260953811 2112 dbSNP
rs1426256838 2116 dbSNP
rs1200339537 2121 dbSNP
rs945907948 2128 dbSNP
rs892528019 2135 dbSNP
rs371129207 2137 dbSNP
rs1326678237 2142 dbSNP
rs780277341 2144 dbSNP
rs904292978 2146 dbSNP
rs1043267349 2148 dbSNP
rs944689583 2152 dbSNP
rs756206261 2160 dbSNP
rs1384832346 2166 dbSNP
rs1380653153 2183 dbSNP
rs943228794 2187 dbSNP
rs1285301823 2189 dbSNP
rs745974130 2203 dbSNP
rs910545704 2214 dbSNP
rs1223147314 2216 dbSNP
rs986188133 2219 dbSNP
rs1318572921 2220 dbSNP
rs1216197291 2229 dbSNP
rs556890396 2229 dbSNP
rs1484864240 2234 dbSNP
rs1224574668 2236 dbSNP
rs1435740353 2237 dbSNP
rs151005940 2241 dbSNP
rs1196917229 2244 dbSNP
rs1490027948 2244 dbSNP
rs1413713839 2256 dbSNP
rs1421291413 2259 dbSNP
rs1160262611 2265 dbSNP
rs1363535717 2266 dbSNP
rs1452301493 2271 dbSNP
rs920883507 2275 dbSNP
rs972206231 2276 dbSNP
rs1051690566 2295 dbSNP
rs1389393801 2296 dbSNP
rs1366335110 2299 dbSNP
rs1161468550 2300 dbSNP
rs577862409 2303 dbSNP
rs1301568039 2308 dbSNP
rs933260812 2315 dbSNP
rs1375767629 2321 dbSNP
rs1224491426 2322 dbSNP
rs780923488 2329 dbSNP
rs557675792 2338 dbSNP
rs191340197 2346 dbSNP
rs1248101381 2353 dbSNP
rs757246034 2354 dbSNP
rs1292397026 2358 dbSNP
rs565366226 2360 dbSNP
rs942097559 2363 dbSNP
rs1034425254 2367 dbSNP
rs1411533430 2372 dbSNP
rs1234303509 2381 dbSNP
rs909313626 2383 dbSNP
rs751303869 2388 dbSNP
rs981326282 2389 dbSNP
rs776910590 2400 dbSNP
rs969530040 2407 dbSNP
rs1438205717 2411 dbSNP
rs1020178423 2418 dbSNP
rs73241407 2420 dbSNP
rs758011538 2421 dbSNP
rs1161774522 2425 dbSNP
rs1356312769 2426 dbSNP
rs1372501926 2428 dbSNP
rs956991652 2429 dbSNP
rs1031732944 2430 dbSNP
rs535212859 2443 dbSNP
rs1370983328 2456 dbSNP
rs1454373672 2462 dbSNP
rs145260022 2483 dbSNP
rs1358621248 2485 dbSNP
rs1243620863 2493 dbSNP
rs752408543 2496 dbSNP
rs1274544059 2500 dbSNP
rs764958485 2520 dbSNP
rs1007368080 2522 dbSNP
rs1203446376 2563 dbSNP
rs1249252927 2564 dbSNP
rs888946018 2568 dbSNP
rs1456744207 2571 dbSNP
rs1185783260 2581 dbSNP
rs1244075368 2585 dbSNP
rs550899930 2586 dbSNP
rs758908513 2588 dbSNP
rs1180552206 2589 dbSNP
rs1248067307 2593 dbSNP
rs775182188 2606 dbSNP
rs75780439 2607 dbSNP
rs1352950515 2610 dbSNP
rs1470864606 2612 dbSNP
rs1036743196 2613 dbSNP
rs1450365440 2614 dbSNP
rs771944744 2615 dbSNP
rs930683233 2620 dbSNP
rs1362120957 2628 dbSNP
rs1213441951 2629 dbSNP
rs1270502036 2635 dbSNP
rs920821157 2644 dbSNP
rs1169792440 2655 dbSNP
rs1325271259 2656 dbSNP
rs565570633 2663 dbSNP
rs1264145418 2665 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23087.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguUUGGUAAUA-----CACGACGAu 5'
              :||:|||||      ||||||| 
6 - 32
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000305364.4 | 3UTR | CUACUUCUUGACUAUUAUACAUAAUGCUGCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.789 1.8e-5 -0.905 2.1e-8 20 Click to see details
GSE21032 Prostate cancer -0.31 2.2e-3 -0.219 2.3e-2 83 Click to see details
GSE14794 Lymphoblastoid cells -0.266 5.6e-3 -0.254 7.9e-3 90 Click to see details
GSE17306 Multiple myeloma 0.31 1.5e-2 0.332 9.9e-3 49 Click to see details
GSE32688 Pancreatic cancer 0.357 2.2e-2 0.154 2.0e-1 32 Click to see details
GSE19536 Breast cancer 0.201 2.2e-2 0.157 5.9e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.333 5.2e-2 0.352 4.2e-2 25 Click to see details
GSE19783 ER- ER- breast cancer 0.167 7.1e-2 0.116 1.5e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.301 8.1e-2 -0.258 1.2e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.294 8.2e-2 -0.330 5.8e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.308 9.3e-2 0.293 1.0e-1 20 Click to see details
GSE28544 Breast cancer 0.274 9.8e-2 0.643 3.5e-4 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.147 2.4e-1 -0.024 4.5e-1 25 Click to see details
GSE38226 Liver fibrosis 0.152 2.6e-1 0.244 1.4e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.148 2.9e-1 0.200 2.3e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.136 3.3e-1 -0.319 1.4e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.047 3.6e-1 -0.002 4.9e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.075 4.1e-1 -0.077 4.1e-1 12 Click to see details
GSE21849 B cell lymphoma 0.028 4.4e-1 0.056 3.9e-1 29 Click to see details
GSE21849 B cell lymphoma 0.028 4.4e-1 0.056 3.9e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD -0.503 0.05 -0.552 0.03 12 Click to see details
LUSC 0.25 0.07 0.305 0.03 38 Click to see details
STAD 0.264 0.07 0.227 0.11 32 Click to see details
LIHC 0.194 0.09 0.161 0.13 49 Click to see details
KIRP 0.198 0.14 0.183 0.16 32 Click to see details
PRAD -0.138 0.17 -0.255 0.04 50 Click to see details
KIRC 0.109 0.19 0.045 0.36 68 Click to see details
COAD -0.25 0.28 0.119 0.39 8 Click to see details
CESC 0.574 0.31 0.500 0.33 3 Click to see details
THCA 0.054 0.34 0.052 0.35 59 Click to see details
BRCA 0.043 0.35 0.024 0.41 84 Click to see details
CHOL 0.129 0.37 0.033 0.47 9 Click to see details
ESCA -0.081 0.41 -0.218 0.26 11 Click to see details
UCEC -0.049 0.42 -0.084 0.37 19 Click to see details
PAAD 0.145 0.43 -0.400 0.3 4 Click to see details
BLCA -0.032 0.45 -0.096 0.35 18 Click to see details
HNSC 0.02 0.45 0.004 0.49 42 Click to see details
KICH -0.021 0.46 -0.098 0.32 25 Click to see details
PCPG -0.122 0.46 0.500 0.33 3 Click to see details
PCPG -0.122 0.46 0.500 0.33 3 Click to see details
PCPG -0.122 0.46 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
Error report submission
Your e-Mail*