miRTarBase - #MIRT514020 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CAMSAP1   
Synonyms -
Description calmodulin regulated spectrin associated protein 1
Transcript NM_015447   
Expression
Putative miRNA Targets on CAMSAP1
3'UTR of CAMSAP1
(miRNA target sites are highlighted)
>CAMSAP1|NM_015447|3'UTR
   1 CCCCGGTGCAGCTGGCGTCCAAAGGGTGACCCAGACTCGTAAATGATGCCCTTGTGGCTGGCATCCAGAGGGTGCCACGG
  81 GGTCCTTATTTATTGTTTTCATCTATTTGGGTACGAAGTGTGCAAAGTCACAGACCTTTTGCAAAGAGGTTTCTAGACAG
 161 CAGAAGAAAACCCCTCTCTCAGCGCTCATCTCACGCAGAGGATGCCAGGCAGGGTGAGGATGGGGGAGTAGATGCCGCTT
 241 TTGCAGTGGCTCGCACTGCTGTGGCCACTGCTGACCACTGAGGCTCCCAGCGGAGGGTGTTCACAGCCAGGTCCCGGGCC
 321 ACGGAGCTCCCTTACTTGAAGTTCTCCTTCAGCATAGATTAGACGTGATCCACTTTGCTTTCTTGCTTCTCACCTCGCCC
 401 CCTTGCACATTGCCTGACACCCTCATATTGGCCAGCTGTAATCTCGTGACTATGGGACTGAGGCTCAATCTTGGCTTGGG
 481 GTGTTTGAATGTCTATAGCAAAGGAATTCATAATGGGAAATCTTTTTCATTTGAGAAATTGTATGATATTTATTGGTTGT
 561 GTCTACTGCCAACATTTATATCCAATTCTAAGATTTCTGAAAAAAAATTCTTATCCCTTGCTGCTCAGAAAAAGTTTACG
 641 GAAAACACCAGTTCACTAAAAGCACCGAAATCTGCAAAGCCTGTCTTCCGCTAGAACAACGTCTACAAATGTGAAGATGA
 721 TGACTTCTGGCACGCGGTCATGAGGGTGGGGAATGGCACTAGGAGCTGATGTTTGCCTCATTTAAAGTAGGCAAGCCGAG
 801 CCAACTGCAGCCATCATTCATTAAGTTTTGGGTAGTGCTCTAATGGTTTGTTCACTTTAATAAAGACAGATTTTGGTAAA
 881 GTAGAATATTTTTCATTCTGAGCATGTTTGTCCCAAAAGGTGATGCACTTAAGCTGACAGTCCCTTCAGTGGTTTTGTTA
 961 GGTCACGGCTTGTCCTGTCTGGATTCTGCATCTGGAAGCGCTGCATGCTCTCAGAGGAGCGTGCCGTTTCCCCTGTAGAT
1041 GGATACTTTTGTTTTGTTGCCTATTTAAAAACAATTAAGTGGTTATTTGCAGTTATTTCAGAACTCCAAGTAAGTGGATG
1121 GCTTTGGGTTCTTTCTGCCTTGGTCCCAATGGTGTTGATGCTTCTGTGGAGCGCGGACATTCCCAGGAGCAGGTGCGTGC
1201 CAGCCATGGCTGCCAGACACTGCTGCAACTGACCAGCTGCCGGAAGATTCTGGAGCCACTAACATTAGTTTTGCACATAT
1281 TTTCTTGGGAGTGTTACTTGAATCTATCTCAAACTGCAGAAAAAATCAAAAGATCAATAATTGGGAGAAAAAGAGACAAA
1361 TTTAACTGTTACATAATTTTAGATAGACAAAAAACATGAGTGAGTCGTGTACATAAGGAGGGAACATGGTACAGAAGGCT
1441 AGAAGGAATTATAGGTCTTATTCCCCTTTCCTCAGTCCTTTGAAGAGAAGTACAGTCTCTTGCGATTTTGTATATATCGT
1521 GTTCGACACAGCCGCTCTCTGTCCTGTAAATAGGGAACTAAAGGCTGTATGATTTCTCAAGTGCTGAGTTACACAGTCCT
1601 GAGTGAGCTTTCTGTTACCATACTTTCACACGTGGGCTTTATTTCTCACTGTATGTTTGATATGATATTACTGTATTTAT
1681 TTTAAGAAAGCACTAAGATGTAATAAAGTGATGAACTAATTTGCTTTACATTGAATCGTATGTGTGAGGTTGCTGTGGCT
1761 CATTTCGCTGACCAGGCGACACCAACTCCTTGCTTTATAGGAGTTTCACATTGTTCTTTACCATGGCCCTATCGAAGTCA
1841 GTGGAATTGGATTCTTTTTAATGAAGAGCTAGAAAATATCTGGCATAGAGCTGGAAAATTGCATTCCCATGGGACGTCTG
1921 AATCAATTCTGGATTTTCTCCATGGAATGAGTCAGTGTGTGGAACATCCTGAAACTTGTCCTTAAGCGTGTAGTTTTCAC
2001 TGTTCGTTGCGAGTAAGCACTAATGTGGCATGGACATTCCTGATGTCCCAAGTCCCCAGGCCAGTGTTCGCCTAATGATT
2081 GACAGAAGCGTCCCTGCGTTCTTCATGCTTGGACACAGCAACCCTTTTAATTAGTCTTGAAAAGTTTCAGACACAGGATT
2161 AATTTTCGTGGTGGTGCTTTTGGGCCTTTCTGGCTTGGGTGGTGGTAAAGTCATGATTTTGCAGTTGATAACACTGACTT
2241 ATAACTCTGTTTATCAATGTCTCCTATATTCAAAGCCCCTGCAGTGGTATTTGTGTCTCGTTGCAAATTTCTTTCAGCGG
2321 AAAGCTTGCACAACTTTCGTTGTGTCTCAGAATTCTAACCTTGTTATTTAAGACAAGCTGCTCTACCCATTTAGGATATA
2401 ACTTTGTAAAGAAAGTGTAAACCAAATGATTCAATGTATGATGAAGTTTATGTGTAAATCCTTGGTAATGCTAGAATTCT
2481 GGGAGCCCAGAAGGGTTGAAAGAGAAATGAAACTTGCGTGAGTCCCATTATTTTACGCATGTATGTGCAGATACGTTCTA
2561 CCCACACGTGTGCGTGCACATGGCTGTGTGCGTGCACCAAAGATGGACTGCTTTCCATGTGTCCTTTTGACTTTCTGCAC
2641 GTGTCACTGCGGTGCAGTCTCTTAGCAGACTTCAGGCCCAAACTGTATTCTTCACTCAGGCAAAATTGAAAAGTGGAATA
2721 ATTCTAAATTACTTCTAGGTTATACTTTTACCTCCCTGAAATTGTAGTTGTCACTTGGAGGGCAAAATATTTATTGAAAT
2801 AAAATTTTCTGTTAAAAATTCAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUA---CACGACGAu 5'
             |||:: ||||    ||||||| 
Target 5' aaaAAATTCTTATCCCTTGCTGCTc 3'
602 - 626 159.00 -8.70
2
miRNA  3' guGUUUGGUAAU-AC--------ACGACGau 5'
            | |:|||| : ||        ||||||  
Target 5' tgCCAGCCATGGCTGCCAGACACTGCTGCaa 3'
1198 - 1228 126.00 -15.90
3
miRNA  3' guguUUGGUAAUA-CACGACGAu 5'
              ||:: | :| ||| |||| 
Target 5' gattAATTTTCGTGGTGGTGCTt 3'
2157 - 2179 122.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26586436 2 COSMIC
COSN26434772 39 COSMIC
COSN31507481 44 COSMIC
COSN30147504 45 COSMIC
COSN31501544 56 COSMIC
COSN31538133 80 COSMIC
COSN23017352 178 COSMIC
COSN28194717 201 COSMIC
COSN17439956 206 COSMIC
COSN19059065 250 COSMIC
COSN8520259 253 COSMIC
COSN17921925 298 COSMIC
COSN6382018 315 COSMIC
COSN9702798 416 COSMIC
COSN32215141 424 COSMIC
COSN20120013 446 COSMIC
COSN31588251 599 COSMIC
COSN29202394 758 COSMIC
COSN2312866 888 COSMIC
COSN6382017 933 COSMIC
COSN6382016 966 COSMIC
COSN31963124 1021 COSMIC
COSN30176982 1135 COSMIC
COSN7559379 1202 COSMIC
COSN29690154 1221 COSMIC
COSN19464097 1261 COSMIC
COSN31513443 1276 COSMIC
COSN23152914 1464 COSMIC
COSN2312865 1762 COSMIC
COSN31523133 1764 COSMIC
COSN16690785 1929 COSMIC
COSN15155780 2005 COSMIC
COSN16188751 2337 COSMIC
COSN25288549 2429 COSMIC
COSN8332018 2517 COSMIC
COSN7559378 2537 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1175857293 1 dbSNP
rs757630710 2 dbSNP
rs369711971 3 dbSNP
rs374443066 4 dbSNP
rs539202672 5 dbSNP
rs1269510812 6 dbSNP
rs764704881 8 dbSNP
rs754523990 9 dbSNP
rs368983345 10 dbSNP
rs149360226 11 dbSNP
rs766003903 16 dbSNP
rs199531330 17 dbSNP
rs1303614501 20 dbSNP
rs1469507118 25 dbSNP
rs1403934194 27 dbSNP
rs1161476104 31 dbSNP
rs1458164912 32 dbSNP
rs372468564 38 dbSNP
rs190405675 39 dbSNP
rs377308361 49 dbSNP
rs998500516 60 dbSNP
rs948935813 70 dbSNP
rs968372791 75 dbSNP
rs139688665 78 dbSNP
rs374480824 79 dbSNP
rs1162613968 80 dbSNP
rs940138262 83 dbSNP
rs1458655533 84 dbSNP
rs1450439216 87 dbSNP
rs997090984 92 dbSNP
rs185746692 105 dbSNP
rs908607401 109 dbSNP
rs987259524 111 dbSNP
rs150654027 114 dbSNP
rs562749047 115 dbSNP
rs1293243786 118 dbSNP
rs755180729 125 dbSNP
rs1330204085 127 dbSNP
rs544538455 129 dbSNP
rs1008718726 130 dbSNP
rs1230675766 135 dbSNP
rs887170726 144 dbSNP
rs763479863 158 dbSNP
rs1485377582 164 dbSNP
rs1200692062 170 dbSNP
rs1257600019 173 dbSNP
rs923058458 181 dbSNP
rs1047609300 183 dbSNP
rs532299493 184 dbSNP
rs776003147 185 dbSNP
rs370038565 186 dbSNP
rs1363018715 187 dbSNP
rs1484733196 192 dbSNP
rs948655847 193 dbSNP
rs138421069 194 dbSNP
rs754128620 195 dbSNP
rs938525193 202 dbSNP
rs955669207 209 dbSNP
rs573254302 213 dbSNP
rs1286772083 219 dbSNP
rs977575496 220 dbSNP
rs1316722702 233 dbSNP
rs968348597 235 dbSNP
rs554684817 236 dbSNP
rs542598586 237 dbSNP
rs1003004753 240 dbSNP
rs964293875 241 dbSNP
rs1483958094 244 dbSNP
rs1179940080 245 dbSNP
rs371188666 248 dbSNP
rs575265293 249 dbSNP
rs1023552775 252 dbSNP
rs1013155005 253 dbSNP
rs1432927870 255 dbSNP
rs1173165437 260 dbSNP
rs1371249213 263 dbSNP
rs1412168189 265 dbSNP
rs1306755178 267 dbSNP
rs1008372634 277 dbSNP
rs766452990 286 dbSNP
rs117695618 289 dbSNP
rs182178833 291 dbSNP
rs1343705130 292 dbSNP
rs1202886109 294 dbSNP
rs995624076 297 dbSNP
rs190467641 307 dbSNP
rs751472117 315 dbSNP
rs112145639 316 dbSNP
rs1452737335 321 dbSNP
rs1425937429 322 dbSNP
rs1414716889 323 dbSNP
rs1431750686 326 dbSNP
rs923161305 327 dbSNP
rs535260997 329 dbSNP
rs1354530081 331 dbSNP
rs948605838 346 dbSNP
rs1181527606 347 dbSNP
rs1458733673 350 dbSNP
rs1295588940 357 dbSNP
rs1369262282 357 dbSNP
rs974558573 360 dbSNP
rs566555036 364 dbSNP
rs747206261 365 dbSNP
rs1057424666 370 dbSNP
rs914509645 373 dbSNP
rs778700862 376 dbSNP
rs1322325541 387 dbSNP
rs924446463 389 dbSNP
rs1263395597 393 dbSNP
rs113455852 396 dbSNP
rs947164175 397 dbSNP
rs914227890 399 dbSNP
rs1248934410 401 dbSNP
rs1031717921 402 dbSNP
rs1482726652 409 dbSNP
rs1184929570 411 dbSNP
rs981255370 413 dbSNP
rs975023549 419 dbSNP
rs1023118525 424 dbSNP
rs753779279 425 dbSNP
rs1013021495 428 dbSNP
rs898646188 445 dbSNP
rs1017147952 446 dbSNP
rs1390453023 446 dbSNP
rs963699356 448 dbSNP
rs912775203 450 dbSNP
rs139031964 452 dbSNP
rs1410957224 455 dbSNP
rs1310538379 457 dbSNP
rs568885206 466 dbSNP
rs775445792 467 dbSNP
rs951571772 468 dbSNP
rs1483640039 474 dbSNP
rs899894577 479 dbSNP
rs1416395656 487 dbSNP
rs771948473 495 dbSNP
rs1164318521 497 dbSNP
rs1460109276 512 dbSNP
rs1298181392 517 dbSNP
rs1039784857 519 dbSNP
rs1026270955 522 dbSNP
rs995571878 523 dbSNP
rs1160075484 531 dbSNP
rs1449647854 535 dbSNP
rs1046300 536 dbSNP
rs11553780 537 dbSNP
rs1472314409 538 dbSNP
rs943198582 541 dbSNP
rs1248248278 543 dbSNP
rs962814871 548 dbSNP
rs914376290 559 dbSNP
rs550810904 560 dbSNP
rs1222241170 561 dbSNP
rs934572496 561 dbSNP
rs1312822243 562 dbSNP
rs1212402594 565 dbSNP
rs1256015938 568 dbSNP
rs1485592601 569 dbSNP
rs532308649 572 dbSNP
rs1183553414 574 dbSNP
rs1254355639 592 dbSNP
rs1468953070 593 dbSNP
rs185966500 607 dbSNP
rs1425503581 608 dbSNP
rs1488658781 608 dbSNP
rs1010412123 610 dbSNP
rs1374339017 611 dbSNP
rs924335547 613 dbSNP
rs145156823 614 dbSNP
rs1330841543 617 dbSNP
rs1057012994 620 dbSNP
rs971195796 631 dbSNP
rs1268380994 638 dbSNP
rs1003242837 639 dbSNP
rs749939737 640 dbSNP
rs1278212431 643 dbSNP
rs1347272533 647 dbSNP
rs1206445350 648 dbSNP
rs1305427938 654 dbSNP
rs903000006 655 dbSNP
rs1389082919 658 dbSNP
rs577251400 660 dbSNP
rs991163865 666 dbSNP
rs528324773 667 dbSNP
rs775408029 680 dbSNP
rs149044952 683 dbSNP
rs914299887 687 dbSNP
rs376620568 689 dbSNP
rs942347955 690 dbSNP
rs1456740770 694 dbSNP
rs3824357 699 dbSNP
rs987067128 700 dbSNP
rs180879754 701 dbSNP
rs1433745677 705 dbSNP
rs745641313 713 dbSNP
rs1229304974 724 dbSNP
rs188838616 733 dbSNP
rs578178778 735 dbSNP
rs962886855 736 dbSNP
rs1054284948 739 dbSNP
rs1248210152 741 dbSNP
rs184105872 742 dbSNP
rs924505334 755 dbSNP
rs1207752728 758 dbSNP
rs1045627893 760 dbSNP
rs1484590753 780 dbSNP
rs1257298493 784 dbSNP
rs1012343415 787 dbSNP
rs891851479 792 dbSNP
rs1190014031 796 dbSNP
rs371734905 797 dbSNP
rs1035456341 798 dbSNP
rs949767361 802 dbSNP
rs751204927 804 dbSNP
rs1415641897 820 dbSNP
rs1324119942 823 dbSNP
rs1459714564 823 dbSNP
rs567879737 824 dbSNP
rs991237290 830 dbSNP
rs1303318491 834 dbSNP
rs1320306303 839 dbSNP
rs962428110 840 dbSNP
rs910081588 845 dbSNP
rs764473347 846 dbSNP
rs554176151 855 dbSNP
rs1337384268 864 dbSNP
rs903072398 866 dbSNP
rs372009655 867 dbSNP
rs1272141103 874 dbSNP
rs1465014542 880 dbSNP
rs1206538734 883 dbSNP
rs1041638200 885 dbSNP
rs150325311 886 dbSNP
rs536362240 889 dbSNP
rs1304717219 894 dbSNP
rs1466624390 895 dbSNP
rs1039421308 898 dbSNP
rs1259590135 900 dbSNP
rs1474101413 904 dbSNP
rs1374715265 913 dbSNP
rs1412457983 915 dbSNP
rs775876466 925 dbSNP
rs1171713288 927 dbSNP
rs1451058070 934 dbSNP
rs951553558 937 dbSNP
rs1390604183 941 dbSNP
rs1187519735 947 dbSNP
rs912210113 948 dbSNP
rs797002112 952 dbSNP
rs1335438888 960 dbSNP
rs1051231303 965 dbSNP
rs568823668 966 dbSNP
rs368306878 967 dbSNP
rs1258628370 969 dbSNP
rs200370141 972 dbSNP
rs974321653 974 dbSNP
rs769775708 979 dbSNP
rs532175185 980 dbSNP
rs1003260799 983 dbSNP
rs1252227084 988 dbSNP
rs1420698999 989 dbSNP
rs1184228861 991 dbSNP
rs1344716497 992 dbSNP
rs1453135667 994 dbSNP
rs760089647 999 dbSNP
rs140158223 1000 dbSNP
rs990903786 1003 dbSNP
rs1312836013 1005 dbSNP
rs1054320472 1010 dbSNP
rs961106902 1012 dbSNP
rs1315130025 1014 dbSNP
rs1396633223 1020 dbSNP
rs1035126047 1021 dbSNP
rs1281784317 1024 dbSNP
rs978476583 1025 dbSNP
rs902988584 1026 dbSNP
rs966684925 1031 dbSNP
rs1481487672 1040 dbSNP
rs1193930314 1042 dbSNP
rs546903710 1050 dbSNP
rs1167179267 1051 dbSNP
rs1418662036 1052 dbSNP
rs1194526764 1054 dbSNP
rs1452702314 1055 dbSNP
rs1173536780 1059 dbSNP
rs1046063167 1060 dbSNP
rs192276301 1076 dbSNP
rs894179400 1077 dbSNP
rs892971651 1079 dbSNP
rs1396258740 1084 dbSNP
rs1187839499 1085 dbSNP
rs1386953853 1091 dbSNP
rs1305233665 1092 dbSNP
rs1055375086 1093 dbSNP
rs909652003 1106 dbSNP
rs982521699 1121 dbSNP
rs1422687442 1124 dbSNP
rs1488701367 1126 dbSNP
rs930142835 1126 dbSNP
rs367994882 1134 dbSNP
rs1255179622 1135 dbSNP
rs1018086100 1142 dbSNP
rs977449479 1145 dbSNP
rs1420333691 1149 dbSNP
rs1006627906 1163 dbSNP
rs759229622 1172 dbSNP
rs776474384 1173 dbSNP
rs1050882326 1174 dbSNP
rs775125652 1175 dbSNP
rs770428163 1176 dbSNP
rs929590192 1179 dbSNP
rs896830337 1182 dbSNP
rs1288878554 1187 dbSNP
rs189161383 1190 dbSNP
rs941631628 1193 dbSNP
rs916738748 1196 dbSNP
rs56055200 1197 dbSNP
rs530905632 1206 dbSNP
rs928002879 1212 dbSNP
rs563479184 1213 dbSNP
rs1269291565 1217 dbSNP
rs545057375 1217 dbSNP
rs1242736645 1219 dbSNP
rs1022293024 1221 dbSNP
rs1185268847 1224 dbSNP
rs1261714170 1225 dbSNP
rs1167472653 1226 dbSNP
rs1460637848 1226 dbSNP
rs772385058 1228 dbSNP
rs1160824749 1235 dbSNP
rs1460546367 1239 dbSNP
rs746535911 1240 dbSNP
rs957312037 1241 dbSNP
rs72771922 1242 dbSNP
rs1428097977 1250 dbSNP
rs1288201879 1253 dbSNP
rs1356085096 1259 dbSNP
rs1416549252 1262 dbSNP
rs929740636 1264 dbSNP
rs1333931833 1265 dbSNP
rs1007112569 1272 dbSNP
rs1175857591 1277 dbSNP
rs890963802 1287 dbSNP
rs115943853 1288 dbSNP
rs541725007 1291 dbSNP
rs780053854 1300 dbSNP
rs574244407 1302 dbSNP
rs11553781 1312 dbSNP
rs942956380 1322 dbSNP
rs185152787 1328 dbSNP
rs1038072441 1329 dbSNP
rs1177401977 1334 dbSNP
rs1409780746 1335 dbSNP
rs1269979380 1340 dbSNP
rs1375544735 1343 dbSNP
rs1436462530 1344 dbSNP
rs369751836 1353 dbSNP
rs989702839 1353 dbSNP
rs958033218 1357 dbSNP
rs1271513350 1359 dbSNP
rs575402273 1361 dbSNP
rs1280356502 1363 dbSNP
rs941020055 1365 dbSNP
rs756059376 1368 dbSNP
rs772470612 1370 dbSNP
rs1030997152 1376 dbSNP
rs745807467 1379 dbSNP
rs1213602597 1380 dbSNP
rs141287658 1388 dbSNP
rs866531446 1388 dbSNP
rs1332581672 1390 dbSNP
rs557054241 1390 dbSNP
rs1024582953 1394 dbSNP
rs1234965821 1395 dbSNP
rs1468232466 1397 dbSNP
rs1324027956 1401 dbSNP
rs1176299612 1406 dbSNP
rs1439697639 1407 dbSNP
rs1055385658 1409 dbSNP
rs1391739401 1418 dbSNP
rs1322166563 1420 dbSNP
rs1014058327 1426 dbSNP
rs1457276847 1427 dbSNP
rs3201247 1430 dbSNP
rs866197328 1437 dbSNP
rs1330575633 1438 dbSNP
rs1406663377 1441 dbSNP
rs894282478 1445 dbSNP
rs1034235825 1447 dbSNP
rs1158477593 1451 dbSNP
rs1469107930 1452 dbSNP
rs1379728415 1453 dbSNP
rs1194584906 1457 dbSNP
rs1005384599 1465 dbSNP
rs1301876637 1466 dbSNP
rs1251319013 1470 dbSNP
rs1344844252 1474 dbSNP
rs1215681233 1485 dbSNP
rs1275505954 1494 dbSNP
rs1210854619 1495 dbSNP
rs56381246 1503 dbSNP
rs1253299970 1504 dbSNP
rs779247727 1505 dbSNP
rs1046721146 1510 dbSNP
rs1393966774 1512 dbSNP
rs1283709281 1515 dbSNP
rs559653861 1518 dbSNP
rs1417094074 1519 dbSNP
rs1409210251 1520 dbSNP
rs1042864028 1524 dbSNP
rs1330920804 1524 dbSNP
rs945488883 1525 dbSNP
rs1275369825 1529 dbSNP
rs751134561 1533 dbSNP
rs1368560685 1534 dbSNP
rs900905421 1535 dbSNP
rs1272478260 1536 dbSNP
rs1337838834 1539 dbSNP
rs1218480225 1546 dbSNP
rs1274200852 1546 dbSNP
rs1336415555 1547 dbSNP
rs989410110 1549 dbSNP
rs964698122 1552 dbSNP
rs911088707 1553 dbSNP
rs1435427637 1561 dbSNP
rs755377144 1567 dbSNP
rs571244473 1570 dbSNP
rs546546450 1576 dbSNP
rs955376431 1578 dbSNP
rs1029535798 1582 dbSNP
rs534615370 1583 dbSNP
rs370116535 1596 dbSNP
rs1174841299 1601 dbSNP
rs567078197 1609 dbSNP
rs1401416258 1617 dbSNP
rs1320842860 1618 dbSNP
rs62584792 1622 dbSNP
rs1399943884 1631 dbSNP
rs7838 1632 dbSNP
rs971113121 1635 dbSNP
rs1005184062 1636 dbSNP
rs1264546251 1645 dbSNP
rs193109960 1651 dbSNP
rs1206449720 1653 dbSNP
rs1281534518 1653 dbSNP
rs1241588087 1663 dbSNP
rs1188598547 1667 dbSNP
rs1213640892 1672 dbSNP
rs1259305648 1675 dbSNP
rs1474131062 1677 dbSNP
rs1185672880 1683 dbSNP
rs1368180429 1685 dbSNP
rs1454505627 1689 dbSNP
rs1160313361 1690 dbSNP
rs1382907494 1691 dbSNP
rs1419582327 1691 dbSNP
rs1444209390 1691 dbSNP
rs1055779672 1692 dbSNP
rs1314060939 1703 dbSNP
rs1377634534 1709 dbSNP
rs1003840298 1718 dbSNP
rs765596133 1730 dbSNP
rs551872291 1737 dbSNP
rs759966944 1738 dbSNP
rs1005461370 1739 dbSNP
rs777033806 1740 dbSNP
rs756152574 1741 dbSNP
rs1211467480 1752 dbSNP
rs915300419 1753 dbSNP
rs1282458323 1761 dbSNP
rs533139091 1766 dbSNP
rs559176101 1767 dbSNP
rs1419841620 1770 dbSNP
rs1184283236 1773 dbSNP
rs910587404 1777 dbSNP
rs539579601 1778 dbSNP
rs1439220961 1782 dbSNP
rs1174805242 1783 dbSNP
rs1397509870 1784 dbSNP
rs1433410163 1791 dbSNP
rs993867078 1792 dbSNP
rs955339567 1797 dbSNP
rs1392732446 1798 dbSNP
rs1268059947 1800 dbSNP
rs559706200 1810 dbSNP
rs1234467804 1813 dbSNP
rs1375502814 1813 dbSNP
rs1304994401 1823 dbSNP
rs1340583343 1825 dbSNP
rs1040824207 1833 dbSNP
rs1313984492 1837 dbSNP
rs1434693346 1838 dbSNP
rs1006606939 1845 dbSNP
rs1197749704 1847 dbSNP
rs1481513999 1847 dbSNP
rs1374009348 1850 dbSNP
rs541698662 1857 dbSNP
rs1457370029 1867 dbSNP
rs574384211 1869 dbSNP
rs922414361 1871 dbSNP
rs760648941 1878 dbSNP
rs1410880760 1879 dbSNP
rs762974817 1880 dbSNP
rs972538035 1883 dbSNP
rs1185035504 1884 dbSNP
rs773380869 1890 dbSNP
rs961202501 1894 dbSNP
rs1463896848 1897 dbSNP
rs866315709 1904 dbSNP
rs1258381685 1908 dbSNP
rs1327270236 1909 dbSNP
rs889991732 1915 dbSNP
rs140491561 1916 dbSNP
rs1484689812 1920 dbSNP
rs1309030008 1921 dbSNP
rs544016147 1931 dbSNP
rs867538183 1934 dbSNP
rs748396211 1941 dbSNP
rs936941601 1942 dbSNP
rs924232620 1951 dbSNP
rs1043004786 1954 dbSNP
rs1254927283 1956 dbSNP
rs1005342785 1957 dbSNP
rs949420797 1957 dbSNP
rs1263129257 1958 dbSNP
rs959297988 1967 dbSNP
rs1430812920 1970 dbSNP
rs1191879074 1980 dbSNP
rs990902084 1984 dbSNP
rs147652617 1988 dbSNP
rs1166691920 1992 dbSNP
rs959441791 1998 dbSNP
rs556755227 1999 dbSNP
rs12004494 2005 dbSNP
rs1398088398 2006 dbSNP
rs1277282354 2009 dbSNP
rs1355889652 2010 dbSNP
rs577527683 2011 dbSNP
rs1319988844 2024 dbSNP
rs1025576384 2035 dbSNP
rs1487107614 2036 dbSNP
rs1009650317 2037 dbSNP
rs1239034885 2038 dbSNP
rs893982328 2039 dbSNP
rs1354037442 2040 dbSNP
rs1262878881 2042 dbSNP
rs1475764889 2045 dbSNP
rs1189604820 2047 dbSNP
rs1053791332 2048 dbSNP
rs1422888694 2051 dbSNP
rs943495286 2056 dbSNP
rs1159127498 2064 dbSNP
rs540344493 2069 dbSNP
rs368472737 2070 dbSNP
rs1375813690 2073 dbSNP
rs1168578692 2075 dbSNP
rs199639883 2081 dbSNP
rs1377176037 2086 dbSNP
rs1227981504 2088 dbSNP
rs933336460 2089 dbSNP
rs1019289459 2090 dbSNP
rs142690839 2097 dbSNP
rs1215055701 2098 dbSNP
rs889519531 2104 dbSNP
rs1032068973 2105 dbSNP
rs1213388353 2108 dbSNP
rs1001051676 2115 dbSNP
rs902646537 2117 dbSNP
rs1042645935 2119 dbSNP
rs949665670 2122 dbSNP
rs148718844 2123 dbSNP
rs939827659 2124 dbSNP
rs909319870 2125 dbSNP
rs909757748 2127 dbSNP
rs1358393314 2128 dbSNP
rs1447531920 2133 dbSNP
rs1231010549 2141 dbSNP
rs985253792 2143 dbSNP
rs759429831 2144 dbSNP
rs983855987 2148 dbSNP
rs1349162854 2152 dbSNP
rs1221457708 2155 dbSNP
rs1276901621 2156 dbSNP
rs931171760 2159 dbSNP
rs1204753358 2160 dbSNP
rs1234311603 2167 dbSNP
rs536819944 2168 dbSNP
rs972716474 2178 dbSNP
rs965659380 2184 dbSNP
rs959183102 2190 dbSNP
rs749697939 2192 dbSNP
rs568355423 2199 dbSNP
rs1424176752 2202 dbSNP
rs1272152556 2205 dbSNP
rs746501004 2211 dbSNP
rs1230859077 2212 dbSNP
rs777395677 2218 dbSNP
rs953662208 2220 dbSNP
rs1032101867 2221 dbSNP
rs1000984115 2223 dbSNP
rs1035964240 2224 dbSNP
rs902718842 2224 dbSNP
rs1033860952 2227 dbSNP
rs1273635241 2231 dbSNP
rs981775874 2233 dbSNP
rs1215594586 2241 dbSNP
rs970801045 2242 dbSNP
rs1224878172 2249 dbSNP
rs1260403656 2249 dbSNP
rs1021127243 2252 dbSNP
rs188880581 2255 dbSNP
rs1009805664 2256 dbSNP
rs757984688 2258 dbSNP
rs1469456642 2272 dbSNP
rs1196643129 2283 dbSNP
rs1032496307 2286 dbSNP
rs1246121099 2291 dbSNP
rs1008043088 2298 dbSNP
rs184547078 2299 dbSNP
rs1296881423 2300 dbSNP
rs1443572415 2304 dbSNP
rs1395422587 2312 dbSNP
rs533469942 2314 dbSNP
rs1055281309 2318 dbSNP
rs1052285277 2319 dbSNP
rs933302495 2333 dbSNP
rs897863294 2335 dbSNP
rs1330964227 2337 dbSNP
rs765543101 2338 dbSNP
rs566087844 2339 dbSNP
rs972958330 2340 dbSNP
rs1418489351 2342 dbSNP
rs547803968 2346 dbSNP
rs1405514541 2349 dbSNP
rs1357840544 2358 dbSNP
rs943827041 2367 dbSNP
rs1288539590 2368 dbSNP
rs1447463707 2369 dbSNP
rs755356570 2372 dbSNP
rs1218747617 2378 dbSNP
rs1260730871 2379 dbSNP
rs1477403362 2382 dbSNP
rs909705307 2384 dbSNP
rs983928040 2395 dbSNP
rs912494595 2399 dbSNP
rs937858473 2401 dbSNP
rs953696002 2403 dbSNP
rs926351920 2417 dbSNP
rs1032420785 2418 dbSNP
rs1251933552 2422 dbSNP
rs1211469868 2426 dbSNP
rs766763459 2431 dbSNP
rs1359007565 2432 dbSNP
rs1399852093 2444 dbSNP
rs565197199 2446 dbSNP
rs776310083 2451 dbSNP
rs1217132561 2463 dbSNP
rs970408731 2468 dbSNP
rs577642619 2470 dbSNP
rs7021888 2476 dbSNP
rs1305513421 2479 dbSNP
rs988333816 2485 dbSNP
rs1350817843 2493 dbSNP
rs1372222529 2493 dbSNP
rs958310035 2494 dbSNP
rs1032568040 2498 dbSNP
rs1487837426 2515 dbSNP
rs1002373959 2517 dbSNP
rs1007688481 2518 dbSNP
rs1289586684 2524 dbSNP
rs887821051 2525 dbSNP
rs1453148067 2526 dbSNP
rs889291393 2529 dbSNP
rs1378931025 2534 dbSNP
rs773107949 2536 dbSNP
rs767711549 2537 dbSNP
rs1030408888 2539 dbSNP
rs1393902466 2540 dbSNP
rs1454518324 2540 dbSNP
rs1335822273 2541 dbSNP
rs762088320 2551 dbSNP
rs1306460932 2554 dbSNP
rs774738963 2554 dbSNP
rs1275268216 2560 dbSNP
rs1234959633 2561 dbSNP
rs1036394384 2563 dbSNP
rs1451021852 2567 dbSNP
rs943857943 2568 dbSNP
rs1006240782 2573 dbSNP
rs1198932420 2573 dbSNP
rs1458384604 2574 dbSNP
rs1049713069 2576 dbSNP
rs1259449435 2586 dbSNP
rs932547060 2588 dbSNP
rs191210507 2591 dbSNP
rs924999528 2592 dbSNP
rs527568942 2598 dbSNP
rs755718609 2598 dbSNP
rs760177987 2599 dbSNP
rs1280138661 2616 dbSNP
rs769052345 2617 dbSNP
rs888343060 2620 dbSNP
rs564142352 2627 dbSNP
rs979490787 2636 dbSNP
rs12671 2637 dbSNP
rs1375568018 2639 dbSNP
rs937823579 2640 dbSNP
rs116830426 2641 dbSNP
rs1046142412 2645 dbSNP
rs1251683256 2647 dbSNP
rs949161187 2650 dbSNP
rs1200790141 2657 dbSNP
rs1256205249 2663 dbSNP
rs553286414 2682 dbSNP
rs149592841 2683 dbSNP
rs539951153 2684 dbSNP
rs544733718 2685 dbSNP
rs1314608915 2686 dbSNP
rs1435332770 2687 dbSNP
rs1033808841 2690 dbSNP
rs776559827 2694 dbSNP
rs1424815766 2699 dbSNP
rs1466828385 2701 dbSNP
rs1374624306 2706 dbSNP
rs913556448 2717 dbSNP
rs1398902856 2718 dbSNP
rs1171454114 2723 dbSNP
rs1458028057 2724 dbSNP
rs1463347401 2729 dbSNP
rs1388409067 2732 dbSNP
rs770756704 2734 dbSNP
rs746976666 2735 dbSNP
rs1192064403 2737 dbSNP
rs577667877 2738 dbSNP
rs1295974549 2739 dbSNP
rs1027880576 2744 dbSNP
rs993916771 2750 dbSNP
rs1426190035 2757 dbSNP
rs1317375387 2760 dbSNP
rs56025849 2761 dbSNP
rs1257720794 2762 dbSNP
rs139593088 2767 dbSNP
rs540599731 2770 dbSNP
rs957717457 2779 dbSNP
rs1209095608 2785 dbSNP
rs777194771 2792 dbSNP
rs1264317336 2804 dbSNP
rs1479039887 2819 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUA---CACGACGAu 5'
             |||:: ||||    ||||||| 
Target 5' aaaAAAUUCUUAUCCCUUGCUGCUc 3'
3 - 27
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000389532.4 | 3UTR | AAAAAAAAUUCUUAUCCCUUGCUGCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000389532.4 | 3UTR | AAAAAAAAUUCUUAUCCCUUGCUGCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000389532.4 | 3UTR | AAUUCUUAUCCCUUGCUGCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.579 3.7e-3 0.588 3.2e-3 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.394 3.1e-2 0.294 8.7e-2 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.353 4.2e-2 0.309 6.6e-2 25 Click to see details
GSE21849 B cell lymphoma 0.283 6.8e-2 0.375 2.3e-2 29 Click to see details
GSE17306 Multiple myeloma 0.177 1.1e-1 0.134 1.8e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.235 1.3e-1 -0.225 1.4e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.174 1.7e-1 0.270 6.8e-2 32 Click to see details
GSE14794 Lymphoblastoid cells 0.098 1.8e-1 0.081 2.2e-1 90 Click to see details
GSE28544 Breast cancer -0.196 1.8e-1 -0.509 5.5e-3 24 Click to see details
GSE17498 Multiple myeloma -0.128 2.2e-1 -0.086 3.0e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.236 2.3e-1 0.014 4.8e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.173 2.3e-1 -0.202 2.0e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.155 2.8e-1 0.112 3.4e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.152 3.1e-1 0.038 4.5e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.063 3.1e-1 -0.154 1.1e-1 64 Click to see details
GSE21032 Prostate cancer 0.036 3.7e-1 0.021 4.3e-1 83 Click to see details
GSE19783 ER- ER- breast cancer 0.029 4.0e-1 -0.004 4.9e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.052 4.0e-1 0.062 3.9e-1 24 Click to see details
GSE19536 Breast cancer 0.01 4.6e-1 -0.080 2.1e-1 100 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 -0.082 3.6e-1 21 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 -0.082 3.6e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.35 0.01 0.352 0.01 42 Click to see details
STAD -0.373 0.02 -0.386 0.01 32 Click to see details
KIRC 0.181 0.07 0.239 0.02 68 Click to see details
LIHC 0.187 0.1 0.085 0.28 49 Click to see details
KIRP -0.229 0.1 -0.335 0.03 32 Click to see details
LUSC 0.199 0.12 0.185 0.13 38 Click to see details
KICH -0.211 0.16 -0.102 0.31 25 Click to see details
CHOL -0.365 0.17 -0.617 0.04 9 Click to see details
PAAD -0.599 0.2 -0.200 0.4 4 Click to see details
ESCA 0.265 0.22 0.345 0.15 11 Click to see details
COAD 0.287 0.25 0.262 0.27 8 Click to see details
LUAD 0.206 0.26 0.336 0.14 12 Click to see details
THCA -0.079 0.28 -0.098 0.23 59 Click to see details
BRCA 0.048 0.33 0.007 0.47 84 Click to see details
UCEC 0.087 0.36 0.089 0.36 19 Click to see details
CESC 0.389 0.37 0.500 0.33 3 Click to see details
BLCA -0.05 0.42 -0.055 0.41 18 Click to see details
PRAD -0.022 0.44 -0.088 0.27 50 Click to see details
PCPG -0.059 0.48 -0.500 0.33 3 Click to see details
PCPG -0.059 0.48 -0.500 0.33 3 Click to see details
PCPG -0.059 0.48 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*