miRTarBase - #MIRT512646 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CPEB3   
Synonyms -
Description cytoplasmic polyadenylation element binding protein 3
Transcript NM_001178137   
Other Transcripts NM_014912   
Expression
Putative miRNA Targets on CPEB3
3'UTR of CPEB3
(miRNA target sites are highlighted)
>CPEB3|NM_001178137|3'UTR
   1 GCCACGGGCCGACCCAGCCACAAGTACTGGAGTAGATAACAAGGAGGGAAAAGAGAGGGCACTGCCTCAGGGCTTACAGT
  81 GTTCTGGAAATCTGTGCATTCGTTCTCGATTTTTAAAGAAGAATTGGGTCTTTTTATTATTATTATTATTATTTACAGTC
 161 ATATTACTGAACTCAGTGTCCAGTATAATGCAGAATTGCAGAGTGTAGAATGGTACTGATTTGCACTTTGATTCACACCT
 241 TTGTCTGCTTGGTACCTTAATTTTTTATACCTGATTTGTCACTCGTGACAGTATGTAGACTGCCATTCTCATCAGCGGCC
 321 GTCAGGCTACTGTCTGTGATTCTTTTGTTTGTTGTTGTGGTGTTGTTCTGATTGTTTTGAACTGGAGCATGCACTTATTT
 401 TCAGAAACTTAGAGAGTTGCCCCTAGGACAAGACTTACCAAAGGTAATACTCGTGAGTAGGTGGCAGATGTAGCAAAAAC
 481 TTCACAACAATTCAGCAATCATTAGCTCGGGTCACTTAGAGTAAGGATAACCCTTCATGAAAATAAGCCTTTAGTTGCTC
 561 TCTATTTTGACTTGTAAGGATACCTCATAAGCTGGATCTTTTATTTTTCCTTCATGTTTGATTTTTGTTTTGCCGAGGAT
 641 TTTGGTTAGATCTTTTAGTATTATGTAAATTTATGCTGCAATAGCTTTTGCTGCTATTAAAATGGTATTATTAATACCAT
 721 AATACTCTATTCAGGCTAGGATATCAATTAAACACAAAAACCCAACAACACACTTTTGTGATTTTAGGGATAGAGTCAGC
 801 TGCCGAACGGAGATCAGAATAGACTTCAGAAAGCTTCGGTGGAAGGTCACTATTTCTGACTGCATGTTTACTTAATCAGG
 881 TTGCTGCATGCAATAAATTTTATATCCAATGTCTAGTATAAAACGTTCCCACAATGCACAAATTAAGAATCTATATAAGC
 961 TATAAAAATACTCATTTTTTAAAAAAAGTTTTTTTCATTCAAAGAATTGGTAATTGACCGGAGGAAGGCATGCCTCAATA
1041 AATGGAATGCTCTGAATGGGAAGAGCCCATAACAGAATGACCTATATTACAACCGATATAAAACCTAGGTGTAGGATATT
1121 CTTCAAGCAAATTTGTGGATGGTAGATGAAGTACTTTGCGGTGCTCTGTTATATATTGTGAAATTTATTTTATATAGTAA
1201 AGTGATTATGTCTAACTGTGATCAAACTTAACTGTTTAAAGCCTCTGTCAGACATTAATGAACTTGACAGTTCATAACTG
1281 ATATATTATAAACTAACACATGAGCTCTTAGTTACAATCTCTTAGTGCTTGCACCATTTTACATAGCTTCAGACCTTGTC
1361 CAGAAAACCAAAGAGCTCATCTTAGCTTACAAACACTAAGAATATATACAGGATATAGAGATAAGTTGTCAGATTGACAA
1441 ACTAGGCACATTTTTAAGAAAGTTGTGTAATGGTGATGCTAAAGAAATGTCTGTACAAAATAAGATGGCCTGGGCAGAGT
1521 TGGTTGTCTGAGTGAGAAACTAACTACTTAATTCCCTGGATTTATCCTGTTAAGCTTGAGTAGAATGAAGGCCTGCTAGC
1601 ACTAGCGTGGTCTAGAATGAAGGCCTGCTAGCACTAGCGTGGACATTTTTCTAGCATTCACCCTTGGGCTGCAGATAGTA
1681 ATATATAAACACACACAATGATTGCAAGACTATGTAAATCTTTTTTTAATCTTCTTCCTATGTTTTGGAATTCTGGGGAC
1761 AATCTGACTGGATATGACACTGCAGAATAGATTTAAGTCGCTGTGTTTTCTGTGCTGTGATGTCCTTGTACTGTCTTAAG
1841 TTAGTGTTGCTTGTTTTTGTTTTGTTCTCCCATGTTTAGTTGCAATTACTGGCTCTCAAGCTATAGTTTGTTTTCAAAAA
1921 GGAAAAACAAAATAGTTTTTTACTGGATTAAAAATGCTTATTTTAGAATCCTCCCCTTTTTGAGGCTTTTTGGTAATAAT
2001 TGCTTTTTTCCAGCCCAGGTGTGGTTTTGTTTGTTTTTTTCTATGTTTGTGGGTTTTTTTTCATCTGTACAAGAAATTTT
2081 GTTATGCACTACTACTTTTTGTATTCTAGACAGTTTTCAAAAGTTGGCAGATTTTTTTTTTTGTTTTTAAGGAAAAAGGC
2161 ATGCTTTCTGACTGACATGATCTTTTGCAATACCTCAATTTTGAAATATAGGAAAGAAAATGATATTTTCTAAGTAAGTT
2241 TATTCAGAAAAATATATATTAATTTAATTCTGCAAGAAAATGATTTAACAGATGGGTAACTTTATTTTTTTCATGCTTAT
2321 TTGTGTTTTTTGAAAATGAAGAAGTTAGAGCTTTATAACTATAATATTAAAGATCATATCTAACCTACAGAAATCTACCT
2401 AATTATGTGAAAGAAGCAAAACTTTTTGAAGAAGCACCCCTCTTTCATGTATTAAAATAACACTGAGATTTTTTTAAAAG
2481 CTGGAAGATTGTACAGCATAAAGCTAAAGTGAAGGCAAAAAACATTGTCCTGAAGAATAGGTTACAAAAAATAAACTCCA
2561 TTTGGTGCTGAAAGTTGTGAATAGATGGTGGAAACTACTTTCCCTTAATTTGTATATTTCTAATCAAGTGTTGATTGTGC
2641 GCGACTGACCAGGATTGTGAAAGAGTTCTTCTGTTTGTATTTTTTTAAAGAGAACTTTTTTAGTTTATTAAATTATAACA
2721 TGTTCCCTTTTGTTTTGTAAATAAATGTGCCCCCAAGTTGTTAATGTTATATTAAAAGAGAGGGTCCTTCAAAAAAATTA
2801 TTTTTTAAAACACAGAGGTGTTCTGACCTGCAACTTGACTGGGAAGCCCCTGGGTAACACAGGTCCTGCTGTGGCCTTTC
2881 CTTGGTGTGACACTTGAACTAGTCGATTTTTTGAAGGCTATAACCTAACCTCGACTATTTGTTGTTATGTGCAATACTGT
2961 TTGTACTGTTTGTATAAAAAATAGAAAAAAAAAAGAAAAGAAAAAAGGCATAAATCTTTATTGCAGATTTATTTTCATTG
3041 CAAACTTTAGACATTGTGATTCACTGAAATCATTTTTCTACTGTCAAATATGTACCTTTTCTTCATGCTGGTATTTTTTC
3121 AATAGTAATGTAGCCTTTGTACTGAGACAAATTTTCATTGTTATTTTTAGAAAGATTTTTTGCTAAGAAAAAAATTAAAC
3201 ATATTTACATATTTTTCATTTTATTTCGTATTTTCTTTAAGGAGTGCTTTCTCAATCATTAATAGAGTTGTTTCTGGGAG
3281 GGACTTTCATATCTGGTCAATGTCATAATATTATTTTGTATTTTTATTGGAATAAATTAATTTTATGATGCTAATTCTTT
3361 AAAAGTTTATTTTTTTCATTTTCAGTTATTTTTGAAGCTAAAACCTTTGTAATATTGTTACTAAAGTGTCTAGTTTTTTG
3441 AAATGCAAAGCTTTATGTATTAACTTGCTGATGTGGTTTACAATAGTGTGACAACGATGAAAATGCTTGGTTATGTAAAG
3521 TGATTGGAAATGTAATGGATAATTGGGTAATAAAATGACAGAATGAGCAGAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||| | | ||   ||||||| 
Target 5' tgCAATAGCTTT---TGCTGCTa 3'
677 - 696 149.00 -10.70
2
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  :||| |||:|||| 
Target 5' tgtcttaaGTTA-GTGTTGCTt 3'
1832 - 1852 137.00 -11.30
3
miRNA  3' guGUUUGG---UAAUACACGACGAu 5'
            | ||||   | ||| ||:||:| 
Target 5' acCTAACCTCGACTATTTGTTGTTa 3'
2923 - 2947 132.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30508953 40 COSMIC
COSN31599461 101 COSMIC
COSN31604410 108 COSMIC
COSN31600096 124 COSMIC
COSN26555842 289 COSMIC
COSN8640630 357 COSMIC
COSN31485005 493 COSMIC
COSN21894663 543 COSMIC
COSN31521056 620 COSMIC
COSN5293538 700 COSMIC
COSN5293537 738 COSMIC
COSN31537231 973 COSMIC
COSN31531002 1296 COSMIC
COSN31594524 1995 COSMIC
COSN31588368 2053 COSMIC
COSN31589715 2067 COSMIC
COSN23987379 2106 COSMIC
COSN27226519 2132 COSMIC
COSN19739597 2143 COSMIC
COSN24511697 2149 COSMIC
COSN26275781 2172 COSMIC
COSN31583171 2216 COSMIC
COSN8640629 2231 COSMIC
COSN30166503 2378 COSMIC
COSN30164514 2409 COSMIC
COSN31488683 2446 COSMIC
COSN31538524 2466 COSMIC
COSN32129279 2540 COSMIC
COSN27569739 2559 COSMIC
COSN29463602 2620 COSMIC
COSN26576512 2860 COSMIC
COSN31529613 2978 COSMIC
COSN31566355 3116 COSMIC
COSN31609293 3154 COSMIC
COSN26564834 3247 COSMIC
COSN9029736 3367 COSMIC
COSN8640628 3476 COSMIC
COSN26641536 3486 COSMIC
COSN26465436 3548 COSMIC
COSN29483279 3829 COSMIC
COSN27327476 3849 COSMIC
COSN5889222 4374 COSMIC
COSN5889221 4396 COSMIC
COSN20370308 4513 COSMIC
COSN19530449 4812 COSMIC
COSN20425103 5194 COSMIC
COSN8726247 5248 COSMIC
rs1776209 1097 GWAS
rs12252682 1227 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768375683 5 dbSNP
rs746809792 6 dbSNP
rs1190434080 7 dbSNP
rs775731548 10 dbSNP
rs375191586 11 dbSNP
rs745929583 12 dbSNP
rs779197891 16 dbSNP
rs1252660411 18 dbSNP
rs757821654 20 dbSNP
rs1355479459 25 dbSNP
rs749751606 28 dbSNP
rs1234859790 29 dbSNP
rs778425405 30 dbSNP
rs545732261 32 dbSNP
rs756455303 33 dbSNP
rs760080191 35 dbSNP
rs779729521 36 dbSNP
rs1013088136 41 dbSNP
rs1315743075 44 dbSNP
rs762054686 44 dbSNP
rs1389158449 45 dbSNP
rs758057285 47 dbSNP
rs944450827 49 dbSNP
rs1411560914 51 dbSNP
rs910335969 71 dbSNP
rs1050035642 79 dbSNP
rs1481172716 84 dbSNP
rs1191078974 91 dbSNP
rs1387763307 92 dbSNP
rs1265922426 98 dbSNP
rs894861384 101 dbSNP
rs1056228933 102 dbSNP
rs551927734 105 dbSNP
rs186236139 107 dbSNP
rs562880416 108 dbSNP
rs1354850128 119 dbSNP
rs1457244683 119 dbSNP
rs1291679335 124 dbSNP
rs1481217125 124 dbSNP
rs1392853415 129 dbSNP
rs914927841 130 dbSNP
rs543298212 133 dbSNP
rs987990380 135 dbSNP
rs1220028593 136 dbSNP
rs796282696 139 dbSNP
rs923591340 141 dbSNP
rs573538302 146 dbSNP
rs1223882755 154 dbSNP
rs754890583 154 dbSNP
rs956657299 154 dbSNP
rs1042078440 155 dbSNP
rs1476893058 158 dbSNP
rs1188466301 159 dbSNP
rs971883278 172 dbSNP
rs1423003582 174 dbSNP
rs1162498046 175 dbSNP
rs1367364787 176 dbSNP
rs766311106 179 dbSNP
rs1297520414 181 dbSNP
rs1023080266 183 dbSNP
rs1358017890 204 dbSNP
rs1205692736 209 dbSNP
rs1328163574 218 dbSNP
rs915171999 229 dbSNP
rs951995867 238 dbSNP
rs1228100253 239 dbSNP
rs749287737 243 dbSNP
rs1362051715 247 dbSNP
rs1247285670 249 dbSNP
rs1225508025 255 dbSNP
rs1285967866 258 dbSNP
rs974943824 284 dbSNP
rs1027663061 285 dbSNP
rs993708898 289 dbSNP
rs138212824 303 dbSNP
rs1180343616 304 dbSNP
rs1386799771 305 dbSNP
rs1434395307 308 dbSNP
rs1378453650 311 dbSNP
rs1401919428 313 dbSNP
rs760794319 316 dbSNP
rs1358071906 317 dbSNP
rs773369888 320 dbSNP
rs560662442 321 dbSNP
rs1385382331 347 dbSNP
rs377473316 350 dbSNP
rs950815554 351 dbSNP
rs368792555 363 dbSNP
rs1179051100 364 dbSNP
rs1470542443 367 dbSNP
rs578129778 369 dbSNP
rs1284965591 370 dbSNP
rs1190316796 378 dbSNP
rs147021258 380 dbSNP
rs1243364167 387 dbSNP
rs1193756098 399 dbSNP
rs994846496 410 dbSNP
rs963925368 411 dbSNP
rs1208222889 417 dbSNP
rs1245236219 433 dbSNP
rs1461581373 440 dbSNP
rs1177835357 447 dbSNP
rs1464387537 452 dbSNP
rs1023232717 453 dbSNP
rs1159085836 457 dbSNP
rs1013470274 463 dbSNP
rs1009095338 464 dbSNP
rs1205313512 469 dbSNP
rs1324088460 471 dbSNP
rs895971043 487 dbSNP
rs1278145204 498 dbSNP
rs41297153 502 dbSNP
rs1003246378 508 dbSNP
rs1334359852 513 dbSNP
rs902306925 515 dbSNP
rs1341512834 520 dbSNP
rs1444924022 529 dbSNP
rs1280669341 531 dbSNP
rs180835124 536 dbSNP
rs1366949632 538 dbSNP
rs1042004420 560 dbSNP
rs946483296 583 dbSNP
rs1324615897 584 dbSNP
rs1164843385 588 dbSNP
rs1197779084 604 dbSNP
rs914875421 626 dbSNP
rs1052054187 634 dbSNP
rs189263020 635 dbSNP
rs1246091798 637 dbSNP
rs761642883 658 dbSNP
rs1363630246 682 dbSNP
rs1429546246 703 dbSNP
rs1477252210 706 dbSNP
rs1168115147 717 dbSNP
rs927939564 718 dbSNP
rs1412028990 721 dbSNP
rs946390164 724 dbSNP
rs774079856 725 dbSNP
rs1453801823 726 dbSNP
rs1349863306 728 dbSNP
rs535123408 729 dbSNP
rs1174852973 736 dbSNP
rs543254508 742 dbSNP
rs1038964956 747 dbSNP
rs969274733 764 dbSNP
rs943311137 771 dbSNP
rs1341168328 774 dbSNP
rs916428735 782 dbSNP
rs991535557 783 dbSNP
rs541526809 790 dbSNP
rs529073786 796 dbSNP
rs1268908382 802 dbSNP
rs148200576 803 dbSNP
rs1191007584 804 dbSNP
rs768613794 805 dbSNP
rs539592667 808 dbSNP
rs952109406 809 dbSNP
rs1413701488 810 dbSNP
rs1027651965 815 dbSNP
rs1305507975 828 dbSNP
rs929340220 832 dbSNP
rs1448411222 837 dbSNP
rs993546463 838 dbSNP
rs962595049 847 dbSNP
rs1227881172 852 dbSNP
rs1388242178 853 dbSNP
rs1019215946 856 dbSNP
rs1357023998 856 dbSNP
rs749158900 868 dbSNP
rs1185387528 875 dbSNP
rs1487659132 880 dbSNP
rs1009580688 898 dbSNP
rs1263396284 903 dbSNP
rs1447290179 907 dbSNP
rs570572635 916 dbSNP
rs574146548 924 dbSNP
rs973378549 925 dbSNP
rs1461586020 928 dbSNP
rs963421257 929 dbSNP
rs1236714006 941 dbSNP
rs779632913 947 dbSNP
rs1439792467 952 dbSNP
rs1386459560 955 dbSNP
rs991735240 960 dbSNP
rs551859525 962 dbSNP
rs960609330 966 dbSNP
rs1156967482 969 dbSNP
rs1387239207 972 dbSNP
rs531847578 981 dbSNP
rs1380255198 984 dbSNP
rs557454250 985 dbSNP
rs1050562789 988 dbSNP
rs1352975723 1005 dbSNP
rs1236252971 1007 dbSNP
rs768556175 1009 dbSNP
rs1035813962 1019 dbSNP
rs569421099 1020 dbSNP
rs1460240836 1024 dbSNP
rs769246345 1025 dbSNP
rs749172913 1030 dbSNP
rs1185870509 1036 dbSNP
rs902234505 1042 dbSNP
rs777734802 1051 dbSNP
rs906426255 1057 dbSNP
rs1020679244 1069 dbSNP
rs1454402145 1073 dbSNP
rs1445279266 1079 dbSNP
rs1404250898 1083 dbSNP
rs1010960941 1087 dbSNP
rs1337229022 1094 dbSNP
rs893461165 1095 dbSNP
rs1776209 1097 dbSNP
rs571321436 1109 dbSNP
rs943291114 1133 dbSNP
rs916376643 1136 dbSNP
rs1335798327 1137 dbSNP
rs983991547 1139 dbSNP
rs1260848420 1140 dbSNP
rs930706532 1143 dbSNP
rs920706031 1147 dbSNP
rs1264081668 1151 dbSNP
rs45556637 1157 dbSNP
rs571373354 1159 dbSNP
rs775917113 1160 dbSNP
rs1419726499 1171 dbSNP
rs529304918 1172 dbSNP
rs1427459836 1178 dbSNP
rs1165351211 1181 dbSNP
rs1019377038 1182 dbSNP
rs1412731750 1193 dbSNP
rs1177442572 1194 dbSNP
rs987707781 1202 dbSNP
rs1399218084 1211 dbSNP
rs1460307468 1212 dbSNP
rs1299787428 1218 dbSNP
rs919310945 1218 dbSNP
rs12252682 1227 dbSNP
rs1385727021 1230 dbSNP
rs942131922 1251 dbSNP
rs1280732676 1260 dbSNP
rs1346863373 1267 dbSNP
rs1471078733 1268 dbSNP
rs1223695026 1274 dbSNP
rs1233640329 1281 dbSNP
rs1029115146 1284 dbSNP
rs1204772452 1291 dbSNP
rs566804138 1293 dbSNP
rs1482089619 1301 dbSNP
rs1222410607 1308 dbSNP
rs1011066672 1312 dbSNP
rs1490868655 1314 dbSNP
rs531643943 1317 dbSNP
rs1030733283 1329 dbSNP
rs999702095 1344 dbSNP
rs1172350200 1347 dbSNP
rs1373432198 1348 dbSNP
rs186284006 1355 dbSNP
rs573799315 1366 dbSNP
rs1046487885 1368 dbSNP
rs1311277400 1380 dbSNP
rs1225824552 1390 dbSNP
rs1035908243 1396 dbSNP
rs1405073133 1400 dbSNP
rs977537636 1409 dbSNP
rs1359505784 1410 dbSNP
rs1374558742 1415 dbSNP
rs967532552 1418 dbSNP
rs1308462771 1421 dbSNP
rs1288563171 1422 dbSNP
rs1408862610 1425 dbSNP
rs1361647109 1432 dbSNP
rs947993273 1439 dbSNP
rs895096391 1446 dbSNP
rs1241738816 1456 dbSNP
rs1484975738 1465 dbSNP
rs1021777698 1473 dbSNP
rs1262104212 1475 dbSNP
rs1443811194 1479 dbSNP
rs1161563814 1482 dbSNP
rs1387064945 1489 dbSNP
rs1424727724 1493 dbSNP
rs1157820104 1501 dbSNP
rs1304445521 1511 dbSNP
rs1458021669 1518 dbSNP
rs931156950 1524 dbSNP
rs1289113556 1526 dbSNP
rs1366333761 1530 dbSNP
rs1452423995 1531 dbSNP
rs1237236873 1533 dbSNP
rs1385704862 1534 dbSNP
rs76235426 1546 dbSNP
rs893586925 1549 dbSNP
rs1017235762 1561 dbSNP
rs755555087 1566 dbSNP
rs546568929 1567 dbSNP
rs529934403 1575 dbSNP
rs1181587992 1576 dbSNP
rs574989691 1591 dbSNP
rs1445098236 1597 dbSNP
rs1176566970 1599 dbSNP
rs1405106092 1600 dbSNP
rs897641447 1606 dbSNP
rs561484285 1607 dbSNP
rs1037976552 1612 dbSNP
rs1471733762 1630 dbSNP
rs1029231173 1635 dbSNP
rs942119858 1638 dbSNP
rs989590966 1639 dbSNP
rs1385450892 1643 dbSNP
rs1449332387 1649 dbSNP
rs1279519445 1664 dbSNP
rs36105375 1675 dbSNP
rs879326181 1690 dbSNP
rs1225584691 1693 dbSNP
rs181769533 1696 dbSNP
rs915990412 1703 dbSNP
rs1055762259 1713 dbSNP
rs999242547 1728 dbSNP
rs938701787 1729 dbSNP
rs780708704 1738 dbSNP
rs1218617512 1750 dbSNP
rs1317845907 1759 dbSNP
rs370082311 1759 dbSNP
rs1267899028 1768 dbSNP
rs1024633491 1781 dbSNP
rs1177342398 1792 dbSNP
rs1227336465 1793 dbSNP
rs1011947793 1799 dbSNP
rs1178167422 1800 dbSNP
rs1284881024 1807 dbSNP
rs572775594 1817 dbSNP
rs867786022 1827 dbSNP
rs1415442435 1845 dbSNP
rs1328743620 1859 dbSNP
rs1366353169 1859 dbSNP
rs1353330034 1871 dbSNP
rs977630726 1904 dbSNP
rs967627947 1908 dbSNP
rs914741206 1909 dbSNP
rs1308643942 1921 dbSNP
rs990731255 1922 dbSNP
rs995436004 1923 dbSNP
rs1285468290 1928 dbSNP
rs189018022 1933 dbSNP
rs567327438 1936 dbSNP
rs1213829330 1954 dbSNP
rs1270786917 1961 dbSNP
rs539363913 1966 dbSNP
rs1267492854 1984 dbSNP
rs1489655249 1985 dbSNP
rs1007197474 2000 dbSNP
rs940784970 2002 dbSNP
rs1158161498 2004 dbSNP
rs1167766210 2006 dbSNP
rs1412078585 2009 dbSNP
rs1417819754 2009 dbSNP
rs1169811363 2019 dbSNP
rs1455492733 2023 dbSNP
rs148382215 2029 dbSNP
rs954346196 2033 dbSNP
rs1177104291 2037 dbSNP
rs1331962995 2041 dbSNP
rs1430280131 2041 dbSNP
rs911999133 2043 dbSNP
rs1030023754 2044 dbSNP
rs1265387052 2045 dbSNP
rs993409712 2054 dbSNP
rs1051760005 2061 dbSNP
rs932009881 2062 dbSNP
rs1207214608 2068 dbSNP
rs1326151868 2085 dbSNP
rs1240675880 2088 dbSNP
rs1476613153 2089 dbSNP
rs921957312 2094 dbSNP
rs897778661 2099 dbSNP
rs756184034 2100 dbSNP
rs924127858 2101 dbSNP
rs1391557728 2103 dbSNP
rs184259295 2106 dbSNP
rs1316534639 2128 dbSNP
rs149062648 2131 dbSNP
rs1314311303 2132 dbSNP
rs1435483677 2132 dbSNP
rs970488559 2139 dbSNP
rs1025167251 2143 dbSNP
rs1209173066 2143 dbSNP
rs1349303444 2143 dbSNP
rs202194341 2143 dbSNP
rs879582960 2143 dbSNP
rs1365817612 2149 dbSNP
rs1012019866 2173 dbSNP
rs1006471958 2177 dbSNP
rs894538426 2178 dbSNP
rs1466544570 2179 dbSNP
rs1189544349 2198 dbSNP
rs1243072470 2208 dbSNP
rs146597829 2210 dbSNP
rs1185946436 2217 dbSNP
rs938797715 2221 dbSNP
rs1469657836 2229 dbSNP
rs1026659062 2230 dbSNP
rs928622183 2234 dbSNP
rs1041740904 2236 dbSNP
rs1335918477 2240 dbSNP
rs946295588 2250 dbSNP
rs1454558547 2253 dbSNP
rs897103460 2270 dbSNP
rs1036859762 2275 dbSNP
rs1236189907 2283 dbSNP
rs1008507768 2296 dbSNP
rs1329332799 2304 dbSNP
rs1202631073 2312 dbSNP
rs1262968344 2313 dbSNP
rs890528850 2315 dbSNP
rs914810644 2319 dbSNP
rs569358470 2320 dbSNP
rs932083666 2332 dbSNP
rs1418593556 2337 dbSNP
rs1465757980 2344 dbSNP
rs561402297 2345 dbSNP
rs1473074678 2349 dbSNP
rs1175946551 2367 dbSNP
rs1426989330 2373 dbSNP
rs1172606363 2379 dbSNP
rs1053751786 2384 dbSNP
rs1395610047 2386 dbSNP
rs1389177529 2388 dbSNP
rs549527187 2395 dbSNP
rs1330380662 2397 dbSNP
rs754692616 2402 dbSNP
rs1350548475 2406 dbSNP
rs1222570853 2418 dbSNP
rs1450243110 2437 dbSNP
rs1321884766 2440 dbSNP
rs936914691 2443 dbSNP
rs924215085 2444 dbSNP
rs761986350 2448 dbSNP
rs964573274 2451 dbSNP
rs1187282513 2452 dbSNP
rs978265067 2467 dbSNP
rs1254133375 2469 dbSNP
rs879037200 2469 dbSNP
rs911424062 2476 dbSNP
rs1462898528 2481 dbSNP
rs1257343351 2495 dbSNP
rs1434697723 2498 dbSNP
rs971279627 2504 dbSNP
rs1372280364 2506 dbSNP
rs1169550331 2509 dbSNP
rs986263847 2515 dbSNP
rs918105200 2525 dbSNP
rs990534574 2527 dbSNP
rs1300921651 2532 dbSNP
rs1346931369 2538 dbSNP
rs1386987694 2541 dbSNP
rs959114063 2551 dbSNP
rs192979482 2564 dbSNP
rs1225927025 2565 dbSNP
rs995207068 2570 dbSNP
rs774139082 2581 dbSNP
rs1221766266 2582 dbSNP
rs1267040481 2595 dbSNP
rs564885188 2612 dbSNP
rs1191975113 2614 dbSNP
rs1296750475 2621 dbSNP
rs1260832402 2622 dbSNP
rs1015951693 2633 dbSNP
rs1190462772 2639 dbSNP
rs763823769 2640 dbSNP
rs762727606 2641 dbSNP
rs1384673420 2642 dbSNP
rs1028122311 2643 dbSNP
rs1376432673 2647 dbSNP
rs1287892985 2650 dbSNP
rs1334570415 2659 dbSNP
rs377119657 2660 dbSNP
rs996212079 2681 dbSNP
rs1380835550 2687 dbSNP
rs961918591 2705 dbSNP
rs1366467647 2706 dbSNP
rs1395299894 2716 dbSNP
rs1245874676 2719 dbSNP
rs1289751804 2720 dbSNP
rs566767282 2736 dbSNP
rs1400332105 2750 dbSNP
rs1300158199 2752 dbSNP
rs1260315934 2753 dbSNP
rs1006026786 2756 dbSNP
rs547229404 2761 dbSNP
rs894286744 2766 dbSNP
rs1370055535 2770 dbSNP
rs1443996026 2771 dbSNP
rs1181656526 2798 dbSNP
rs1423849645 2798 dbSNP
rs189560774 2798 dbSNP
rs1157942490 2799 dbSNP
rs564485095 2800 dbSNP
rs936689065 2807 dbSNP
rs1446976443 2818 dbSNP
rs550749351 2831 dbSNP
rs1323046026 2849 dbSNP
rs775358047 2853 dbSNP
rs1389820591 2857 dbSNP
rs1369350397 2863 dbSNP
rs1452607586 2875 dbSNP
rs1282905387 2877 dbSNP
rs531041139 2892 dbSNP
rs1422508875 2902 dbSNP
rs1228907239 2904 dbSNP
rs1306569493 2905 dbSNP
rs1315424927 2907 dbSNP
rs1041661120 2919 dbSNP
rs902529438 2920 dbSNP
rs1268582786 2921 dbSNP
rs1043003322 2924 dbSNP
rs561420944 2929 dbSNP
rs1483297711 2932 dbSNP
rs949670109 2933 dbSNP
rs918038727 2937 dbSNP
rs946069206 2944 dbSNP
rs1473399996 2948 dbSNP
rs184701525 2953 dbSNP
rs1159413247 2966 dbSNP
rs1413205915 2967 dbSNP
rs1469571752 2972 dbSNP
rs1332788492 2974 dbSNP
rs1206915462 2975 dbSNP
rs1483070107 2982 dbSNP
rs1273326539 2984 dbSNP
rs77117729 2985 dbSNP
rs1449393128 2988 dbSNP
rs79983315 2994 dbSNP
rs201419100 2995 dbSNP
rs551351044 2995 dbSNP
rs1202855624 2998 dbSNP
rs1289176176 2999 dbSNP
rs1358363914 3000 dbSNP
rs1322581932 3003 dbSNP
rs919704224 3005 dbSNP
rs1243756006 3007 dbSNP
rs1280654807 3009 dbSNP
rs1312767527 3016 dbSNP
rs1203714687 3028 dbSNP
rs1230722999 3047 dbSNP
rs1406485960 3048 dbSNP
rs572759848 3056 dbSNP
rs893358810 3082 dbSNP
rs1267666599 3083 dbSNP
rs1480318603 3084 dbSNP
rs1171263823 3103 dbSNP
rs1427685535 3109 dbSNP
rs1415596210 3112 dbSNP
rs1170322771 3122 dbSNP
rs1055103098 3129 dbSNP
rs1368827110 3135 dbSNP
rs1411683559 3152 dbSNP
rs1308879362 3163 dbSNP
rs973716900 3171 dbSNP
rs961313059 3181 dbSNP
rs1338532691 3182 dbSNP
rs1276454151 3187 dbSNP
rs528093199 3195 dbSNP
rs1213952385 3200 dbSNP
rs1410698526 3205 dbSNP
rs1272329831 3212 dbSNP
rs1343702586 3217 dbSNP
rs1205170783 3220 dbSNP
rs987091099 3223 dbSNP
rs769739476 3227 dbSNP
rs745420772 3228 dbSNP
rs996661794 3238 dbSNP
rs1426693286 3248 dbSNP
rs911374831 3255 dbSNP
rs1392082821 3256 dbSNP
rs1431708352 3281 dbSNP
rs900575822 3282 dbSNP
rs1365019762 3284 dbSNP
rs986999537 3289 dbSNP
rs933021829 3297 dbSNP
rs923019824 3299 dbSNP
rs1325735452 3316 dbSNP
rs1331498757 3317 dbSNP
rs1163233538 3329 dbSNP
rs1429699486 3338 dbSNP
rs560037652 3343 dbSNP
rs1367354874 3345 dbSNP
rs1229040616 3350 dbSNP
rs971702225 3362 dbSNP
rs1164907473 3372 dbSNP
rs1313804678 3373 dbSNP
rs1353609843 3377 dbSNP
rs1365939033 3377 dbSNP
rs1000969803 3379 dbSNP
rs962029591 3385 dbSNP
rs1215431096 3404 dbSNP
rs144403009 3404 dbSNP
rs1246568745 3407 dbSNP
rs1183846045 3423 dbSNP
rs1451939228 3425 dbSNP
rs1189748121 3431 dbSNP
rs1384723949 3432 dbSNP
rs1471826482 3433 dbSNP
rs1165239675 3434 dbSNP
rs1472717174 3435 dbSNP
rs1250352607 3440 dbSNP
rs1400339902 3456 dbSNP
rs1318366637 3457 dbSNP
rs1390537852 3460 dbSNP
rs1435776341 3467 dbSNP
rs1335959550 3471 dbSNP
rs1179382221 3472 dbSNP
rs1338216460 3481 dbSNP
rs1452872317 3487 dbSNP
rs985095192 3495 dbSNP
rs1042393492 3496 dbSNP
rs1226173661 3504 dbSNP
rs776159071 3514 dbSNP
rs949667237 3517 dbSNP
rs1209937065 3528 dbSNP
rs1353941446 3531 dbSNP
rs1034590126 3532 dbSNP
rs545832557 3535 dbSNP
rs1431932707 3557 dbSNP
rs896774764 3566 dbSNP
rs1369119512 3567 dbSNP
rs1002670244 3575 dbSNP
rs1157179000 3576 dbSNP
rs1413947099 3576 dbSNP
rs1457531299 3585 dbSNP
rs1229179383 3586 dbSNP
rs192364620 3592 dbSNP
rs577053870 3593 dbSNP
rs1397707118 3595 dbSNP
rs1334308588 3610 dbSNP
rs1334637936 3626 dbSNP
rs1407651524 3634 dbSNP
rs770710597 3637 dbSNP
rs938184804 3638 dbSNP
rs1331681287 3639 dbSNP
rs1229326486 3641 dbSNP
rs920110763 3661 dbSNP
rs1028100325 3662 dbSNP
rs1010305922 3663 dbSNP
rs893109082 3671 dbSNP
rs1054498437 3672 dbSNP
rs942936818 3673 dbSNP
rs1160386136 3674 dbSNP
rs890050933 3676 dbSNP
rs986515245 3686 dbSNP
rs1457106383 3689 dbSNP
rs955455284 3690 dbSNP
rs1254178009 3695 dbSNP
rs1175177780 3702 dbSNP
rs1051224163 3710 dbSNP
rs1410728488 3720 dbSNP
rs1156563953 3723 dbSNP
rs746599780 3724 dbSNP
rs557326952 3725 dbSNP
rs537220048 3727 dbSNP
rs1427206275 3738 dbSNP
rs971794024 3739 dbSNP
rs574196260 3752 dbSNP
rs1032814517 3792 dbSNP
rs374947654 3793 dbSNP
rs1329684049 3801 dbSNP
rs908870091 3803 dbSNP
rs1257051832 3804 dbSNP
rs55921749 3804 dbSNP
rs1276857511 3813 dbSNP
rs796245744 3821 dbSNP
rs868700110 3823 dbSNP
rs11186811 3825 dbSNP
rs546300433 3825 dbSNP
rs1458093404 3827 dbSNP
rs200936666 3827 dbSNP
rs537157814 3827 dbSNP
rs61875182 3827 dbSNP
rs1463349614 3829 dbSNP
rs373292872 3829 dbSNP
rs61875181 3829 dbSNP
rs1346236323 3830 dbSNP
rs1001317250 3831 dbSNP
rs762713507 3831 dbSNP
rs111440534 3833 dbSNP
rs1207905782 3833 dbSNP
rs1345760505 3835 dbSNP
rs1483266960 3835 dbSNP
rs1249086263 3837 dbSNP
rs1274343053 3840 dbSNP
rs966859121 3843 dbSNP
rs1409154645 3848 dbSNP
rs1021366624 3850 dbSNP
rs11186810 3850 dbSNP
rs1174531082 3850 dbSNP
rs1307662054 3850 dbSNP
rs1360994149 3850 dbSNP
rs1217436246 3852 dbSNP
rs1279971084 3852 dbSNP
rs1366605374 3852 dbSNP
rs796586864 3852 dbSNP
rs143546605 3854 dbSNP
rs749025600 3854 dbSNP
rs772834199 3854 dbSNP
rs1203724616 3856 dbSNP
rs1367959481 3866 dbSNP
rs1271850973 3869 dbSNP
rs958839946 3872 dbSNP
rs1034247189 3883 dbSNP
rs755459926 3890 dbSNP
rs143948074 3901 dbSNP
rs539859584 3902 dbSNP
rs560159720 3903 dbSNP
rs1427788962 3907 dbSNP
rs1020095230 3913 dbSNP
rs1010273539 3918 dbSNP
rs1055362465 3935 dbSNP
rs139684627 3936 dbSNP
rs530976528 3939 dbSNP
rs150619443 3945 dbSNP
rs1329741849 3949 dbSNP
rs1006894463 3952 dbSNP
rs1038540833 3962 dbSNP
rs756592338 3966 dbSNP
rs1371720200 3967 dbSNP
rs548224601 3969 dbSNP
rs890012350 3973 dbSNP
rs1171465607 3974 dbSNP
rs908312985 3976 dbSNP
rs1051360565 4024 dbSNP
rs1288636727 4040 dbSNP
rs1451397367 4052 dbSNP
rs1219913181 4055 dbSNP
rs998467980 4059 dbSNP
rs528170252 4060 dbSNP
rs187745772 4062 dbSNP
rs940429435 4064 dbSNP
rs1388432006 4073 dbSNP
rs1451353204 4079 dbSNP
rs1168728109 4080 dbSNP
rs1464236083 4081 dbSNP
rs1413255159 4088 dbSNP
rs933632594 4090 dbSNP
rs1325343966 4092 dbSNP
rs908971952 4094 dbSNP
rs1394913587 4095 dbSNP
rs543517472 4097 dbSNP
rs1366760687 4103 dbSNP
rs937033886 4115 dbSNP
rs926989412 4132 dbSNP
rs1283084879 4136 dbSNP
rs1353892581 4155 dbSNP
rs975265583 4156 dbSNP
rs1275487916 4159 dbSNP
rs981304560 4164 dbSNP
rs1208672299 4165 dbSNP
rs1246665306 4166 dbSNP
rs957287302 4168 dbSNP
rs925776084 4169 dbSNP
rs1443230657 4175 dbSNP
rs1471960148 4181 dbSNP
rs977315855 4184 dbSNP
rs1418337946 4191 dbSNP
rs971324625 4192 dbSNP
rs1278259317 4195 dbSNP
rs1390837000 4199 dbSNP
rs1382701356 4201 dbSNP
rs1198771853 4209 dbSNP
rs1332988915 4211 dbSNP
rs1338162372 4214 dbSNP
rs1344469279 4221 dbSNP
rs967185048 4238 dbSNP
rs35952322 4239 dbSNP
rs1021063167 4240 dbSNP
rs1335924110 4253 dbSNP
rs1014106621 4254 dbSNP
rs1267983071 4255 dbSNP
rs1298922271 4265 dbSNP
rs1266620608 4274 dbSNP
rs1228349577 4276 dbSNP
rs960670090 4283 dbSNP
rs1278052275 4291 dbSNP
rs1440726750 4294 dbSNP
rs1033689935 4295 dbSNP
rs1258410853 4305 dbSNP
rs750497847 4307 dbSNP
rs544799342 4313 dbSNP
rs1413879959 4314 dbSNP
rs1454286831 4329 dbSNP
rs545467878 4348 dbSNP
rs1171890103 4350 dbSNP
rs1449285155 4351 dbSNP
rs747979035 4353 dbSNP
rs1313112155 4360 dbSNP
rs957644265 4361 dbSNP
rs1407600893 4365 dbSNP
rs1359372693 4366 dbSNP
rs1033115208 4384 dbSNP
rs767570875 4392 dbSNP
rs1337871054 4393 dbSNP
rs776265170 4395 dbSNP
rs1240425377 4396 dbSNP
rs555540419 4403 dbSNP
rs954015710 4404 dbSNP
rs1029692373 4405 dbSNP
rs1371896058 4406 dbSNP
rs1482882107 4415 dbSNP
rs563544771 4417 dbSNP
rs1252447608 4423 dbSNP
rs1419398760 4442 dbSNP
rs1004406353 4446 dbSNP
rs1375792393 4452 dbSNP
rs7082939 4453 dbSNP
rs1173783068 4457 dbSNP
rs897447248 4459 dbSNP
rs887291080 4461 dbSNP
rs1037171174 4468 dbSNP
rs1427464852 4483 dbSNP
rs543754712 4485 dbSNP
rs1399099923 4494 dbSNP
rs574644434 4501 dbSNP
rs1392261621 4512 dbSNP
rs1301011902 4516 dbSNP
rs1388029475 4523 dbSNP
rs887493430 4535 dbSNP
rs1237119605 4544 dbSNP
rs1183366940 4555 dbSNP
rs1304312884 4556 dbSNP
rs1473042288 4563 dbSNP
rs142856681 4565 dbSNP
rs1226496466 4568 dbSNP
rs1253229207 4575 dbSNP
rs541264834 4588 dbSNP
rs7079522 4606 dbSNP
rs937108529 4608 dbSNP
rs1480837722 4616 dbSNP
rs926956850 4628 dbSNP
rs573245904 4638 dbSNP
rs949937142 4640 dbSNP
rs1264980957 4641 dbSNP
rs913153442 4643 dbSNP
rs1194149507 4646 dbSNP
rs989025597 4653 dbSNP
rs1389044387 4654 dbSNP
rs1484053741 4655 dbSNP
rs1275447423 4657 dbSNP
rs1447076997 4657 dbSNP
rs1172098647 4668 dbSNP
rs933750145 4668 dbSNP
rs920889084 4670 dbSNP
rs957241723 4671 dbSNP
rs1293360652 4673 dbSNP
rs1388992770 4675 dbSNP
rs1205000138 4686 dbSNP
rs1327108769 4692 dbSNP
rs1364561778 4694 dbSNP
rs75724762 4715 dbSNP
rs1297804669 4717 dbSNP
rs1292719770 4724 dbSNP
rs935912977 4732 dbSNP
rs539425259 4733 dbSNP
rs1336624881 4738 dbSNP
rs977640804 4745 dbSNP
rs985544586 4749 dbSNP
rs1283193249 4752 dbSNP
rs1463487342 4755 dbSNP
rs185005230 4775 dbSNP
rs917083750 4794 dbSNP
rs954149380 4796 dbSNP
rs374438825 4810 dbSNP
rs1162216475 4819 dbSNP
rs192461259 4826 dbSNP
rs1351729449 4829 dbSNP
rs577667395 4849 dbSNP
rs532692565 4856 dbSNP
rs1308126167 4857 dbSNP
rs1463292105 4857 dbSNP
rs1388630289 4859 dbSNP
rs1429218359 4861 dbSNP
rs1290755741 4868 dbSNP
rs1362711802 4868 dbSNP
rs1395701677 4871 dbSNP
rs557195150 4873 dbSNP
rs1310783456 4881 dbSNP
rs960786242 4882 dbSNP
rs1233745188 4895 dbSNP
rs1267247381 4898 dbSNP
rs1352684359 4906 dbSNP
rs1166880423 4910 dbSNP
rs1029664377 4913 dbSNP
rs1033680014 4915 dbSNP
rs976759459 4916 dbSNP
rs1191419408 4917 dbSNP
rs1405689278 4918 dbSNP
rs1260838653 4931 dbSNP
rs961584311 4936 dbSNP
rs1259093821 4937 dbSNP
rs397718186 4937 dbSNP
rs78525297 4937 dbSNP
rs1006244779 4938 dbSNP
rs962934615 4939 dbSNP
rs1017160679 4940 dbSNP
rs1252881684 4940 dbSNP
rs35944165 4947 dbSNP
rs114776112 4948 dbSNP
rs1465557149 4948 dbSNP
rs528084017 4948 dbSNP
rs1287535967 4949 dbSNP
rs1348354373 4952 dbSNP
rs1225419826 4953 dbSNP
rs1307553625 4953 dbSNP
rs1311111257 4953 dbSNP
rs1482135769 4955 dbSNP
rs1207490720 4956 dbSNP
rs1281821822 4960 dbSNP
rs565347525 4961 dbSNP
rs1485820454 4962 dbSNP
rs148535158 4966 dbSNP
rs1251583438 4968 dbSNP
rs1468879298 4969 dbSNP
rs887247512 4972 dbSNP
rs1034300888 4977 dbSNP
rs759804647 4984 dbSNP
rs1288177331 4987 dbSNP
rs1030244991 4988 dbSNP
rs1001281929 4994 dbSNP
rs1307601683 4995 dbSNP
rs1352561830 5000 dbSNP
rs899626872 5013 dbSNP
rs905627852 5026 dbSNP
rs1298526345 5027 dbSNP
rs1231015704 5035 dbSNP
rs1366891068 5035 dbSNP
rs1045332992 5038 dbSNP
rs1330760644 5052 dbSNP
rs1288665448 5053 dbSNP
rs1408657033 5057 dbSNP
rs866446043 5066 dbSNP
rs949739612 5072 dbSNP
rs1227240506 5088 dbSNP
rs1271965126 5091 dbSNP
rs147182808 5095 dbSNP
rs935693409 5096 dbSNP
rs775335274 5106 dbSNP
rs1233792743 5115 dbSNP
rs904206861 5118 dbSNP
rs1192261540 5128 dbSNP
rs1396994757 5129 dbSNP
rs1454724178 5132 dbSNP
rs1053030890 5153 dbSNP
rs1349029510 5159 dbSNP
rs746702048 5159 dbSNP
rs534736081 5164 dbSNP
rs1411850999 5170 dbSNP
rs1041608385 5179 dbSNP
rs548487943 5181 dbSNP
rs1349054538 5182 dbSNP
rs765111482 5183 dbSNP
rs528719882 5188 dbSNP
rs1327780590 5191 dbSNP
rs935940980 5204 dbSNP
rs1371109450 5213 dbSNP
rs917051430 5235 dbSNP
rs1267890981 5238 dbSNP
rs1341099146 5239 dbSNP
rs992701326 5260 dbSNP
rs187640342 5270 dbSNP
rs1334559062 5276 dbSNP
rs1417350845 5278 dbSNP
rs1269603290 5303 dbSNP
rs372331300 5307 dbSNP
rs779834966 5307 dbSNP
rs552270373 5316 dbSNP
rs985734441 5319 dbSNP
rs1188076059 5339 dbSNP
rs932691053 5339 dbSNP
rs1240405679 5342 dbSNP
rs1476533581 5343 dbSNP
rs922686442 5344 dbSNP
rs926714899 5353 dbSNP
rs1412827513 5361 dbSNP
rs976726964 5365 dbSNP
rs1167012329 5371 dbSNP
rs961354062 5376 dbSNP
rs1488449765 5384 dbSNP
rs1395212833 5385 dbSNP
rs1245541460 5386 dbSNP
rs980868348 5415 dbSNP
rs1315662547 5418 dbSNP
rs1210966581 5424 dbSNP
rs532110181 5429 dbSNP
rs984384261 5432 dbSNP
rs1227432795 5438 dbSNP
rs1314541807 5443 dbSNP
rs1231919746 5446 dbSNP
rs776016387 5454 dbSNP
rs983013668 5478 dbSNP
rs1205025371 5483 dbSNP
rs1302782696 5483 dbSNP
rs1219362111 5484 dbSNP
rs951756834 5488 dbSNP
rs1366809733 5496 dbSNP
rs1323849335 5505 dbSNP
rs1237052534 5510 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugGUAAUAC-ACGACGAu 5'
                 | || || ||||||| 
Target 5' -------CUUUCUGCUGCUGCUu 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUAC-ACGACGAu 5'
                   || || ||||||| 
Target 5' --------uUUCUGCUGCUGCUu 3'
1 - 15
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000412050.4 | 3UTR | CUUUCUGCUGCUGCUUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000412050.4 | 3UTR | UUUCUGCUGCUGCUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.677 1.9e-4 0.571 2.2e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.66 7.7e-4 0.761 4.9e-5 20 Click to see details
GSE32688 Pancreatic cancer -0.447 5.2e-3 -0.275 6.4e-2 32 Click to see details
GSE19783 ER- ER- breast cancer 0.268 8.5e-3 0.312 2.6e-3 79 Click to see details
GSE19536 Breast cancer 0.238 8.6e-3 0.243 7.4e-3 100 Click to see details
GSE17498 Multiple myeloma 0.349 1.4e-2 0.213 9.3e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.439 1.4e-2 0.392 2.6e-2 25 Click to see details
GSE21032 Prostate cancer -0.21 2.8e-2 -0.271 6.6e-3 83 Click to see details
GSE21849 B cell lymphoma -0.317 4.7e-2 -0.275 7.4e-2 29 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.278 8.9e-2 -0.358 3.9e-2 25 Click to see details
GSE28260 Renal cortex and medulla -0.319 1.4e-1 -0.253 2.0e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.264 1.6e-1 -0.156 2.8e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.303 1.7e-1 -0.014 4.8e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.1 1.7e-1 0.121 1.3e-1 90 Click to see details
GSE28544 Breast cancer -0.162 2.2e-1 -0.620 6.2e-4 24 Click to see details
GSE38226 Liver fibrosis 0.154 2.5e-1 0.218 1.7e-1 21 Click to see details
GSE17306 Multiple myeloma 0.072 3.1e-1 0.097 2.5e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.07 3.8e-1 0.147 2.7e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.025 4.2e-1 -0.008 4.7e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.036 4.3e-1 -0.067 3.8e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.036 4.3e-1 -0.067 3.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.362 0 -0.315 0 68 Click to see details
KIRP -0.313 0.04 -0.404 0.01 32 Click to see details
KICH -0.316 0.06 -0.434 0.02 25 Click to see details
THCA -0.193 0.07 -0.250 0.03 59 Click to see details
LUSC 0.216 0.1 0.210 0.1 38 Click to see details
STAD -0.23 0.1 -0.181 0.16 32 Click to see details
BLCA -0.287 0.12 -0.337 0.09 18 Click to see details
PRAD 0.164 0.13 0.198 0.08 50 Click to see details
PCPG -0.845 0.18 -1.000 0.5 3 Click to see details
CHOL -0.347 0.18 -0.617 0.04 9 Click to see details
CESC 0.84 0.18 0.500 0.33 3 Click to see details
COAD -0.34 0.2 -0.667 0.04 8 Click to see details
HNSC -0.09 0.29 -0.146 0.18 42 Click to see details
LIHC 0.048 0.37 -0.047 0.37 49 Click to see details
BRCA -0.024 0.41 -0.060 0.29 84 Click to see details
ESCA 0.062 0.43 0.045 0.45 11 Click to see details
LUAD -0.053 0.44 -0.140 0.33 12 Click to see details
UCEC -0.018 0.47 0.053 0.41 19 Click to see details
PAAD -0.026 0.49 0.000 0.5 4 Click to see details
PAAD -0.026 0.49 0.000 0.5 4 Click to see details
PAAD -0.026 0.49 0.000 0.5 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2