miRTarBase - #MIRT512288 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARHGDIA   
Synonyms GDIA1, HEL-S-47e, NPHS8, RHOGDI, RHOGDI-1
Description Rho GDP dissociation inhibitor alpha
Transcript NM_001185077   
Other Transcripts NM_001185078 , NM_004309   
Expression
Putative miRNA Targets on ARHGDIA
3'UTR of ARHGDIA
(miRNA target sites are highlighted)
>ARHGDIA|NM_001185077|3'UTR
   1 GCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTGTCCCCCCCAGCCCCTCCCCTCCC
  81 CATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCCGCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCG
 161 ACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAGCCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGT
 241 GGGGGAGAGAGGCCGCAGCCAGGCCTCTGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCT
 321 GGCTTCAGGAGGGAGCGGAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGG
 401 AGCTGGGGTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTGTCG
 481 CTGTCGGTCCCGTCTAACCATGATGCCTTAACATGTGGAGTGTACCGTGGGGCCTCACTAGCCTCTAACTCCCTGTGTCT
 561 GCATGAGCATGTGGCCTCCCCGTCCCTTCCCCGGTGGCGAACCCAGTGACCCAGGGACACGTGGGGTGTGCTGCTGCTGC
 641 TCCCCAGCCCACCAGTGCCTGGCCAGCCTGCCCCCTTCCCTGGACAGGGCTGTGGAGATGGCTCCGGCGGCTTGGGGAAA
 721 GCCAAATTGCCAAAACTCAAGTCACCTCAGTACCATCCAGGAGGCTGGGTATTGTCCTGCCTCTGCCTTTTCTGTCTCAG
 801 CGGGCAGTGCCCAGAGCCCACACCCCCCCAAGAGCCCTCGATGGACAGCCTCACTCACCCCACCTGGGCCCAGCCAGGAG
 881 CCCCGCCTGGCCATCAGTATTTATTGCCTCCGTCCGTGCCGTCCCTGGGCCACTGGCCTGGCGCCTGTTCCCCCAGGCTC
 961 TCAGTGCCACCACCCCCGGCAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACATTGCTGAGAGC
1041 CGTCTCCTGTGCCTCCCCCGCCCCATCCCCGGTCTTCGTGTTGTGTCTGCCAGGCTCAGGCAGAGGCGCCTGTCCCTGCT
1121 TCTTTTCTGACCGGGAAATAAATGCCCCTGAAGGAGCAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUG-GUA--AUACACGACGAu 5'
             ::|| |:|   :||||||||| 
Target 5' cagGGACACGTGGGGTGTGCTGCTg 3'
612 - 636 153.00 -22.00
2
miRNA  3' guGUUUG-GUA-AUACACGACGAu 5'
            :::|| ::|  :| ||||||| 
Target 5' ccTGGACGTGTGCGTCTGCTGCTc 3'
369 - 392 144.00 -13.10
3
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' gtctcctgtctcgtTGCTGCTt 3'
206 - 227 140.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1030364 41 ClinVar
522880 66 ClinVar
915863 243 ClinVar
COSN26966630 5 COSMIC
COSN30688368 13 COSMIC
COSN26966633 14 COSMIC
COSN15661340 15 COSMIC
COSN24294098 17 COSMIC
COSN30512275 17 COSMIC
COSN13754813 21 COSMIC
COSN30516615 25 COSMIC
COSN30501880 31 COSMIC
COSN26966632 32 COSMIC
COSN30501998 32 COSMIC
COSN28181675 36 COSMIC
COSN30155064 40 COSMIC
COSN31612632 43 COSMIC
COSN30157374 44 COSMIC
COSN30518981 58 COSMIC
COSN1202610 59 COSMIC
COSN20084036 63 COSMIC
COSN31498404 65 COSMIC
COSN32071602 66 COSMIC
COSN26962356 77 COSMIC
COSN32071702 82 COSMIC
COSN21981430 126 COSMIC
COSN28860332 126 COSMIC
COSN30117360 179 COSMIC
COSN28838716 193 COSMIC
COSN31660510 295 COSMIC
COSN30542779 303 COSMIC
COSN27006953 372 COSMIC
COSN27007430 412 COSMIC
COSN30598773 421 COSMIC
COSN20046574 429 COSMIC
COSN26859644 457 COSMIC
COSN9223539 473 COSMIC
COSN19770383 491 COSMIC
COSN20088367 500 COSMIC
COSN31553582 522 COSMIC
COSN1202609 529 COSMIC
COSN31610993 549 COSMIC
COSN20042577 558 COSMIC
COSN31533297 593 COSMIC
COSN30646653 623 COSMIC
COSN31487736 738 COSMIC
COSN30175986 771 COSMIC
COSN26550672 776 COSMIC
COSN28815382 962 COSMIC
COSN17999595 972 COSMIC
COSN26553235 998 COSMIC
COSN15584186 1011 COSMIC
COSN30173884 1035 COSMIC
COSN31532525 1108 COSMIC
COSN26617937 1145 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs11546984 5 dbSNP
rs1228143728 6 dbSNP
rs765171247 8 dbSNP
rs754757370 14 dbSNP
rs373508832 15 dbSNP
rs766138328 17 dbSNP
rs1417668273 18 dbSNP
rs1042272850 19 dbSNP
rs1303902934 22 dbSNP
rs760377906 23 dbSNP
rs772848070 25 dbSNP
rs1057282 27 dbSNP
rs766942075 29 dbSNP
rs1057283 31 dbSNP
rs768213538 32 dbSNP
rs1009457365 33 dbSNP
rs746580972 34 dbSNP
rs369699594 35 dbSNP
rs571770530 36 dbSNP
rs746350097 38 dbSNP
rs1057284 39 dbSNP
rs546790617 40 dbSNP
rs201139992 41 dbSNP
rs779870102 41 dbSNP
rs567655758 42 dbSNP
rs202026197 43 dbSNP
rs778825097 45 dbSNP
rs753761809 46 dbSNP
rs758232372 47 dbSNP
rs750215632 48 dbSNP
rs766228744 50 dbSNP
rs1226933638 51 dbSNP
rs1350463476 54 dbSNP
rs886337329 55 dbSNP
rs530554967 57 dbSNP
rs750057679 58 dbSNP
rs1284662661 60 dbSNP
rs1365514906 61 dbSNP
rs767150158 62 dbSNP
rs1431667638 63 dbSNP
rs761261929 64 dbSNP
rs1161176059 65 dbSNP
rs757131763 66 dbSNP
rs778903662 66 dbSNP
rs897038186 66 dbSNP
rs1455417246 67 dbSNP
rs1443204873 68 dbSNP
rs751122756 69 dbSNP
rs1176642504 70 dbSNP
rs1434412557 71 dbSNP
rs1038261460 72 dbSNP
rs1264577194 73 dbSNP
rs763492845 75 dbSNP
rs760182464 76 dbSNP
rs941350334 77 dbSNP
rs777277511 79 dbSNP
rs761068260 80 dbSNP
rs773335010 81 dbSNP
rs1328499109 82 dbSNP
rs1331993626 82 dbSNP
rs1391970197 82 dbSNP
rs753882835 83 dbSNP
rs772376841 85 dbSNP
rs748293793 90 dbSNP
rs1300757975 91 dbSNP
rs1450239135 94 dbSNP
rs1435889774 97 dbSNP
rs779105538 99 dbSNP
rs961636919 101 dbSNP
rs768717665 102 dbSNP
rs779910117 103 dbSNP
rs1387561015 105 dbSNP
rs755927023 106 dbSNP
rs750195456 107 dbSNP
rs1375843151 108 dbSNP
rs371644062 109 dbSNP
rs764015476 109 dbSNP
rs11546989 110 dbSNP
rs780821323 111 dbSNP
rs1449514616 112 dbSNP
rs1391668657 115 dbSNP
rs1460354295 118 dbSNP
rs1186229976 122 dbSNP
rs1464741322 124 dbSNP
rs948445895 127 dbSNP
rs756985934 128 dbSNP
rs751161946 132 dbSNP
rs763767452 135 dbSNP
rs1229270482 138 dbSNP
rs1344345713 139 dbSNP
rs1230807206 140 dbSNP
rs970320215 142 dbSNP
rs984534034 145 dbSNP
rs1227861562 147 dbSNP
rs1341287530 149 dbSNP
rs762490731 150 dbSNP
rs955720841 152 dbSNP
rs1397534698 154 dbSNP
rs1400025914 159 dbSNP
rs1312161834 160 dbSNP
rs1429858959 161 dbSNP
rs1371808870 162 dbSNP
rs959440482 163 dbSNP
rs1225242902 164 dbSNP
rs1448571301 166 dbSNP
rs1368672232 167 dbSNP
rs1257030963 168 dbSNP
rs754414636 168 dbSNP
rs924285282 168 dbSNP
rs1448976064 169 dbSNP
rs955133122 170 dbSNP
rs766949406 172 dbSNP
rs1422404073 173 dbSNP
rs1478250781 173 dbSNP
rs1003613126 174 dbSNP
rs1256097685 175 dbSNP
rs970517789 177 dbSNP
rs1020756197 178 dbSNP
rs563157861 179 dbSNP
rs1272652675 181 dbSNP
rs893717708 183 dbSNP
rs530110406 185 dbSNP
rs1286140242 189 dbSNP
rs1246764739 192 dbSNP
rs996782121 196 dbSNP
rs773673054 198 dbSNP
rs1292616867 201 dbSNP
rs772310030 203 dbSNP
rs3809896 204 dbSNP
rs1006163200 205 dbSNP
rs1016323815 205 dbSNP
rs1305707578 206 dbSNP
rs774369485 208 dbSNP
rs1391052761 209 dbSNP
rs1164590489 210 dbSNP
rs1302609645 211 dbSNP
rs532896353 217 dbSNP
rs901315268 218 dbSNP
rs1417505538 220 dbSNP
rs1260500986 224 dbSNP
rs1183343229 225 dbSNP
rs1182840295 227 dbSNP
rs1473889737 228 dbSNP
rs1171175477 229 dbSNP
rs1488772782 229 dbSNP
rs1250216518 232 dbSNP
rs1181597645 233 dbSNP
rs1452208048 234 dbSNP
rs1292324802 236 dbSNP
rs1460530512 237 dbSNP
rs1208232839 238 dbSNP
rs1191795977 239 dbSNP
rs1048210857 240 dbSNP
rs767433421 241 dbSNP
rs1228767954 242 dbSNP
rs189865523 243 dbSNP
rs1044235684 245 dbSNP
rs780000070 246 dbSNP
rs1331122092 252 dbSNP
rs769764976 254 dbSNP
rs1384783691 255 dbSNP
rs1393258161 256 dbSNP
rs1160430418 259 dbSNP
rs1459122624 260 dbSNP
rs1410436230 262 dbSNP
rs984424896 264 dbSNP
rs1478406729 265 dbSNP
rs937997362 267 dbSNP
rs1196844112 272 dbSNP
rs541274253 278 dbSNP
rs573974891 279 dbSNP
rs1451310547 283 dbSNP
rs1248859977 284 dbSNP
rs1209165991 285 dbSNP
rs1289895570 286 dbSNP
rs1330899487 287 dbSNP
rs562000594 288 dbSNP
rs1222455510 290 dbSNP
rs914312395 290 dbSNP
rs1345622394 291 dbSNP
rs982131775 292 dbSNP
rs34659851 293 dbSNP
rs764803182 295 dbSNP
rs745773792 296 dbSNP
rs1230405937 298 dbSNP
rs1440100049 302 dbSNP
rs970792413 304 dbSNP
rs369742215 305 dbSNP
rs1164933184 311 dbSNP
rs757001317 312 dbSNP
rs185290419 313 dbSNP
rs777514732 314 dbSNP
rs1415612028 316 dbSNP
rs1427856374 319 dbSNP
rs1170944012 326 dbSNP
rs758009792 328 dbSNP
rs957928529 331 dbSNP
rs954975497 332 dbSNP
rs1024936311 335 dbSNP
rs1466090453 335 dbSNP
rs752292660 336 dbSNP
rs1214788123 337 dbSNP
rs964875144 339 dbSNP
rs1280607685 340 dbSNP
rs1198258599 349 dbSNP
rs1248056642 350 dbSNP
rs764816110 351 dbSNP
rs1297901858 358 dbSNP
rs1032657953 359 dbSNP
rs1007497861 360 dbSNP
rs1270043241 361 dbSNP
rs761416911 362 dbSNP
rs1030017053 363 dbSNP
rs997234113 366 dbSNP
rs376097951 367 dbSNP
rs1401713754 370 dbSNP
rs1434209123 375 dbSNP
rs754784895 376 dbSNP
rs1170559998 379 dbSNP
rs1447952114 380 dbSNP
rs1286208850 381 dbSNP
rs543025140 382 dbSNP
rs750889382 384 dbSNP
rs1318586518 387 dbSNP
rs1036155994 388 dbSNP
rs1200469202 388 dbSNP
rs1472979331 389 dbSNP
rs1239151284 390 dbSNP
rs940176223 391 dbSNP
rs1026307601 392 dbSNP
rs1003327596 393 dbSNP
rs140429915 394 dbSNP
rs762026141 396 dbSNP
rs774579724 397 dbSNP
rs1305459293 398 dbSNP
rs1044737852 400 dbSNP
rs1289341656 403 dbSNP
rs1271814782 405 dbSNP
rs557094400 406 dbSNP
rs763133358 407 dbSNP
rs938296634 409 dbSNP
rs1282958205 410 dbSNP
rs1414786427 411 dbSNP
rs1399612331 412 dbSNP
rs1279009318 418 dbSNP
rs775598375 420 dbSNP
rs151190257 421 dbSNP
rs1427867188 423 dbSNP
rs934366174 424 dbSNP
rs745888774 426 dbSNP
rs982079574 427 dbSNP
rs1405749509 429 dbSNP
rs949426713 435 dbSNP
rs913980090 436 dbSNP
rs1474874532 437 dbSNP
rs988211180 439 dbSNP
rs578069979 440 dbSNP
rs1183766764 441 dbSNP
rs1032192506 443 dbSNP
rs113912799 446 dbSNP
rs1407309903 448 dbSNP
rs553139378 449 dbSNP
rs953330818 450 dbSNP
rs534920169 451 dbSNP
rs923534695 453 dbSNP
rs879074652 454 dbSNP
rs770777679 455 dbSNP
rs1362637201 458 dbSNP
rs1408100157 460 dbSNP
rs943640634 461 dbSNP
rs909344504 462 dbSNP
rs1163372717 465 dbSNP
rs1330519212 466 dbSNP
rs1294342318 468 dbSNP
rs997183097 469 dbSNP
rs1438962889 472 dbSNP
rs1348350051 473 dbSNP
rs567596796 476 dbSNP
rs1162591348 478 dbSNP
rs1460703097 479 dbSNP
rs897531590 480 dbSNP
rs950829382 483 dbSNP
rs1416805432 484 dbSNP
rs549236733 485 dbSNP
rs981455275 486 dbSNP
rs1489286225 487 dbSNP
rs1171865708 489 dbSNP
rs1250718194 490 dbSNP
rs143149806 491 dbSNP
rs971775365 492 dbSNP
rs1439493395 494 dbSNP
rs1159604451 498 dbSNP
rs1270586934 501 dbSNP
rs1237427948 513 dbSNP
rs1316844335 514 dbSNP
rs1302146291 515 dbSNP
rs1220997259 518 dbSNP
rs569592709 520 dbSNP
rs1490822171 521 dbSNP
rs1325428151 524 dbSNP
rs1439926899 526 dbSNP
rs551094058 527 dbSNP
rs1048570005 532 dbSNP
rs1002829449 534 dbSNP
rs533045407 540 dbSNP
rs1451616034 541 dbSNP
rs1363135865 542 dbSNP
rs998726578 543 dbSNP
rs905449964 545 dbSNP
rs902913406 551 dbSNP
rs1271561545 554 dbSNP
rs201456477 555 dbSNP
rs1179730332 557 dbSNP
rs1240401719 562 dbSNP
rs1443102624 565 dbSNP
rs1046663559 567 dbSNP
rs933767056 568 dbSNP
rs899471197 570 dbSNP
rs1459535242 571 dbSNP
rs1166209942 574 dbSNP
rs1039346249 575 dbSNP
rs565822007 581 dbSNP
rs1345671418 582 dbSNP
rs943588480 584 dbSNP
rs1394026833 589 dbSNP
rs753509982 590 dbSNP
rs1246396692 592 dbSNP
rs149162567 593 dbSNP
rs763793720 598 dbSNP
rs925075194 599 dbSNP
rs919448834 602 dbSNP
rs1428075033 608 dbSNP
rs1259931464 609 dbSNP
rs1482501436 609 dbSNP
rs759961443 615 dbSNP
rs985986883 616 dbSNP
rs145222356 620 dbSNP
rs1191191753 621 dbSNP
rs1423021418 621 dbSNP
rs923178523 624 dbSNP
rs1171332909 625 dbSNP
rs976026436 627 dbSNP
rs1464400058 628 dbSNP
rs991522524 640 dbSNP
rs957270972 642 dbSNP
rs961687888 642 dbSNP
rs1295903503 643 dbSNP
rs1223602381 646 dbSNP
rs1339280299 646 dbSNP
rs1218669544 650 dbSNP
rs1280679570 652 dbSNP
rs1032949787 653 dbSNP
rs1233039261 661 dbSNP
rs561887970 663 dbSNP
rs1014617475 670 dbSNP
rs1006356104 671 dbSNP
rs543669379 672 dbSNP
rs774786158 678 dbSNP
rs1488670554 680 dbSNP
rs1195906327 681 dbSNP
rs772733853 687 dbSNP
rs1425736163 688 dbSNP
rs1431363653 693 dbSNP
rs1293035724 697 dbSNP
rs1378004634 700 dbSNP
rs1034552344 701 dbSNP
rs1002368459 703 dbSNP
rs1156491659 704 dbSNP
rs905397715 705 dbSNP
rs192374470 706 dbSNP
rs563695856 708 dbSNP
rs764688742 709 dbSNP
rs1386716663 711 dbSNP
rs771575112 713 dbSNP
rs1302498569 725 dbSNP
rs892436391 729 dbSNP
rs1285636571 736 dbSNP
rs899599154 738 dbSNP
rs1052453026 740 dbSNP
rs762316087 741 dbSNP
rs936713502 750 dbSNP
rs1488165728 752 dbSNP
rs763498600 753 dbSNP
rs1337406268 755 dbSNP
rs777068122 757 dbSNP
rs1455440467 762 dbSNP
rs545110642 763 dbSNP
rs1050980495 765 dbSNP
rs1156592281 767 dbSNP
rs1379346263 769 dbSNP
rs1461566140 773 dbSNP
rs139833239 774 dbSNP
rs1172863616 777 dbSNP
rs1159997524 780 dbSNP
rs1429462882 786 dbSNP
rs769884611 787 dbSNP
rs1294651715 792 dbSNP
rs1370330294 794 dbSNP
rs929595068 796 dbSNP
rs1377999910 798 dbSNP
rs531506084 798 dbSNP
rs774814541 799 dbSNP
rs1045909191 800 dbSNP
rs950172462 801 dbSNP
rs189617645 802 dbSNP
rs991468685 812 dbSNP
rs957384899 814 dbSNP
rs541149079 815 dbSNP
rs561286472 821 dbSNP
rs67492359 822 dbSNP
rs372444902 824 dbSNP
rs781412778 826 dbSNP
rs967323353 827 dbSNP
rs1411116416 828 dbSNP
rs556972941 829 dbSNP
rs1029874874 830 dbSNP
rs1164826166 830 dbSNP
rs1397402864 830 dbSNP
rs998061919 830 dbSNP
rs537704632 832 dbSNP
rs570300732 834 dbSNP
rs1314025659 839 dbSNP
rs1034089243 840 dbSNP
rs557725432 847 dbSNP
rs1229006446 851 dbSNP
rs147882325 855 dbSNP
rs1025109208 856 dbSNP
rs1394485493 859 dbSNP
rs1300105503 860 dbSNP
rs771726740 860 dbSNP
rs11546990 861 dbSNP
rs892724563 867 dbSNP
rs1419406142 870 dbSNP
rs898112955 871 dbSNP
rs1162000732 877 dbSNP
rs1399277537 880 dbSNP
rs1412046696 881 dbSNP
rs1446850206 884 dbSNP
rs1031711517 885 dbSNP
rs1000866967 892 dbSNP
rs1046318525 894 dbSNP
rs950268500 897 dbSNP
rs1218033328 898 dbSNP
rs191535846 906 dbSNP
rs915982605 906 dbSNP
rs188198453 907 dbSNP
rs932072713 911 dbSNP
rs758335225 912 dbSNP
rs1040241446 913 dbSNP
rs36092850 915 dbSNP
rs907776367 916 dbSNP
rs547938347 920 dbSNP
rs111761086 921 dbSNP
rs1265939490 922 dbSNP
rs1238320181 923 dbSNP
rs1334056731 924 dbSNP
rs1415339037 925 dbSNP
rs1309156869 926 dbSNP
rs926967566 928 dbSNP
rs531622600 932 dbSNP
rs1392054010 933 dbSNP
rs528196501 936 dbSNP
rs564255224 942 dbSNP
rs1025057925 943 dbSNP
rs1366641506 944 dbSNP
rs1432822593 947 dbSNP
rs771076406 947 dbSNP
rs992285576 950 dbSNP
rs956906161 952 dbSNP
rs1366072189 953 dbSNP
rs140021686 954 dbSNP
rs952474068 955 dbSNP
rs1472651748 958 dbSNP
rs1057506 960 dbSNP
rs1215347441 961 dbSNP
rs1286097751 963 dbSNP
rs763841138 963 dbSNP
rs1197382601 970 dbSNP
rs1267697106 971 dbSNP
rs1025725923 976 dbSNP
rs760343820 977 dbSNP
rs1159412822 978 dbSNP
rs1419311521 978 dbSNP
rs993889907 980 dbSNP
rs1403636775 982 dbSNP
rs1029421673 988 dbSNP
rs1321530191 994 dbSNP
rs1330428267 1005 dbSNP
rs112368425 1007 dbSNP
rs192956674 1009 dbSNP
rs1490776305 1010 dbSNP
rs1267885181 1014 dbSNP
rs1374276928 1018 dbSNP
rs559337748 1018 dbSNP
rs1348389745 1021 dbSNP
rs752024922 1022 dbSNP
rs188191954 1023 dbSNP
rs1207525676 1027 dbSNP
rs894621079 1029 dbSNP
rs1055976087 1030 dbSNP
rs1322979685 1031 dbSNP
rs1281596850 1041 dbSNP
rs573797970 1042 dbSNP
rs1179529012 1052 dbSNP
rs1365707171 1055 dbSNP
rs1048944838 1059 dbSNP
rs1331906030 1060 dbSNP
rs766841134 1060 dbSNP
rs946098224 1061 dbSNP
rs930566609 1062 dbSNP
rs1380908953 1063 dbSNP
rs1445725388 1065 dbSNP
rs1387728303 1070 dbSNP
rs555925671 1071 dbSNP
rs979739747 1077 dbSNP
rs543700653 1078 dbSNP
rs1173812860 1083 dbSNP
rs1235682759 1087 dbSNP
rs576658546 1095 dbSNP
rs763409258 1100 dbSNP
rs3208929 1103 dbSNP
rs558197954 1106 dbSNP
rs748151008 1107 dbSNP
rs972795510 1108 dbSNP
rs1445105119 1111 dbSNP
rs956879501 1112 dbSNP
rs970388897 1120 dbSNP
rs183715287 1121 dbSNP
rs1025078605 1125 dbSNP
rs1057771 1127 dbSNP
rs1464939943 1128 dbSNP
rs1298526197 1129 dbSNP
rs1460923765 1131 dbSNP
rs565646889 1132 dbSNP
rs553813821 1133 dbSNP
rs1000404602 1134 dbSNP
rs904594593 1139 dbSNP
rs1228699501 1142 dbSNP
rs1253436546 1145 dbSNP
rs1041776633 1149 dbSNP
rs1269863338 1150 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 396.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 396.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000269321.7 | 3UTR | ucuccugucucguugcugcuucug
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000269321.7 | 3UTR | ccuccucggucuccugucucguugcugcuucugccugugcuguggggg
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000269321.7 | 3UTR | ccuccucggucuccugucucguugcugcuucugccugugcugugggggAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000269321.7 | 3UTR | ccuccucggucuccugucucguugcugcuucugccugugcugugggggAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000269321.7 | 3UTR | cggucuccugucucguugcugcuucugccugugcugugggggAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000269321.7 | 3UTR | ucuccugucucguugcugcuucu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000269321.7 | 3UTR | ucuccugucucguugcugcuucugccugugcugugggggAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.548 5.1e-3 0.285 1.1e-1 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.559 5.2e-3 -0.583 3.5e-3 20 Click to see details
GSE21687 Ependynoma primary tumors -0.284 1.1e-2 -0.258 2.0e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.413 2.5e-2 0.308 7.6e-2 23 Click to see details
GSE21032 Prostate cancer -0.196 3.8e-2 -0.071 2.6e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.36 3.9e-2 -0.333 5.2e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.37 5.4e-2 -0.379 5.0e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.279 8.8e-2 -0.135 2.6e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.124 1.2e-1 0.216 2.0e-2 90 Click to see details
GSE26953 Aortic valvular endothelial cells 0.207 1.7e-1 0.095 3.3e-1 24 Click to see details
GSE28544 Breast cancer 0.189 1.9e-1 0.555 2.4e-3 24 Click to see details
GSE27834 Pluripotent stem cells 0.235 1.9e-1 0.138 3.1e-1 16 Click to see details
GSE21849 B cell lymphoma -0.166 1.9e-1 -0.207 1.4e-1 29 Click to see details
GSE32688 Pancreatic cancer -0.15 2.1e-1 -0.065 3.6e-1 32 Click to see details
GSE19536 Breast cancer -0.08 2.1e-1 0.017 4.3e-1 100 Click to see details
GSE17306 Multiple myeloma 0.109 2.3e-1 0.022 4.4e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.211 2.6e-1 0.070 4.1e-1 12 Click to see details
GSE17498 Multiple myeloma -0.08 3.1e-1 -0.063 3.5e-1 40 Click to see details
GSE19783 ER- ER- breast cancer 0.041 3.6e-1 0.195 4.3e-2 79 Click to see details
GSE28260 Renal cortex and medulla 0.005 4.9e-1 0.159 3.0e-1 13 Click to see details
GSE28260 Renal cortex and medulla 0.005 4.9e-1 0.159 3.0e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.584 0 0.634 0 32 Click to see details
THCA 0.256 0.03 0.277 0.02 59 Click to see details
LUSC -0.301 0.03 -0.347 0.02 38 Click to see details
UCEC -0.419 0.04 -0.293 0.11 19 Click to see details
BLCA 0.416 0.04 0.480 0.02 18 Click to see details
HNSC 0.178 0.13 0.248 0.06 42 Click to see details
BRCA 0.113 0.15 0.149 0.09 84 Click to see details
COAD 0.355 0.19 0.643 0.04 8 Click to see details
KIRP 0.142 0.22 0.273 0.07 32 Click to see details
PAAD -0.519 0.24 -0.800 0.1 4 Click to see details
CHOL 0.225 0.28 0.150 0.35 9 Click to see details
CESC -0.608 0.29 -0.500 0.33 3 Click to see details
LUAD 0.168 0.3 0.238 0.23 12 Click to see details
KIRC 0.05 0.34 0.170 0.08 68 Click to see details
PCPG 0.334 0.39 0.500 0.33 3 Click to see details
LIHC 0.038 0.4 0.011 0.47 49 Click to see details
PRAD 0.025 0.43 -0.025 0.43 50 Click to see details
KICH 0.015 0.47 0.007 0.49 25 Click to see details
ESCA -0.006 0.49 0.000 0.5 11 Click to see details
ESCA -0.006 0.49 0.000 0.5 11 Click to see details
ESCA -0.006 0.49 0.000 0.5 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
Error report submission
MIRT ID*
Your e-Mail*
Memo*