miRTarBase - #MIRT507877 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CBX6   
Synonyms -
Description chromobox 6
Transcript NM_014292   
Expression
Putative miRNA Targets on CBX6
3'UTR of CBX6
(miRNA target sites are highlighted)
>CBX6|NM_014292|3'UTR
   1 GGGGGCTCCACCAAGGAGGGGGGCTTGGGGGGGCCCTCCTGCCCGAAGTCATACTCTTGCTCCCACCCCACCCTTGCCCC
  81 CAGCCCTCTCTCCCTGTGCTTTGCTTGTCTCAAATGGCTCGGTGTTGACCCAGGGATGGGGCTGGGTAGTTGGGGTCCCA
 161 GAAAGCCGGGGGTAGGGGCCACCCTGGAATGGGGCAGGGGAAGGGCACACCCCCTGCCCATGCATGGTAGCCCACTGGGT
 241 GGTTTCTGGAAAGCCCTAGAAACTAGGGTTCCTCTGCCCCTTCCACATCCCACCTGTCTCTCTAGCTTGCTTCCTGCTCT
 321 CCTGTGCGGCGTCTGATTTCTCGGTGCTAACCTGGCAGCTGTGGGGCCCTTAGGAGCCCCCCACCGAGGGTGGACACAGT
 401 CCCTTTCCTTCCTGCAGATGCCTAGGCAGGAGGAGGGCTTCCTGCCTGTTTGGCAAAGTCCCAGGCAGAGGCCAAGGATG
 481 AGGCCTGACTCGGCTCCTCCCTCCACATCAGCCAGGGCATCAGAAGTTGGGCCAGGGCGGGGTCTTCCCTGCTCGATTTT
 561 GGACGAGGCCTAAGTAGACCCCCTATGCCCTGCCCCAGCCCTGGCTCTTTCCTAACCCCCTCAACGGTGGGAGGAACTGG
 641 CAGAGGGTGCGCCTGGCCACAGCCTCCCCGCATCTAAAGGCCCCTTCAGTTCTTGACCAAAGGTGCTACGAGAACCTGCC
 721 GTGGAAACTTCCAGTTGTGCGTCTGCCCCACTCGCTGTGTTTGTCCGTGGGTTCATACATGCATTGGGTGCTAGGCCCCA
 801 GGCTGCCGGGTGGCACCCTTTACAGTTCCTTTGAACAGGGGCATTGAAGGCCTGGACTGCCTCTCGCCTCAGTAGGCCTG
 881 GGGACCAGGCTTGGGTCTGGAGGTTTGCTGTGGAAGTCACCAGGCCTCCCCTCCTGGCCCAGGTGTGCTGGGGGCACCGT
 961 GCCCCCCACCCCCCTGCCCTCCTCAGGGTGGTCAGCCCAACCTGTCGGACCTTCACTTCACATCATGGTGGGGACCGAGA
1041 TAGAGAGGGAGACCCCATTCCAAGCTCCCTCTTCCTCCGGGTGTTTGGGGAGGATGCTGAAGAATCCATTCCCGAGGGCC
1121 TCCCGGCTTGTCCCAGCCCCTCTTTTGCTTCTGACCACGGAGGCTTTCTCACAGCCCAGCCTGCCTGAAGCAAAGGAGGC
1201 TCCCGTGTCCTGGGCAGCTTCTGTTTCCCTCTGCTGCCTGGGAGCTGAGGCACCCGTGCCAGTGGCAGAGGCCACAGCCC
1281 CAGCCTTAGGCCAGGCCCTGGGAGGGCAGGCAGGCAAAGGGGAGACCAGAGGGTCTGTGTTCTCCAGGAGAATGAGGGTG
1361 TTGGTCCCAGAATTGGGACCGGGGCCCCGCTGGCCAGCCCTGGGCCACTTCCCGGGTCTCCATTGTGCGTGGGTGGCGTG
1441 TTCCAGGCGTGGCTGGAGCTGGCTTCCTGGCTGTGCTGCCATGGGCCCCTCCCTCAGAAGCACGTTGGCAGGAGGCCGAT
1521 CAGAACCCTAGCGCCTTTGGTCCTAAGAATGGGAGGCTGCCTTCCTTCCCAATCTCCCTGCCAGGGCCCACAGCGTGGCC
1601 CTAGCCCTCCCCTCCCCGGGATGTAGAACGGGGACCCTCGCAGGGTTGGGGCGGGGGCTGATACTCCTCGGCCCCTCCCT
1681 ACCCTGCCCTGTGTGTTGGCTTTGTGGCCGTCCAAGTGCCAATTGGCTTTTCGCCCAAATAAGGGCTGGTATTTCTCCTC
1761 TGTCCTTGGAGGTGATTTCCCCCTGACCCCCTCCCCCAGGTGAGTGACCACCTGGGTGCCAGTTACAGGTGTTTCCAGAG
1841 ACCATAGAAATGTGTTTTCCTGAGAGTTCGTGTCATTCGTGACTTTTTTGTAAAGAAGTTGTGTTTTCAGAGGTGATTTT
1921 ATGACAGGAAAGTGAAAGAATTAGTTTTGCAAAAAAACAAAAACAAAAAAAGAGGAAAAAAAAAAGAAATAGAAAAAAAT
2001 ATTGTGGGATTCCTATGGGGGGGTGGCGGGGGAGAAAGAGCTATTTAAGAAAAAATAGTAACGCAGTGATTGCACAGGTG
2081 AGGTGGCAATGTCAGGATGGGGCGGAGGCCTGGGCCCAGCTGGCAGGTCCCCTGGCATCGCAGGCACTGTGGAGAGGGCC
2161 TGGACCCAGATCTCCACACCCGTGCTTGCTCAAAGGGAAGGACAACAGCGGGCCCCCGGGAGCTAACCCAAGCTGCAGGT
2241 CCCGGCAAGCTGAGGTTTGGGAGGGTGGGGGTTGTCACTGGTGATTTTCTCCAGGGGGCTGGTGAGTGGGCAGTTTGGTT
2321 TCTTGCCCCCTTCTGTTCCTTTCCCAGTTGTTGGGCCATCTGGTCCCCACCACCGCCACCCTATGGGGGAGACCTCCCTC
2401 CCCACGGGTCACCCTAAAGCCCACAACCTCTCTGAGCCTCCCTGGCCTGAAAGGGGATGCAGGCTTCAGGAGGCAAGAAG
2481 CTGGGCCCCTGGGGGTGGCTGGGGAGAGGGAATGCATTTCCCTTGCCACAGGTGGTCTGCTTCTGCTGGCCTGAGCTCCA
2561 AGTGGAGCAGCCCGGGCCAGCCTTGGTGCATGAAGAGGCACCAGGCACACCGCCTTGAGGTGGGCAGTGCCCATGGGGGC
2641 CCGAGTGGATGGGACCGAGGGTGAGTGGAGCCTCCTTCCTCCCCTCTCTAGTACCCCCGCCTCCCACACACTTGCACGGA
2721 TCGGCCTCCCTTGGGAGATCAGCCTCCATGGGCCCCTCGTCCACCCTTGCTGCTTTCCATTTGCCTAATTACCAAGCAGA
2801 AGTTGCAATCTGGTTTGCTTTATTTTTGTATGTGAAATAACCCCCAAAGCCCAATCTCCTCCTACGTTCAATATTGGTTG
2881 GGGCATCCGTCATCTCCCCTTAAGTGCGCCCCCTCCCCACCCAAGTATCATAGGAAACCGGTGAGGTCTGGTGTCTCTGG
2961 TTTGAGACGGTAAGTTGGGACCCATCCCTGTCTGGGTGCCCACTCTGACCTTTAGTTTGCCCTTCTGTGAAATGGGTGTA
3041 TTGGGTAGCAAGCCCTCTTCAGAAAGCGCTGCTGGTGTCAGAGCAGCTGCCCAGTACCAGGTGGGGGGTCAAGGTTGCTG
3121 GTACTGGGGCCCCCAGCTGCCCACAACCCCTCTTTGTTCTCACCCTGCAAAGGGGTCAAGGTCAAAATGAGCCTCATCCT
3201 TCCTATGATCTGGGAAGAGGTGATGATCAAGTCCCCAACTTCAGTGTGAGGTGGACAGAGTTGGGGGGATGGCCCCTTTT
3281 TGAAGAGGTGAAAATGGTTTTGGAGAAGCGCAGCTGCTTCACTGGGGGAATGCGGCAGGGACTGGGGCCCAGGATGCTTT
3361 GGCCTATGGGGAAAAGCCCTTTAAAAGGCAGGGCCCAGGCCCTGGAGCCAGCACAAGACTGGCCTCGAGCCCCTGAGCCA
3441 GGAGGTCCTGGAGGAGAGCCAGGCCGGTGGGCCCGCCCAAGGCTGGAGGGTCAGCCCCAACAGGGAGCTGGGTTGGCCAG
3521 GGGGCTGGACTGCTACCAGCCTCTCTGGCCTATGGGGACCCAAGAGGACACATCCCCCTTTTGCCCACTCTTCTGTGTCA
3601 TTTTGTTGTTTTGGTTTGTGGTGGTTTTTCTTTTTTCTTTTGTTTTTCTTTTTTCTTTCTTTCTTTTTTTTTTTTTTTTT
3681 TTTTTTTTTTGCACTTCGCCCACACAGGACAGTGGAGCCCCACCTGGTCAGTTCCACTTCCGGGCTCCCATGCACTTGCC
3761 CAAGGCGGCCTCTTTGGGACGGGGATGGTTTGAGGAAACACTTTTAAAGAAAAAAGGAAGACATTGAAAGGTTTTAGTTT
3841 CTTCCCTATCTGCATGTCCTCTCATATAGAAAGCCCAGAATTAGGGGCTAGAACTCCAGGAGAGGGTCTCCCCGACTCAT
3921 CTCTTGCTGACGGTCACCAGGATGCAGAAATAGGGAGATGGTTAGTGGGGGCCAAAGATGCCCCCTCCCAGGCCTTCGTG
4001 GTTCCCTCCTCCGCCCCCTGCAATCTTTGGAGGAGTCAGTGCCTCACTCCAGCAGTGAGTGCCTACTGTATGCAGGTAGT
4081 CAGCCAGGCAAAGAGAGACTAACGGTCTCATGGGGGAACCCTCTTGCGGGAGGCCGGGTAGCTGGAGCGAAGCGTTCCGG
4161 CTGCCCTTGCTGCTGGGTGGAGTGGAGAGGGAGACTTCTTTTTGTTGGTTTTAATTTAAAAACACAAAGGCCTAAAGAAA
4241 TACGTATCTTATAATTTTTTTAATTTTTGAGACGTTCATTTAATGAATTGTGCACGAATGAATTCTATATATATAAAATA
4321 TACATATATAGCTCTATATTTGGGGAGGGGCACTGTCTCTTTTTTCTCTCATTTTTAAAATGAAGTGTTGTTGCCTTTGT
4401 ATGTGGTTCAACCATCCAGCTCCCAGCTGGCTAAACTTTGCCTCCAGTGGTCAAAGATGGGAAAAGAGTGGGGTTGGCAG
4481 GAGATGGAAAACGGAGGTGCCGCCCCAGCATGGGGGGCAGGTCCCCCAGTCCACCCTGCCCCTCCCCCTGTGGAGAAGAC
4561 GCTTAGTTGGGGGTGTGGGTTTGGGCTCCATTCTGGATTCGGCGGTTCCGGGGGAGGGGTGGGTCTGTGCCGATTACTCT
4641 GTCTTGTACGTTTGTTCTGCTGCTCTTCAATATTGTATCAACGCCAGGAAAGGGGGGTGAAAAGCCTCTTTTACCCCCCA
4721 AATAAATTGTCACATTCCGAAGCTGAGGCCTAGCCCCTAGGTTGGGGTGTGTCTGTGTCTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAU-ACACGACGAu 5'
               ||  ||: | ||||||| 
Target 5' cttgtACGTTTGTTCTGCTGCTc 3'
4643 - 4665 149.00 -11.90
2
miRNA  3' guGUUUGGUAA----UAC----ACGACGAu 5'
            |:|| |:||     ||    ||||||| 
Target 5' agCGAAGCGTTCCGGCTGCCCTTGCTGCTg 3'
4146 - 4175 148.00 -15.60
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||   | ||||||| 
Target 5' cctcgtCCACCCT-TGCTGCTt 3'
2755 - 2775 143.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28881540 1 COSMIC
COSN31579231 24 COSMIC
COSN31579415 25 COSMIC
COSN18743779 27 COSMIC
COSN31579737 27 COSMIC
COSN2528598 44 COSMIC
COSN30128450 69 COSMIC
COSN30540165 108 COSMIC
COSN30143473 120 COSMIC
COSN8904882 237 COSMIC
COSN31540177 271 COSMIC
COSN31480948 319 COSMIC
COSN28684754 327 COSMIC
COSN15125470 374 COSMIC
COSN30175420 470 COSMIC
COSN20117470 545 COSMIC
COSN8612715 577 COSMIC
COSN31590775 583 COSMIC
COSN31562034 625 COSMIC
COSN22751007 710 COSMIC
COSN24480346 740 COSMIC
COSN31545425 849 COSMIC
COSN32171079 1039 COSMIC
COSN31961976 1393 COSMIC
COSN8018665 1487 COSMIC
COSN31485007 1669 COSMIC
COSN31550752 1682 COSMIC
COSN31595267 1716 COSMIC
COSN20226149 1732 COSMIC
COSN26566603 1746 COSMIC
COSN30165356 1779 COSMIC
COSN28688271 1794 COSMIC
COSN25595637 1869 COSMIC
COSN31779384 2075 COSMIC
COSN22167324 2252 COSMIC
COSN26415339 2816 COSMIC
COSN8018664 2968 COSMIC
COSN14509607 3477 COSMIC
COSN20320686 4548 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781375658 5 dbSNP
rs1168251854 6 dbSNP
rs776183371 6 dbSNP
rs994352563 6 dbSNP
rs1488098802 8 dbSNP
rs1324009478 9 dbSNP
rs1289541778 17 dbSNP
rs1220283795 18 dbSNP
rs559300132 19 dbSNP
rs1292686784 21 dbSNP
rs1004465580 22 dbSNP
rs906674410 23 dbSNP
rs769410194 24 dbSNP
rs751523797 27 dbSNP
rs1367471115 30 dbSNP
rs1301864388 32 dbSNP
rs766350916 33 dbSNP
rs745324903 34 dbSNP
rs776205845 34 dbSNP
rs1026952138 38 dbSNP
rs1185766050 40 dbSNP
rs375193523 41 dbSNP
rs750262840 44 dbSNP
rs1460132357 45 dbSNP
rs765163625 47 dbSNP
rs761679049 48 dbSNP
rs1432405769 49 dbSNP
rs1236509580 50 dbSNP
rs1266612087 51 dbSNP
rs1193666202 55 dbSNP
rs1408726577 56 dbSNP
rs1184476070 59 dbSNP
rs1054979402 61 dbSNP
rs1166936138 69 dbSNP
rs1474320136 76 dbSNP
rs895412605 79 dbSNP
rs937871366 86 dbSNP
rs906350413 99 dbSNP
rs1373532904 104 dbSNP
rs1384087497 108 dbSNP
rs113601744 113 dbSNP
rs1355144263 115 dbSNP
rs1046787362 120 dbSNP
rs540781501 121 dbSNP
rs913580717 122 dbSNP
rs1258386916 133 dbSNP
rs187729823 136 dbSNP
rs554642338 141 dbSNP
rs536000164 145 dbSNP
rs568816118 146 dbSNP
rs556655374 167 dbSNP
rs546096492 168 dbSNP
rs1362094170 170 dbSNP
rs1455542845 171 dbSNP
rs1019772475 172 dbSNP
rs1159412702 173 dbSNP
rs1375069553 174 dbSNP
rs1229752361 188 dbSNP
rs1413367054 189 dbSNP
rs1315154337 196 dbSNP
rs983445487 212 dbSNP
rs951623660 213 dbSNP
rs34532494 215 dbSNP
rs111419073 219 dbSNP
rs1336959736 220 dbSNP
rs1240220637 223 dbSNP
rs1279240306 227 dbSNP
rs1345249839 230 dbSNP
rs995478492 238 dbSNP
rs1212811986 242 dbSNP
rs770266997 250 dbSNP
rs894467157 258 dbSNP
rs1192413058 264 dbSNP
rs918259838 267 dbSNP
rs972485755 276 dbSNP
rs1179304377 278 dbSNP
rs1394759672 280 dbSNP
rs970884757 286 dbSNP
rs1034459305 289 dbSNP
rs1360047880 294 dbSNP
rs1396956318 298 dbSNP
rs1461935024 300 dbSNP
rs1381717408 304 dbSNP
rs1399250983 310 dbSNP
rs748569957 311 dbSNP
rs1002959510 313 dbSNP
rs1012359060 319 dbSNP
rs959568236 321 dbSNP
rs1301724952 324 dbSNP
rs1032540309 325 dbSNP
rs571169531 327 dbSNP
rs771912194 328 dbSNP
rs1042802773 330 dbSNP
rs906395076 331 dbSNP
rs1193080754 333 dbSNP
rs1046197990 342 dbSNP
rs1188438291 343 dbSNP
rs1428360378 343 dbSNP
rs945303204 345 dbSNP
rs1425787087 352 dbSNP
rs139292005 360 dbSNP
rs1466553317 366 dbSNP
rs528259632 374 dbSNP
rs901933113 376 dbSNP
rs150776468 377 dbSNP
rs1184589058 383 dbSNP
rs942507608 383 dbSNP
rs372668913 385 dbSNP
rs1297392312 388 dbSNP
rs1318558150 393 dbSNP
rs1232538652 398 dbSNP
rs936362315 400 dbSNP
rs1467245090 412 dbSNP
rs1223864022 416 dbSNP
rs1247549144 418 dbSNP
rs1485651583 422 dbSNP
rs781517504 427 dbSNP
rs1268740807 438 dbSNP
rs1426174401 444 dbSNP
rs1478437176 447 dbSNP
rs77471411 448 dbSNP
rs1332103127 462 dbSNP
rs918218267 466 dbSNP
rs1271998436 472 dbSNP
rs943769060 473 dbSNP
rs1290418077 491 dbSNP
rs1445011156 492 dbSNP
rs912725119 493 dbSNP
rs1340838276 501 dbSNP
rs868294772 504 dbSNP
rs373462495 514 dbSNP
rs982948066 518 dbSNP
rs148273871 526 dbSNP
rs1336820016 527 dbSNP
rs60785115 528 dbSNP
rs532551885 538 dbSNP
rs879027838 539 dbSNP
rs1213825177 541 dbSNP
rs1366516742 544 dbSNP
rs139971387 547 dbSNP
rs1488853872 549 dbSNP
rs958736442 554 dbSNP
rs1256084084 555 dbSNP
rs1034344704 565 dbSNP
rs779628789 567 dbSNP
rs1277539447 570 dbSNP
rs565572813 579 dbSNP
rs540969696 580 dbSNP
rs1163940098 581 dbSNP
rs1459598307 582 dbSNP
rs967368572 583 dbSNP
rs41281245 588 dbSNP
rs1168023771 594 dbSNP
rs375938362 596 dbSNP
rs1025239243 597 dbSNP
rs5995626 598 dbSNP
rs1448611318 599 dbSNP
rs1009428858 600 dbSNP
rs1284855749 601 dbSNP
rs892279870 603 dbSNP
rs997918769 616 dbSNP
rs901883418 618 dbSNP
rs541059908 619 dbSNP
rs1210646655 621 dbSNP
rs1278585431 624 dbSNP
rs1000728666 625 dbSNP
rs749197541 626 dbSNP
rs1232799245 636 dbSNP
rs1468220443 641 dbSNP
rs1179940564 645 dbSNP
rs1380584053 650 dbSNP
rs1467084591 651 dbSNP
rs1007661131 657 dbSNP
rs373899881 658 dbSNP
rs1328164406 661 dbSNP
rs557028863 668 dbSNP
rs369654452 669 dbSNP
rs182644608 670 dbSNP
rs577266567 672 dbSNP
rs753675943 684 dbSNP
rs930152108 692 dbSNP
rs1347655852 693 dbSNP
rs1201387973 696 dbSNP
rs1272978157 704 dbSNP
rs920090841 709 dbSNP
rs763901145 710 dbSNP
rs190839398 718 dbSNP
rs1191296593 720 dbSNP
rs137956958 721 dbSNP
rs1478270901 731 dbSNP
rs186458403 740 dbSNP
rs113823841 741 dbSNP
rs971788555 747 dbSNP
rs146952918 750 dbSNP
rs1394605361 753 dbSNP
rs1010271937 754 dbSNP
rs766472532 758 dbSNP
rs537257626 759 dbSNP
rs1017635766 761 dbSNP
rs1000740137 765 dbSNP
rs141243834 766 dbSNP
rs1018371204 767 dbSNP
rs1027773412 772 dbSNP
rs1007922892 775 dbSNP
rs541628362 779 dbSNP
rs770179105 786 dbSNP
rs1046850032 787 dbSNP
rs1247821858 793 dbSNP
rs1203916590 796 dbSNP
rs1315259896 798 dbSNP
rs1240076769 802 dbSNP
rs34110620 803 dbSNP
rs1037341085 806 dbSNP
rs929705395 807 dbSNP
rs898674443 808 dbSNP
rs532543618 811 dbSNP
rs1038510821 812 dbSNP
rs937597404 814 dbSNP
rs1461027669 818 dbSNP
rs573933149 830 dbSNP
rs896134866 836 dbSNP
rs565316023 841 dbSNP
rs1387522407 846 dbSNP
rs748482235 847 dbSNP
rs925026928 850 dbSNP
rs1402223848 853 dbSNP
rs777075661 860 dbSNP
rs879696397 865 dbSNP
rs547295592 866 dbSNP
rs1242042641 868 dbSNP
rs1266644904 872 dbSNP
rs957411435 876 dbSNP
rs1356619324 883 dbSNP
rs1333994141 894 dbSNP
rs914103548 895 dbSNP
rs1281683328 904 dbSNP
rs1489188133 907 dbSNP
rs1032154146 909 dbSNP
rs976717236 910 dbSNP
rs979205032 933 dbSNP
rs966322111 951 dbSNP
rs1410619630 953 dbSNP
rs576315442 954 dbSNP
rs1309596728 958 dbSNP
rs1017581998 959 dbSNP
rs1432670912 962 dbSNP
rs986121755 968 dbSNP
rs1299162956 969 dbSNP
rs1394733984 969 dbSNP
rs964208091 974 dbSNP
rs1314266810 975 dbSNP
rs1018215895 976 dbSNP
rs1340616640 976 dbSNP
rs1008560170 982 dbSNP
rs1355381264 987 dbSNP
rs1217101679 989 dbSNP
rs1279295875 990 dbSNP
rs1484650594 991 dbSNP
rs183537555 992 dbSNP
rs1256755462 993 dbSNP
rs1478971621 998 dbSNP
rs1424535871 1006 dbSNP
rs553431723 1007 dbSNP
rs1181134130 1008 dbSNP
rs1027720476 1010 dbSNP
rs993623336 1011 dbSNP
rs1361516813 1013 dbSNP
rs1441724986 1016 dbSNP
rs375184534 1022 dbSNP
rs1375160983 1023 dbSNP
rs1180857116 1028 dbSNP
rs1472703285 1036 dbSNP
rs1415609721 1037 dbSNP
rs1253582352 1045 dbSNP
rs556452681 1049 dbSNP
rs1306397119 1054 dbSNP
rs1015447985 1056 dbSNP
rs898226587 1061 dbSNP
rs1302424617 1064 dbSNP
rs1279795253 1071 dbSNP
rs1310275782 1078 dbSNP
rs2235140 1079 dbSNP
rs937513951 1080 dbSNP
rs561641729 1083 dbSNP
rs1055001190 1088 dbSNP
rs906022464 1090 dbSNP
rs1001824078 1099 dbSNP
rs1459269820 1102 dbSNP
rs1046013753 1113 dbSNP
rs1394700555 1119 dbSNP
rs1043853872 1124 dbSNP
rs1178666116 1125 dbSNP
rs1378745810 1135 dbSNP
rs75218720 1138 dbSNP
rs575798438 1141 dbSNP
rs76298073 1142 dbSNP
rs371097287 1144 dbSNP
rs1365010736 1154 dbSNP
rs190618465 1158 dbSNP
rs986402958 1159 dbSNP
rs1306878749 1168 dbSNP
rs1216649832 1170 dbSNP
rs1259899515 1171 dbSNP
rs1339583021 1174 dbSNP
rs41280843 1196 dbSNP
rs920604815 1197 dbSNP
rs972537053 1198 dbSNP
rs1487601632 1199 dbSNP
rs962158073 1204 dbSNP
rs147922595 1205 dbSNP
rs1018517283 1206 dbSNP
rs1465724091 1216 dbSNP
rs1163552060 1217 dbSNP
rs745432774 1221 dbSNP
rs1382763211 1227 dbSNP
rs1293900495 1230 dbSNP
rs368091515 1231 dbSNP
rs1397908365 1234 dbSNP
rs534329376 1236 dbSNP
rs544586415 1241 dbSNP
rs903501406 1244 dbSNP
rs1320150850 1246 dbSNP
rs1043400826 1249 dbSNP
rs150246008 1255 dbSNP
rs962351235 1256 dbSNP
rs555638178 1267 dbSNP
rs1016730537 1271 dbSNP
rs1185277474 1277 dbSNP
rs1472261726 1282 dbSNP
rs554193367 1284 dbSNP
rs753531644 1289 dbSNP
rs1046278108 1290 dbSNP
rs1014525494 1291 dbSNP
rs892014606 1296 dbSNP
rs1180804537 1297 dbSNP
rs1053286328 1305 dbSNP
rs111659164 1306 dbSNP
rs1406752606 1308 dbSNP
rs1165125493 1316 dbSNP
rs1344207937 1319 dbSNP
rs910750518 1321 dbSNP
rs1050636303 1327 dbSNP
rs925953277 1331 dbSNP
rs141074592 1339 dbSNP
rs1039129250 1350 dbSNP
rs1341091855 1351 dbSNP
rs1414022836 1354 dbSNP
rs943415904 1355 dbSNP
rs1283691976 1356 dbSNP
rs1247992578 1358 dbSNP
rs1230094376 1360 dbSNP
rs1313749674 1365 dbSNP
rs1353227324 1368 dbSNP
rs911061885 1373 dbSNP
rs1331382818 1377 dbSNP
rs987017626 1377 dbSNP
rs920555159 1381 dbSNP
rs1209958954 1385 dbSNP
rs972100472 1386 dbSNP
rs755925677 1388 dbSNP
rs113545257 1389 dbSNP
rs112821077 1395 dbSNP
rs1437396169 1398 dbSNP
rs972640526 1403 dbSNP
rs960515952 1413 dbSNP
rs1033488045 1414 dbSNP
rs1332185518 1416 dbSNP
rs1360791158 1418 dbSNP
rs41280841 1420 dbSNP
rs1016575136 1423 dbSNP
rs1376476625 1425 dbSNP
rs1001293376 1428 dbSNP
rs1354944076 1429 dbSNP
rs1218976519 1435 dbSNP
rs970187092 1437 dbSNP
rs1444588406 1438 dbSNP
rs1022666287 1443 dbSNP
rs1236964452 1446 dbSNP
rs1456179269 1448 dbSNP
rs1024489544 1449 dbSNP
rs1014865936 1467 dbSNP
rs1435748009 1475 dbSNP
rs1009232032 1480 dbSNP
rs1170575675 1482 dbSNP
rs1427212050 1484 dbSNP
rs1414933708 1485 dbSNP
rs1337477085 1489 dbSNP
rs1399569151 1493 dbSNP
rs1444640247 1497 dbSNP
rs112098775 1503 dbSNP
rs140486168 1504 dbSNP
rs1273401567 1506 dbSNP
rs1000397628 1508 dbSNP
rs1347755670 1511 dbSNP
rs1220257602 1513 dbSNP
rs1414128910 1517 dbSNP
rs1165330354 1518 dbSNP
rs904541590 1526 dbSNP
rs763092331 1528 dbSNP
rs1008662005 1533 dbSNP
rs1238463405 1542 dbSNP
rs1450638324 1543 dbSNP
rs1039408797 1546 dbSNP
rs1189708173 1552 dbSNP
rs1466664943 1553 dbSNP
rs561378468 1559 dbSNP
rs1251166780 1569 dbSNP
rs943487233 1571 dbSNP
rs1169952571 1572 dbSNP
rs1421385636 1574 dbSNP
rs1050587826 1580 dbSNP
rs1220993625 1582 dbSNP
rs930850539 1587 dbSNP
rs750560797 1594 dbSNP
rs111252022 1595 dbSNP
rs1333245916 1600 dbSNP
rs549699480 1610 dbSNP
rs1051846881 1611 dbSNP
rs933854719 1614 dbSNP
rs531004150 1617 dbSNP
rs765505691 1618 dbSNP
rs972651810 1620 dbSNP
rs1355216880 1622 dbSNP
rs1207641996 1624 dbSNP
rs573275751 1629 dbSNP
rs1192629362 1630 dbSNP
rs1228999196 1633 dbSNP
rs545216176 1639 dbSNP
rs1195938582 1640 dbSNP
rs1367288943 1641 dbSNP
rs1472499849 1648 dbSNP
rs762139129 1650 dbSNP
rs962579165 1652 dbSNP
rs992844556 1653 dbSNP
rs1350103478 1655 dbSNP
rs1425747189 1658 dbSNP
rs1325181544 1660 dbSNP
rs909565972 1666 dbSNP
rs1359223293 1667 dbSNP
rs1407872847 1669 dbSNP
rs1389897654 1671 dbSNP
rs980146042 1679 dbSNP
rs1241979311 1683 dbSNP
rs1285636100 1689 dbSNP
rs969736676 1689 dbSNP
rs1451857965 1694 dbSNP
rs377392754 1707 dbSNP
rs1024498129 1709 dbSNP
rs992587921 1710 dbSNP
rs1478431854 1722 dbSNP
rs1255376353 1723 dbSNP
rs980565488 1726 dbSNP
rs776794069 1728 dbSNP
rs968324373 1731 dbSNP
rs1022193673 1732 dbSNP
rs577281378 1733 dbSNP
rs761004156 1734 dbSNP
rs1158425850 1738 dbSNP
rs1031766911 1739 dbSNP
rs186882971 1741 dbSNP
rs1421893476 1744 dbSNP
rs1482868001 1752 dbSNP
rs1053222 1755 dbSNP
rs988490784 1757 dbSNP
rs1393842850 1758 dbSNP
rs904762788 1769 dbSNP
rs1017620481 1772 dbSNP
rs1335574073 1780 dbSNP
rs776044494 1782 dbSNP
rs1383075351 1783 dbSNP
rs151075636 1785 dbSNP
rs1306608662 1792 dbSNP
rs1344182400 1792 dbSNP
rs1019042807 1793 dbSNP
rs540577212 1793 dbSNP
rs1482209768 1794 dbSNP
rs573627239 1795 dbSNP
rs1008614502 1797 dbSNP
rs12166725 1799 dbSNP
rs888878882 1800 dbSNP
rs1160262377 1808 dbSNP
rs112586256 1810 dbSNP
rs995003620 1813 dbSNP
rs1173833597 1816 dbSNP
rs1052313288 1831 dbSNP
rs868735432 1838 dbSNP
rs1445394121 1840 dbSNP
rs1328918750 1864 dbSNP
rs899353515 1865 dbSNP
rs1036604666 1870 dbSNP
rs896991565 1878 dbSNP
rs940953881 1879 dbSNP
rs1310376185 1883 dbSNP
rs1235251864 1888 dbSNP
rs1407563617 1890 dbSNP
rs555363814 1898 dbSNP
rs1263669092 1899 dbSNP
rs1369615561 1899 dbSNP
rs1324445792 1927 dbSNP
rs1188451399 1934 dbSNP
rs1236632623 1937 dbSNP
rs1481713063 1938 dbSNP
rs1178143499 1941 dbSNP
rs1308986786 1950 dbSNP
rs1132718 1957 dbSNP
rs1474656212 1958 dbSNP
rs765678534 1958 dbSNP
rs1432089210 1959 dbSNP
rs1057067624 1960 dbSNP
rs1374164518 1962 dbSNP
rs1132719 1963 dbSNP
rs1415554677 1964 dbSNP
rs1339732137 1966 dbSNP
rs1218116951 1968 dbSNP
rs1256162594 1972 dbSNP
rs1309498585 1972 dbSNP
rs1427311912 1972 dbSNP
rs745344745 1973 dbSNP
rs1265078560 1974 dbSNP
rs1225153280 1975 dbSNP
rs978838726 1975 dbSNP
rs1175576250 1976 dbSNP
rs1190889519 1986 dbSNP
rs142546236 1986 dbSNP
rs879132701 1986 dbSNP
rs1347725363 1987 dbSNP
rs1459296388 1987 dbSNP
rs1472371899 1987 dbSNP
rs576136558 1992 dbSNP
rs988049580 1998 dbSNP
rs1483946383 2000 dbSNP
rs1398006117 2002 dbSNP
rs1254041311 2005 dbSNP
rs956835105 2006 dbSNP
rs1364252980 2008 dbSNP
rs1209254939 2016 dbSNP
rs1036842248 2017 dbSNP
rs1280097979 2018 dbSNP
rs554973248 2019 dbSNP
rs1244333684 2022 dbSNP
rs1349492488 2023 dbSNP
rs1180751287 2024 dbSNP
rs1411211684 2024 dbSNP
rs760161903 2024 dbSNP
rs1288657002 2025 dbSNP
rs796290916 2027 dbSNP
rs146798052 2028 dbSNP
rs202180252 2028 dbSNP
rs1431597677 2033 dbSNP
rs995025411 2033 dbSNP
rs1302293519 2037 dbSNP
rs1377349536 2051 dbSNP
rs537700107 2053 dbSNP
rs1466956786 2057 dbSNP
rs948430422 2059 dbSNP
rs1353525009 2060 dbSNP
rs916915340 2062 dbSNP
rs1156991704 2063 dbSNP
rs1456838153 2076 dbSNP
rs1208855815 2077 dbSNP
rs1235175650 2082 dbSNP
rs992996365 2087 dbSNP
rs955752274 2089 dbSNP
rs1183890850 2103 dbSNP
rs1031820785 2104 dbSNP
rs1437645661 2108 dbSNP
rs1160032597 2115 dbSNP
rs1408665105 2116 dbSNP
rs1413768954 2124 dbSNP
rs1175473864 2131 dbSNP
rs1474351191 2139 dbSNP
rs553509990 2140 dbSNP
rs181237491 2141 dbSNP
rs1001470964 2144 dbSNP
rs1445058020 2145 dbSNP
rs1281596353 2150 dbSNP
rs1181116466 2166 dbSNP
rs905901136 2168 dbSNP
rs735306 2182 dbSNP
rs1203726853 2184 dbSNP
rs1257053674 2191 dbSNP
rs1456140765 2203 dbSNP
rs947475579 2209 dbSNP
rs549388287 2210 dbSNP
rs735305 2213 dbSNP
rs890459119 2217 dbSNP
rs1052708813 2218 dbSNP
rs1030291135 2222 dbSNP
rs375695212 2229 dbSNP
rs911811114 2234 dbSNP
rs1336791075 2241 dbSNP
rs987411119 2243 dbSNP
rs1273634106 2244 dbSNP
rs1347885636 2251 dbSNP
rs1223623961 2264 dbSNP
rs1312423620 2267 dbSNP
rs897882984 2270 dbSNP
rs1037776046 2271 dbSNP
rs570026771 2276 dbSNP
rs773485122 2291 dbSNP
rs1197247110 2295 dbSNP
rs1273267639 2296 dbSNP
rs953011907 2297 dbSNP
rs367639244 2298 dbSNP
rs888283505 2313 dbSNP
rs551516508 2316 dbSNP
rs533352888 2328 dbSNP
rs1381960225 2329 dbSNP
rs948631238 2351 dbSNP
rs973153411 2353 dbSNP
rs1474464340 2354 dbSNP
rs1435028222 2355 dbSNP
rs1397455219 2362 dbSNP
rs916904872 2370 dbSNP
rs1301631165 2374 dbSNP
rs73419426 2375 dbSNP
rs1456538388 2382 dbSNP
rs772144317 2385 dbSNP
rs960219361 2386 dbSNP
rs1324245589 2387 dbSNP
rs569110361 2389 dbSNP
rs539810209 2391 dbSNP
rs1001752401 2395 dbSNP
rs1386878621 2396 dbSNP
rs924394825 2405 dbSNP
rs978465908 2406 dbSNP
rs968889635 2416 dbSNP
rs1215879630 2422 dbSNP
rs1248055663 2425 dbSNP
rs1210104016 2426 dbSNP
rs143661367 2427 dbSNP
rs1373887011 2441 dbSNP
rs1472551058 2450 dbSNP
rs1162072747 2453 dbSNP
rs1387533457 2454 dbSNP
rs113751954 2455 dbSNP
rs1043039427 2463 dbSNP
rs986789070 2466 dbSNP
rs1298164958 2481 dbSNP
rs1264556823 2482 dbSNP
rs1383416166 2484 dbSNP
rs1383441558 2492 dbSNP
rs750471108 2495 dbSNP
rs532656033 2497 dbSNP
rs561753085 2500 dbSNP
rs1053248766 2502 dbSNP
rs993525508 2516 dbSNP
rs543073876 2521 dbSNP
rs1258913109 2525 dbSNP
rs911758909 2529 dbSNP
rs1206975865 2531 dbSNP
rs1051652463 2536 dbSNP
rs1441901738 2549 dbSNP
rs576253000 2556 dbSNP
rs1245169011 2566 dbSNP
rs921560512 2570 dbSNP
rs1158373173 2573 dbSNP
rs1016396900 2574 dbSNP
rs1455745507 2575 dbSNP
rs1006302740 2577 dbSNP
rs1385231239 2578 dbSNP
rs7292471 2587 dbSNP
rs12628941 2588 dbSNP
rs1294282971 2591 dbSNP
rs1383003141 2592 dbSNP
rs1459647091 2598 dbSNP
rs754078220 2599 dbSNP
rs1445814794 2604 dbSNP
rs1044198454 2607 dbSNP
rs1166511348 2610 dbSNP
rs983250186 2610 dbSNP
rs1013269632 2611 dbSNP
rs895706980 2612 dbSNP
rs1322973024 2613 dbSNP
rs1194685716 2635 dbSNP
rs1431007330 2640 dbSNP
rs1201832328 2642 dbSNP
rs545976822 2643 dbSNP
rs1461915306 2645 dbSNP
rs779950980 2648 dbSNP
rs769357936 2649 dbSNP
rs745332870 2650 dbSNP
rs1248790125 2654 dbSNP
rs1035836589 2655 dbSNP
rs1056966449 2656 dbSNP
rs572318982 2657 dbSNP
rs553495972 2659 dbSNP
rs1177916632 2664 dbSNP
rs1272869504 2666 dbSNP
rs112199455 2669 dbSNP
rs112454743 2671 dbSNP
rs11405382 2671 dbSNP
rs1491279380 2671 dbSNP
rs397688954 2671 dbSNP
rs1464722574 2678 dbSNP
rs1343494469 2681 dbSNP
rs1398445336 2688 dbSNP
rs1015589027 2693 dbSNP
rs189645678 2698 dbSNP
rs1231727203 2699 dbSNP
rs1330529002 2705 dbSNP
rs1221799595 2711 dbSNP
rs1285202986 2715 dbSNP
rs1302114232 2717 dbSNP
rs1042793455 2718 dbSNP
rs371234535 2723 dbSNP
rs1481848668 2725 dbSNP
rs1196697727 2730 dbSNP
rs542958111 2740 dbSNP
rs891820922 2744 dbSNP
rs1200974621 2748 dbSNP
rs1032162611 2751 dbSNP
rs6001277 2753 dbSNP
rs1374411622 2758 dbSNP
rs986286235 2759 dbSNP
rs890270387 2789 dbSNP
rs1371071238 2792 dbSNP
rs368430892 2806 dbSNP
rs1464485524 2807 dbSNP
rs1346305596 2808 dbSNP
rs775738188 2809 dbSNP
rs923570659 2813 dbSNP
rs1214031574 2820 dbSNP
rs1293729288 2823 dbSNP
rs972307027 2837 dbSNP
rs569964952 2841 dbSNP
rs1228621022 2842 dbSNP
rs34295378 2846 dbSNP
rs1051601886 2847 dbSNP
rs962072314 2853 dbSNP
rs1489956959 2854 dbSNP
rs199821671 2855 dbSNP
rs931853395 2861 dbSNP
rs140089910 2865 dbSNP
rs1249251472 2866 dbSNP
rs1184210405 2871 dbSNP
rs375675770 2872 dbSNP
rs1181895566 2877 dbSNP
rs1483554126 2883 dbSNP
rs1421249694 2885 dbSNP
rs772525218 2888 dbSNP
rs1006312815 2889 dbSNP
rs1163828708 2897 dbSNP
rs1383213906 2899 dbSNP
rs62228811 2907 dbSNP
rs773789723 2908 dbSNP
rs1012774708 2911 dbSNP
rs895624503 2912 dbSNP
rs1057008652 2913 dbSNP
rs1287121572 2915 dbSNP
rs998692775 2917 dbSNP
rs185972791 2922 dbSNP
rs902867108 2929 dbSNP
rs1314621221 2933 dbSNP
rs1042676599 2939 dbSNP
rs928771264 2940 dbSNP
rs980230604 2941 dbSNP
rs149721827 2958 dbSNP
rs6001276 2960 dbSNP
rs1485901334 2965 dbSNP
rs1182671075 2966 dbSNP
rs1050586829 2968 dbSNP
rs139591439 2969 dbSNP
rs923431926 2974 dbSNP
rs972312075 2975 dbSNP
rs1398821180 2980 dbSNP
rs1470703640 2982 dbSNP
rs576253447 2993 dbSNP
rs1347102636 3002 dbSNP
rs940889239 3004 dbSNP
rs909224372 3015 dbSNP
rs984783812 3029 dbSNP
rs891225275 3035 dbSNP
rs969775001 3036 dbSNP
rs1222625586 3040 dbSNP
rs1286952397 3042 dbSNP
rs1317032487 3047 dbSNP
rs1202460489 3056 dbSNP
rs543365632 3067 dbSNP
rs6001275 3068 dbSNP
rs900360916 3077 dbSNP
rs1037993157 3089 dbSNP
rs564371852 3090 dbSNP
rs1468405711 3093 dbSNP
rs959936622 3094 dbSNP
rs1035455321 3097 dbSNP
rs1185935420 3103 dbSNP
rs1442321814 3104 dbSNP
rs1404192990 3105 dbSNP
rs1471047189 3107 dbSNP
rs938382726 3108 dbSNP
rs928384091 3109 dbSNP
rs1044150411 3112 dbSNP
rs1257561809 3117 dbSNP
rs546054755 3119 dbSNP
rs914761318 3129 dbSNP
rs990785283 3131 dbSNP
rs956318835 3136 dbSNP
rs1435914439 3149 dbSNP
rs1206292903 3156 dbSNP
rs924574373 3163 dbSNP
rs116190527 3164 dbSNP
rs572256016 3168 dbSNP
rs1198809623 3171 dbSNP
rs955381120 3172 dbSNP
rs1028398092 3175 dbSNP
rs1173420721 3179 dbSNP
rs1419050919 3186 dbSNP
rs1229198863 3187 dbSNP
rs1408598717 3189 dbSNP
rs1331249448 3193 dbSNP
rs1371726597 3194 dbSNP
rs1404938520 3195 dbSNP
rs1353139176 3196 dbSNP
rs769356531 3205 dbSNP
rs1011271672 3213 dbSNP
rs888772216 3221 dbSNP
rs1050226489 3222 dbSNP
rs933025725 3223 dbSNP
rs867105838 3224 dbSNP
rs1336996080 3230 dbSNP
rs1006514617 3233 dbSNP
rs902020413 3236 dbSNP
rs1273379052 3245 dbSNP
rs886349082 3251 dbSNP
rs1220252789 3252 dbSNP
rs1454515839 3253 dbSNP
rs1036502643 3254 dbSNP
rs1490876164 3260 dbSNP
rs1047675210 3267 dbSNP
rs1241778619 3269 dbSNP
rs1474515054 3276 dbSNP
rs1319328194 3277 dbSNP
rs1002477237 3280 dbSNP
rs940939722 3290 dbSNP
rs560359859 3291 dbSNP
rs1424384634 3296 dbSNP
rs985432044 3298 dbSNP
rs1367949669 3300 dbSNP
rs1386873568 3308 dbSNP
rs755382326 3309 dbSNP
rs370892816 3310 dbSNP
rs747937028 3311 dbSNP
rs1161818646 3328 dbSNP
rs1432533940 3329 dbSNP
rs992265714 3331 dbSNP
rs960751410 3332 dbSNP
rs1035507585 3333 dbSNP
rs541672990 3334 dbSNP
rs977250591 3339 dbSNP
rs967172585 3342 dbSNP
rs1210518178 3348 dbSNP
rs1463961344 3348 dbSNP
rs376556733 3356 dbSNP
rs914686552 3371 dbSNP
rs1021577995 3375 dbSNP
rs1445345917 3377 dbSNP
rs1054638680 3385 dbSNP
rs934859656 3389 dbSNP
rs180857673 3393 dbSNP
rs1387634629 3394 dbSNP
rs987078965 3411 dbSNP
rs373308956 3414 dbSNP
rs1288072612 3418 dbSNP
rs5757314 3419 dbSNP
rs575587926 3422 dbSNP
rs921283788 3424 dbSNP
rs554055982 3426 dbSNP
rs1017466110 3427 dbSNP
rs997288292 3439 dbSNP
rs1006049611 3444 dbSNP
rs1258856649 3447 dbSNP
rs576067351 3451 dbSNP
rs901569009 3455 dbSNP
rs950630528 3456 dbSNP
rs1206923373 3461 dbSNP
rs111458817 3463 dbSNP
rs940866537 3465 dbSNP
rs1346587100 3466 dbSNP
rs558013302 3467 dbSNP
rs754906768 3469 dbSNP
rs74653710 3471 dbSNP
rs566055583 3474 dbSNP
rs369525685 3475 dbSNP
rs916601345 3484 dbSNP
rs1056846965 3489 dbSNP
rs1054652940 3496 dbSNP
rs939338643 3501 dbSNP
rs903363371 3508 dbSNP
rs1165889859 3512 dbSNP
rs535681340 3515 dbSNP
rs1051324944 3519 dbSNP
rs924058291 3521 dbSNP
rs1322897281 3523 dbSNP
rs568100791 3524 dbSNP
rs967224827 3532 dbSNP
rs1442029309 3535 dbSNP
rs1189292169 3538 dbSNP
rs914351529 3543 dbSNP
rs574784078 3544 dbSNP
rs549659753 3547 dbSNP
rs921229600 3552 dbSNP
rs990092320 3554 dbSNP
rs1439997961 3556 dbSNP
rs975429332 3557 dbSNP
rs1245059087 3567 dbSNP
rs1221055946 3573 dbSNP
rs1479151131 3574 dbSNP
rs531326836 3577 dbSNP
rs1178201190 3587 dbSNP
rs1452429055 3589 dbSNP
rs6001274 3590 dbSNP
rs1224494279 3594 dbSNP
rs1231795419 3600 dbSNP
rs552479954 3607 dbSNP
rs1302467753 3608 dbSNP
rs997207473 3618 dbSNP
rs1403158685 3620 dbSNP
rs1312957065 3623 dbSNP
rs950552240 3623 dbSNP
rs1273898732 3625 dbSNP
rs1215104781 3626 dbSNP
rs28594557 3630 dbSNP
rs12628591 3636 dbSNP
rs1249919905 3637 dbSNP
rs879181547 3637 dbSNP
rs1435253505 3638 dbSNP
rs1332772873 3641 dbSNP
rs1268768642 3642 dbSNP
rs373450483 3642 dbSNP
rs1275547423 3643 dbSNP
rs527547577 3643 dbSNP
rs1428123249 3644 dbSNP
rs1427494698 3645 dbSNP
rs1167862405 3648 dbSNP
rs28580631 3648 dbSNP
rs1345808609 3649 dbSNP
rs71319014 3649 dbSNP
rs1430133277 3650 dbSNP
rs59140414 3652 dbSNP
rs1363586714 3653 dbSNP
rs1403215454 3653 dbSNP
rs28616050 3654 dbSNP
rs141233893 3655 dbSNP
rs1334537571 3656 dbSNP
rs1428301324 3657 dbSNP
rs1368594945 3659 dbSNP
rs1381926973 3659 dbSNP
rs149118856 3659 dbSNP
rs1370471157 3660 dbSNP
rs1367854770 3662 dbSNP
rs28416336 3662 dbSNP
rs1076613 3663 dbSNP
rs1229528768 3663 dbSNP
rs1291726435 3663 dbSNP
rs66505567 3664 dbSNP
rs878901596 3665 dbSNP
rs1412161538 3666 dbSNP
rs1423090283 3667 dbSNP
rs1449873692 3667 dbSNP
rs868324094 3667 dbSNP
rs1190731985 3668 dbSNP
rs1478459880 3670 dbSNP
rs1053434428 3672 dbSNP
rs1271399592 3672 dbSNP
rs1426412332 3672 dbSNP
rs1201295447 3674 dbSNP
rs1165382373 3675 dbSNP
rs1350610878 3675 dbSNP
rs1481919672 3676 dbSNP
rs1250812504 3677 dbSNP
rs1205089679 3678 dbSNP
rs935695432 3679 dbSNP
rs1436280036 3680 dbSNP
rs1309212859 3681 dbSNP
rs1275870785 3682 dbSNP
rs1218173703 3683 dbSNP
rs904165957 3683 dbSNP
rs1230597179 3684 dbSNP
rs1314022990 3686 dbSNP
rs528270375 3687 dbSNP
rs1284868434 3690 dbSNP
rs1182422307 3691 dbSNP
rs1202816819 3691 dbSNP
rs1241109793 3691 dbSNP
rs1407093784 3691 dbSNP
rs1418606677 3691 dbSNP
rs1465017898 3691 dbSNP
rs1473654627 3691 dbSNP
rs1491406185 3691 dbSNP
rs3042739 3691 dbSNP
rs796787770 3691 dbSNP
rs869118076 3691 dbSNP
rs1407618224 3692 dbSNP
rs1491490273 3692 dbSNP
rs1303957203 3693 dbSNP
rs1350211111 3697 dbSNP
rs1289621099 3698 dbSNP
rs1329226153 3699 dbSNP
rs1222597809 3712 dbSNP
rs750420815 3718 dbSNP
rs1260834232 3722 dbSNP
rs1443947771 3723 dbSNP
rs1210508902 3740 dbSNP
rs1299121202 3741 dbSNP
rs1026125683 3742 dbSNP
rs1414366606 3745 dbSNP
rs1472940364 3755 dbSNP
rs1444961952 3765 dbSNP
rs1176039204 3766 dbSNP
rs1423270433 3767 dbSNP
rs1416551324 3768 dbSNP
rs538331836 3777 dbSNP
rs569047687 3780 dbSNP
rs1310386704 3781 dbSNP
rs1350618685 3783 dbSNP
rs559558326 3785 dbSNP
rs1281007533 3792 dbSNP
rs56057553 3792 dbSNP
rs1431553393 3796 dbSNP
rs560194165 3797 dbSNP
rs1472407126 3804 dbSNP
rs1305546623 3806 dbSNP
rs1022871508 3816 dbSNP
rs965687633 3831 dbSNP
rs1014715054 3833 dbSNP
rs1004631053 3834 dbSNP
rs541958107 3839 dbSNP
rs1481558818 3844 dbSNP
rs866161457 3852 dbSNP
rs1173366186 3858 dbSNP
rs1419335972 3864 dbSNP
rs189172055 3866 dbSNP
rs1012521486 3872 dbSNP
rs562202673 3894 dbSNP
rs1208802092 3899 dbSNP
rs753912241 3907 dbSNP
rs1423453544 3912 dbSNP
rs115654378 3913 dbSNP
rs1226137660 3914 dbSNP
rs1328112339 3918 dbSNP
rs903312409 3921 dbSNP
rs199946498 3923 dbSNP
rs376374191 3931 dbSNP
rs1359666346 3932 dbSNP
rs1230279209 3936 dbSNP
rs939390654 3941 dbSNP
rs1358559583 3942 dbSNP
rs923941990 3947 dbSNP
rs934178321 3949 dbSNP
rs1287890706 3950 dbSNP
rs1225898171 3952 dbSNP
rs900080604 3953 dbSNP
rs1199904248 3955 dbSNP
rs1241726203 3956 dbSNP
rs557702054 3958 dbSNP
rs1391337509 3959 dbSNP
rs1377601282 3962 dbSNP
rs1302715243 3965 dbSNP
rs1161971257 3966 dbSNP
rs1392305353 3971 dbSNP
rs1405423546 3972 dbSNP
rs941356498 3975 dbSNP
rs1042455046 3981 dbSNP
rs1437016392 3982 dbSNP
rs1408343781 3983 dbSNP
rs1381753314 3986 dbSNP
rs1318649286 3987 dbSNP
rs909888886 3987 dbSNP
rs946768467 3993 dbSNP
rs930067254 3997 dbSNP
rs1364642559 3998 dbSNP
rs1210804815 4008 dbSNP
rs1249103980 4009 dbSNP
rs914424601 4012 dbSNP
rs539464837 4013 dbSNP
rs971244553 4019 dbSNP
rs1157415096 4022 dbSNP
rs868116353 4025 dbSNP
rs953220206 4033 dbSNP
rs1409328604 4034 dbSNP
rs1181169557 4039 dbSNP
rs1320806583 4041 dbSNP
rs1405138007 4049 dbSNP
rs921871830 4053 dbSNP
rs1445189814 4054 dbSNP
rs975987410 4066 dbSNP
rs1244419961 4068 dbSNP
rs572363640 4076 dbSNP
rs554173134 4082 dbSNP
rs1014556988 4084 dbSNP
rs1340954817 4084 dbSNP
rs1004639625 4103 dbSNP
rs536047151 4104 dbSNP
rs1287871330 4111 dbSNP
rs1327154027 4116 dbSNP
rs957036759 4116 dbSNP
rs1268979394 4117 dbSNP
rs1461163906 4118 dbSNP
rs1199051771 4119 dbSNP
rs1258878773 4120 dbSNP
rs1033094282 4127 dbSNP
rs951866444 4128 dbSNP
rs1249071710 4130 dbSNP
rs1027390391 4133 dbSNP
rs733107 4136 dbSNP
rs998334067 4145 dbSNP
rs900028458 4147 dbSNP
rs866004739 4153 dbSNP
rs1056682185 4154 dbSNP
rs1039928892 4157 dbSNP
rs143761420 4158 dbSNP
rs1434553033 4159 dbSNP
rs888417466 4159 dbSNP
rs1047515827 4161 dbSNP
rs1003711578 4165 dbSNP
rs902530597 4173 dbSNP
rs1346148447 4177 dbSNP
rs537969791 4179 dbSNP
rs928050222 4205 dbSNP
rs733106 4208 dbSNP
rs946820753 4219 dbSNP
rs1267742938 4223 dbSNP
rs893906018 4225 dbSNP
rs1431147037 4229 dbSNP
rs1049821679 4232 dbSNP
rs752989303 4243 dbSNP
rs1186105968 4244 dbSNP
rs1461274155 4251 dbSNP
rs921783020 4251 dbSNP
rs767877390 4252 dbSNP
rs552160402 4261 dbSNP
rs1261817674 4262 dbSNP
rs957523821 4269 dbSNP
rs944569605 4273 dbSNP
rs1366981045 4280 dbSNP
rs1385380028 4282 dbSNP
rs113908331 4288 dbSNP
rs1332091138 4290 dbSNP
rs369478066 4295 dbSNP
rs951734081 4296 dbSNP
rs964185020 4298 dbSNP
rs1018862870 4300 dbSNP
rs1487199471 4305 dbSNP
rs1211315803 4309 dbSNP
rs1223746181 4310 dbSNP
rs566792806 4312 dbSNP
rs990583334 4315 dbSNP
rs959810142 4316 dbSNP
rs1186364760 4321 dbSNP
rs1327032611 4323 dbSNP
rs1450072099 4326 dbSNP
rs1162848006 4327 dbSNP
rs375336203 4332 dbSNP
rs1456438596 4336 dbSNP
rs1003763935 4343 dbSNP
rs1295529551 4344 dbSNP
rs1367216876 4350 dbSNP
rs1391676560 4352 dbSNP
rs1047348892 4356 dbSNP
rs1295790696 4361 dbSNP
rs1367783751 4363 dbSNP
rs1229834546 4368 dbSNP
rs902749366 4376 dbSNP
rs994111689 4382 dbSNP
rs548228220 4388 dbSNP
rs1011352383 4403 dbSNP
rs1046439758 4413 dbSNP
rs948141649 4414 dbSNP
rs915711818 4416 dbSNP
rs1249731878 4417 dbSNP
rs1465156873 4422 dbSNP
rs1181260423 4424 dbSNP
rs893798431 4425 dbSNP
rs56108909 4426 dbSNP
rs529883344 4447 dbSNP
rs774812937 4458 dbSNP
rs1166925088 4469 dbSNP
rs1369286999 4470 dbSNP
rs762058074 4472 dbSNP
rs1326428541 4477 dbSNP
rs1431067311 4480 dbSNP
rs1456972451 4485 dbSNP
rs925842554 4488 dbSNP
rs547283972 4492 dbSNP
rs1490927032 4493 dbSNP
rs1436206432 4496 dbSNP
rs967004872 4501 dbSNP
rs142726813 4502 dbSNP
rs1040200743 4510 dbSNP
rs1312882905 4511 dbSNP
rs944507254 4512 dbSNP
rs964144091 4516 dbSNP
rs1329633672 4518 dbSNP
rs1253119897 4526 dbSNP
rs907823068 4534 dbSNP
rs1053197 4541 dbSNP
rs1311813060 4542 dbSNP
rs1235670803 4543 dbSNP
rs930345946 4545 dbSNP
rs561722522 4546 dbSNP
rs1006131729 4554 dbSNP
rs1472290905 4558 dbSNP
rs920235672 4560 dbSNP
rs990985131 4561 dbSNP
rs1053199 4567 dbSNP
rs1053200 4568 dbSNP
rs1401654097 4574 dbSNP
rs1347113571 4575 dbSNP
rs1357771639 4579 dbSNP
rs369114543 4585 dbSNP
rs1305976597 4588 dbSNP
rs994392891 4590 dbSNP
rs1349392925 4595 dbSNP
rs959124618 4600 dbSNP
rs763932185 4601 dbSNP
rs1024938668 4603 dbSNP
rs1276320694 4604 dbSNP
rs1464156857 4605 dbSNP
rs982268716 4607 dbSNP
rs966837401 4609 dbSNP
rs1021196001 4610 dbSNP
rs5757313 4611 dbSNP
rs1481232001 4612 dbSNP
rs762479008 4614 dbSNP
rs1180019109 4619 dbSNP
rs1410185051 4623 dbSNP
rs564252056 4631 dbSNP
rs148221944 4634 dbSNP
rs1028289403 4639 dbSNP
rs556923229 4641 dbSNP
rs1416505482 4644 dbSNP
rs1253353718 4645 dbSNP
rs772630245 4649 dbSNP
rs1309261692 4650 dbSNP
rs1041140477 4668 dbSNP
rs1008771467 4669 dbSNP
rs1435355632 4681 dbSNP
rs886272777 4682 dbSNP
rs149190151 4683 dbSNP
rs930544303 4693 dbSNP
rs769423360 4695 dbSNP
rs1054775535 4697 dbSNP
rs1238151606 4699 dbSNP
rs1207185982 4704 dbSNP
rs922231895 4710 dbSNP
rs1438461581 4713 dbSNP
rs1406739653 4727 dbSNP
rs138286478 4733 dbSNP
rs747769851 4738 dbSNP
rs927745984 4739 dbSNP
rs910944791 4748 dbSNP
rs574956217 4749 dbSNP
rs983916203 4761 dbSNP
rs1170993482 4762 dbSNP
rs1396670160 4765 dbSNP
rs1404187760 4771 dbSNP
rs952963858 4773 dbSNP
rs1351222146 4775 dbSNP
rs1025768971 4777 dbSNP
rs972925002 4778 dbSNP
rs1362731847 4779 dbSNP
rs776484135 4786 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||   | ||||||| 
Target 5' ccucguCCACCCU-UGCUGCUu 3'
3 - 23
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000407418.3 | 3UTR | CCCCUCGUCCACCCUUGCUGCUUUCCAUUUGCCUAAUUACCAAGCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.645 4.5e-4 0.680 1.8e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.624 1.6e-3 -0.729 1.3e-4 20 Click to see details
GSE19783 ER- ER- breast cancer -0.229 2.1e-2 -0.188 4.9e-2 79 Click to see details
GSE32688 Pancreatic cancer -0.361 2.1e-2 -0.131 2.4e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.395 2.5e-2 -0.494 6.0e-3 25 Click to see details
GSE38226 Liver fibrosis -0.427 2.7e-2 -0.279 1.1e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.371 3.7e-2 -0.423 2.0e-2 24 Click to see details
GSE21032 Prostate cancer -0.176 5.6e-2 -0.103 1.8e-1 83 Click to see details
GSE27834 Pluripotent stem cells -0.387 6.9e-2 -0.400 6.2e-2 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.251 1.4e-1 0.159 2.5e-1 20 Click to see details
GSE19536 Breast cancer -0.095 1.7e-1 -0.102 1.6e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.115 1.8e-1 -0.059 3.2e-1 64 Click to see details
GSE17498 Multiple myeloma -0.126 2.2e-1 -0.003 4.9e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.23 2.2e-1 -0.110 3.6e-1 13 Click to see details
GSE28544 Breast cancer -0.148 2.5e-1 -0.522 4.4e-3 24 Click to see details
GSE19350 CNS germ cell tumors -0.159 3.1e-1 0.028 4.7e-1 12 Click to see details
GSE21849 B cell lymphoma -0.047 4.0e-1 -0.169 1.9e-1 29 Click to see details
GSE17306 Multiple myeloma 0.011 4.7e-1 0.083 2.9e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.007 4.9e-1 0.060 3.9e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.007 4.9e-1 0.060 3.9e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0 5.0e-1 0.005 4.8e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.695 0 -0.676 0 32 Click to see details
HNSC -0.477 0 -0.502 0 42 Click to see details
KIRP -0.416 0.01 -0.394 0.01 32 Click to see details
CHOL -0.755 0.01 -0.783 0.01 9 Click to see details
BLCA -0.534 0.01 -0.410 0.05 18 Click to see details
PRAD -0.322 0.01 -0.244 0.04 50 Click to see details
LIHC -0.207 0.08 -0.117 0.21 49 Click to see details
KIRC -0.162 0.09 -0.081 0.26 68 Click to see details
LUSC 0.218 0.09 0.193 0.12 38 Click to see details
COAD -0.405 0.16 -0.619 0.05 8 Click to see details
CESC 0.81 0.2 0.500 0.33 3 Click to see details
THCA -0.089 0.25 -0.103 0.22 59 Click to see details
PAAD -0.478 0.26 0.000 0.5 4 Click to see details
ESCA 0.17 0.31 0.255 0.22 11 Click to see details
KICH 0.081 0.35 -0.060 0.39 25 Click to see details
LUAD 0.124 0.35 0.133 0.34 12 Click to see details
PCPG 0.281 0.41 0.500 0.33 3 Click to see details
BRCA -0.022 0.42 -0.035 0.38 84 Click to see details
UCEC 0.012 0.48 -0.074 0.38 19 Click to see details
UCEC 0.012 0.48 -0.074 0.38 19 Click to see details
UCEC 0.012 0.48 -0.074 0.38 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 protea