miRTarBase - #MIRT506166 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLAG1   
Synonyms PSA, SGPA, ZNF912
Description PLAG1 zinc finger
Transcript NM_001114634   
Other Transcripts NM_001114635 , NM_002655   
Expression
Putative miRNA Targets on PLAG1
3'UTR of PLAG1
(miRNA target sites are highlighted)
>PLAG1|NM_001114634|3'UTR
   1 GATTCTGGGACATGGATTCATTACAGAAATGTATGTGTAGCTGTGCCCTAGATGACCATTTTTATTTTAGTGCCTACTTT
  81 AAAACAGTATAAAAATTTCTGCTTTTGTATAATACAAATTTTCATTAAGCCAGTATAAAATAGAAACTAGCTTTTAAACT
 161 GAGCTTTGGAACCATTTGTGTTCAGTTAAGTTTACCTGGGTATTTTGTCCTGATTCACTGCCAATTGTCACATTTTAAGA
 241 CTTTTTTTTTTCCATATAGGAAAGCCATTATTAGTAGTAAACTTTTACAAATCCCATTTTCAAATTACTTTTAGATCTTA
 321 AAATTTTCATTTTTGTCTAATAACAGTGGCTCTACCTTTTGACATCTGGCTCATTAAAAAATTTAGCAATAGAATGTAAA
 401 TTGTATAAAAAGTTTGTGAATAACTCAAGGGTTTAAATTTTCTTACTAGCTTCTAAATGGATTAATAATCAAGTGCTTCA
 481 AATGAATTAAGAGTCCAGTTTCGGAAGATAATAAATGTTTGTTAGATACACCATAATTTCAGATCAGTATATTCTGAAGA
 561 CTCCCTGTTGTCTGGCTAAAATATTTGCCATCTTTATTATGAGCCTTTAAGGAAAACAAACCCTAAACACAAAGCATCAG
 641 TATTTATAGCAAAAAGAGACTCTGTTAGGTGACATGGCATTTCGTGTCACTTAATAGTTGGCCCTAAATTAGTACACAGG
 721 ATATTTTGTCGTGTTTCATCCTTCTTAACATGCTATCTTTTCATTTAATAATAGTAATAGTGTATGGCATTGGGGTCTTC
 801 AGAGTCGATATATAGGTAGATCTCTTTAGTCTTTTCCACCTTTCACATCCAAGGGGTGGGTCAAGTGCAGCCAGCAATTT
 881 ATTTTCATTGTTGGCCCACGGTTAGTCCATAATCTAGAGCCATTGTGGAACTGCAGCCATGAGGTGTGTTTATCCCACAG
 961 TGGATTGACTCAGCCTCTGTGGGTGACAGACTTCTAAGCAGGAAGATAGACGTGAAGCACATGGTTACATTTGGGAACTT
1041 GTGTAGGGATCATGGCCCCTGTAGCCAGGGTTAAAAACTGGACTTTTTAGAAGTAAAGTAAAAGCATATCGCTTATATCA
1121 TTTCTTGCTGAATTTGATATGTTTTTCTTTCCCTTAAGAATCAAAAGCAGAAAACAAAAACAACAGTCCTACTCCGATGT
1201 TATCTTTCTGATTCAATGTGAATCCATCTTTCCTTGCAATATTTTGGATGGAGAATTTGAAGTTAAATGCATTAGAAAAC
1281 TACCTGATGAACTACCACAAAGTTTTAAGTGACTAGAAATATATACAGTAAAATCCCACTTTCATGCATCTCTGGGAAAT
1361 GATAGGAGTATTGCAAATAAGTTGAGTTTGTAGAGGGTAACAAAGTAAAGTAAAACAAACCTATCTTGGTTAACATGAAA
1441 ATAACAATTGAGAATATATTATATTCACTGAATAATTATAGGCTTTTCCTCACATTAGACAACCAACATAATCTTCTTAA
1521 AGGTCTAATTAATATATTTTTCTAAGGGTCAGTTGGGACATTAACCTAAGAAACATATCTATTAAGCACTTGTTAACACC
1601 TTATTTTAGGACCCTTTCCGTTGGGGATGGGGGCAAGGGTGGGAGGTTTTTAGAAGAGTATATATCTCTTTAAAAAAAAA
1681 CAGAAAGAAAAATATTTCTGAGCACTCATTAGCCCTATATGGAAACTTCTTTCCTTTTTGTAGGGCCAGTTATCACTGCA
1761 GATTGCAATGTTTACCAAGAATTTCTAAAAATGAGTGCAGATTACTGAATATAATACATTATTTAAAATATTTGGGAGTA
1841 GTATAATTTGTGGAGAAATGTAAATTGTAATAATGTAAATGGGGGCTTCAATATATATATATAATACACACACACACACA
1921 CATGCACACATACCGCACTTCATAGAATCAAAGTTGCTCTCTGAAGGAGCTTTGGCTCCTGATATTTTATCATGCTCCTA
2001 TATTTTTTTAATCCTTGGAGCAGTAGTTTTTATACTTATGTATTTAAATTTTATTATGAAAAATTACATTTATTAAAAAA
2081 GTGTGTTCCAAAGGCATTAAAATTATATATGTTAATAAGGAAGTACATTTTTAAATTTTTCAAACTGCTCCTAGCTTTTG
2161 ATTAGGAGAATATTTTTTCTGAAAGTAGGCTTTTCGCTCTGCTTCATTACTGCTTCCTTTAGTTTCTATGAAACAGATTG
2241 CTTACCTAAATCTTTAGTTGAATGATTAGTGTTCAATATTGCTTTAATCACCATATAAAAGGAAAAAAATTGGTGACAGA
2321 GCACAAATAGAAAACCTATTTTTAAATAGAAATCACAAATAGCAAGTGTGGAAGCACTACTTTATTCTGTTTAAAATGTA
2401 CTTAAGAAGTCATCAAATTAGTGAACTGAGACATTGGCCTTAGTAGGCTGTATTCACTGCTAATTTAAAAAAGGGAGTAC
2481 CAGGATTTATTAAGTAAAGCATTTTGGAAATGGGGAATAGCGCCATATATGTATGTATGTGTATGTGTGTGTGTGTGTGT
2561 GTATATATACACACACACACACATACTTAAATCTTGCCCTGCATGAAATTCAAATACATGGAGGCACATCTTCAGGGCAC
2641 CAGTGTTAAAATTTTGGAGTCTTAATTTTCATGTGTACACCTCTTTGCCTGTTCCCACCCCCAGACTTGAAATAACACTT
2721 CAGAGTAAGAGGGAATTCAGCTAATTTGTTTTTAAAATTGACTGTAGTGGTCACTAAACCCTTTTTGAGAGAATTTCTAT
2801 TAAAGATGAGGCAGACTCGCTTATTTGAATTGCACAATGTTCTAACAAGGATGTAACACAGAATTGGCTTTTTTTTCCCT
2881 AGAAAAAGATTGTTTGTTTCTATGTCAACTAGATATGATTAAAAATAAGTATTGCCAATGCTGTTTTCATTCTCTAGTGG
2961 CCAGAATCATTATCCTTGAAATTTCTGGTAGTGCCTTAGCTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAGGGATTAA
3041 CATTAAATAAAAGTAGTTTAGAATTTGGGCCTCAGACAAGATATTGAACCTCATTCAGTTTCACTTCCACATGTATGTAC
3121 AAGTTAGGTCACCAAACACGGAAGTGTGAGTGTGGAAGGATCTTGGCACTGTAAGCAATGCTATCCATTGATGTATACAA
3201 GTACCTTTATAGTTATCGATCACTGTTAAAACTTTCATTTTAAAATCCTATTACCAAGTTCAGTTTTTTAAAACTTCAAT
3281 TGTCCTGGCTGATTATGCATCACTCTGTGTGCAACTTTTTTATTTCATTTAGTGTTTCTTTCAAGCTGTGTATTTTTGCC
3361 TATTTGTTGCTTGTGCTTTATTTTTCTTAGTCATTTGTGGAATATAGTGATATATTGTGTTAATTTGGACAGTAGCGGTT
3441 TTTAAAAACCATATACTGACTGAAACATGAGCCAGAGCCGATTGCTTTATTAAGCTAATAATGAATGTTAAAGAGTACAT
3521 ATTTTCAGGATCGTTCATCTAGTGAGCAATACACATATTATAGGCCAATATTTTTTTAAAAAATAGAGCTTGGTCAACCT
3601 CTATACTACACATATTACAAGATATAGCACTTTCAAAATGAATCTAAACCTTTACAGAAACTTTCTTATAGGTTATGCCT
3681 TTTATTTTAAGACTTATTATAATTCAAGTGCCATTAGATGATATATATGTAGGCCTTTGATATATAATGCTTTGTGTACA
3761 AAAATGGTAGATGGTATTTTAAACAGGTACATTTTTACAGTGTTTTCTTATCAATTTGCTATATTGCACAGAATCAGTGT
3841 GTGTCTTTTCATAAGGTTTTACAATGGTTTATTTTTTTACAAGGTTTACGTGTCTCAAAGCACACTGTCTTCCCAGTACG
3921 TAAGTTAAAAAATACCAGTTCACCCAAGTTGCTTCTAGCCTACTGAGATCCATGTGACATTGGAGGAGATCTTTTAAATG
4001 TTTAGTATTCGTCATTAGCAATGGCTGGCTGTTAGTTCTGGTAAATGTGTGCCTAAGTTGAATTTGTCTTGTTTTTCTCA
4081 CACTGTGTCAGCAGCCATGTCTACAACACAGATAAGTCTGTTGTGATCACATAGATCTACATAAGTTGTGCAGTTTTGTG
4161 CTAAAAACCCATAGGGAGCTCCTTTGGGATCATAGAAAAGAAGATCATGCAACCAGCATTGGTGAAGGCACACTCAGATT
4241 GCACTTAGGGCCTTTCTATGATGTTGTCAACCCTCTGAGGATGGAAGGCAGTGTCTTTTGATGTTATCTAGCCTAGAAAT
4321 GACACAGAACTATTGCTAATGTATAAAACACTTCATTATATAAGCTTCAGTGGTACAGATGAACCAGAATGAATGTTTAT
4401 CTTCTCAGAAACACTCCTTCAATATTATATTGGATCATGCTGCTAATGTAACTTGGGCTACAACTCTTCATGGTGCTACA
4481 AACTTCTCTGTCTCATTCAGTCGTATTTTTTTATCCATAGAAAAAGGACTACATTAGGTGTAAAAGTGTACAATATATTT
4561 TTATACTGTGACTTAATTTGTCATTAACAAACTTTTACACCACCACAATGTATTCATGTGCACTTGCAAAAGGAGATCTC
4641 GGACATGCAAATGTTACCAGAACAAACCCAGCTTTTGTCCACAAGGTGACTGTAACTCAGAATGGAAAGTGGGCTTTATA
4721 ATAGGGTGTGGAGTGAAGAACATGCTGTATGTTACTAACAGCCCTTTGAATTTAACAAAAACTGGGAATCCATTAGGAAA
4801 CGGATTGCATCATACCTGAACATAAGCTGGACTGCTGAAATTGTATTTTTAGCTAATGAAAAAGTGTTTGGACTAGTACT
4881 CTAAAAATGTTCTAATGATAAAGTTTTGAGTCAAAATAGAAAAGAAAAAAATCTGCATTCCAGGCCGAATTTTGTATATT
4961 TTTATTGCATTTAAAATTGCTATTCTGTAATATTGGGAAATCAAGTGGCTTATCATGTATATCGTGTACTTAAAATGTAT
5041 TCACAAACTACTGTTGTATTTGTATAAAATATAGACAAAGATCATATTTTTTGTGTGTGTATAAGCTCTGTAAAATAGCA
5121 ATCACATTATGAAGCTGCAGTGATACTACATTTTAAACATTCACATCCAAAGAAGCAGACTATTTATTGTCCATATACCA
5201 GATTTAAAATATTAATTTGCTGCTAATTAAATAATAGTACTGCAGCTTCTTGTGGCCTACAGTGTTATGTTTGCTGTAAG
5281 AATAAGATATGTGAATTCCACAAAATATATGAATAAAATTATAGAATGGCTTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA-UACACGACGAu 5'
            :||| :||| || ||||||| 
Target 5' ttTAAAATATTAATTTGCTGCTa 3'
5203 - 5225 168.00 -12.20
2
miRNA  3' guGUU-UGGUAAUAC-----ACGACGAu 5'
            ||| |::||  ||     ||||||| 
Target 5' ttCAATATTATATTGGATCATGCTGCTa 3'
4418 - 4445 152.00 -12.50
3
miRNA  3' gugUUUGGUAAU-AC----ACGACGAu 5'
             |||: | || ||    |||||:| 
Target 5' taaAAATAAGTATTGCCAATGCTGTTt 3'
2920 - 2946 137.00 -8.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN510063 19 COSMIC
COSN30109995 31 COSMIC
COSN5865225 32 COSMIC
COSN31550831 33 COSMIC
COSN30103325 36 COSMIC
COSN2281276 39 COSMIC
COSN26989305 56 COSMIC
COSN31529263 66 COSMIC
COSN30100442 76 COSMIC
COSN31542155 99 COSMIC
COSN20123585 103 COSMIC
COSN1366243 242 COSMIC
COSN16963509 344 COSMIC
COSN9661385 501 COSMIC
COSN20244098 502 COSMIC
COSN5684209 832 COSMIC
COSN17827170 1012 COSMIC
COSN17182765 1193 COSMIC
COSN28541439 1196 COSMIC
COSN30172842 1493 COSMIC
COSN31549555 1540 COSMIC
COSN20822952 1573 COSMIC
COSN31557544 1574 COSMIC
COSN31486924 1620 COSMIC
COSN29607803 1671 COSMIC
COSN30539071 1671 COSMIC
COSN4940734 1697 COSMIC
COSN31523552 1843 COSMIC
COSN16296047 1905 COSMIC
COSN20105503 1905 COSMIC
COSN28152407 1906 COSMIC
COSN31546676 2139 COSMIC
COSN31547888 2195 COSMIC
COSN31568488 2226 COSMIC
COSN31522014 2302 COSMIC
COSN26174914 2303 COSMIC
COSN31962962 2355 COSMIC
COSN9661383 2356 COSMIC
COSN26581579 2483 COSMIC
COSN31540918 2521 COSMIC
COSN31514783 2543 COSMIC
COSN31535855 2543 COSMIC
COSN29743145 2544 COSMIC
COSN31569273 2553 COSMIC
COSN30175289 2559 COSMIC
COSN28671911 2561 COSMIC
COSN8092111 2563 COSMIC
COSN30176746 2568 COSMIC
COSN28106721 2569 COSMIC
COSN31518509 2570 COSMIC
COSN21627586 2604 COSMIC
COSN31570706 2683 COSMIC
COSN31563318 2702 COSMIC
COSN29665705 2752 COSMIC
COSN31491210 2754 COSMIC
COSN31547126 2821 COSMIC
COSN9661382 2859 COSMIC
COSN20855198 2934 COSMIC
COSN31532475 3007 COSMIC
COSN31561905 3032 COSMIC
COSN26574036 3033 COSMIC
COSN9661381 3211 COSMIC
COSN31568475 3217 COSMIC
COSN31483073 3261 COSMIC
COSN30165088 3307 COSMIC
COSN31549556 3338 COSMIC
COSN30169605 3400 COSMIC
COSN31778698 3436 COSMIC
COSN30543346 3437 COSMIC
COSN30162406 3480 COSMIC
COSN30544485 3577 COSMIC
COSN26589364 3578 COSMIC
COSN31523560 3648 COSMIC
COSN2281275 3709 COSMIC
COSN4940733 3739 COSMIC
COSN31547104 3750 COSMIC
COSN21520082 3780 COSMIC
COSN6699965 3839 COSMIC
COSN31519048 3845 COSMIC
COSN20105500 3871 COSMIC
COSN26550803 3903 COSMIC
COSN31548709 3905 COSMIC
COSN17078614 4118 COSMIC
COSN23582919 4144 COSMIC
COSN23066532 4200 COSMIC
COSN21143837 4224 COSMIC
COSN17182034 4264 COSMIC
COSN24302584 4322 COSMIC
COSN27776282 4323 COSMIC
COSN2281274 4425 COSMIC
COSN9661380 4502 COSMIC
COSN19330471 4505 COSMIC
COSN31550843 4550 COSMIC
COSN30543172 4797 COSMIC
COSN27073150 4897 COSMIC
COSN31539657 4928 COSMIC
COSN31529840 4962 COSMIC
COSN31517917 5023 COSMIC
COSN22109803 5024 COSMIC
COSN31531346 5064 COSMIC
COSN31544355 5108 COSMIC
rs34715615 3871 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759676950 2 dbSNP
rs774529289 5 dbSNP
rs1372913133 6 dbSNP
rs1164267320 8 dbSNP
rs770946747 12 dbSNP
rs534097674 15 dbSNP
rs1396820444 19 dbSNP
rs1357819187 27 dbSNP
rs1430765797 30 dbSNP
rs904239542 30 dbSNP
rs754956552 32 dbSNP
rs764795534 35 dbSNP
rs768369873 41 dbSNP
rs1010292003 44 dbSNP
rs1188878067 45 dbSNP
rs1306238253 46 dbSNP
rs746870540 48 dbSNP
rs1213365599 58 dbSNP
rs1442779392 71 dbSNP
rs1299685771 82 dbSNP
rs892730014 87 dbSNP
rs1227386891 89 dbSNP
rs1315380704 92 dbSNP
rs1361126685 96 dbSNP
rs544620120 107 dbSNP
rs1273237996 108 dbSNP
rs1307449996 118 dbSNP
rs575754603 125 dbSNP
rs1205768541 130 dbSNP
rs565363193 133 dbSNP
rs1040631443 135 dbSNP
rs1440434087 137 dbSNP
rs1369062735 140 dbSNP
rs545513736 154 dbSNP
rs1447278416 159 dbSNP
rs1446637664 162 dbSNP
rs1166827917 165 dbSNP
rs573329399 168 dbSNP
rs553547953 174 dbSNP
rs1410473812 176 dbSNP
rs911820184 177 dbSNP
rs1357349633 183 dbSNP
rs1447082505 184 dbSNP
rs1337116642 188 dbSNP
rs1384589584 190 dbSNP
rs986414594 198 dbSNP
rs944938890 199 dbSNP
rs910759541 202 dbSNP
rs1215812018 217 dbSNP
rs1050544914 220 dbSNP
rs146219331 224 dbSNP
rs573999721 227 dbSNP
rs1264100604 236 dbSNP
rs1462840082 243 dbSNP
rs75628621 245 dbSNP
rs60449229 246 dbSNP
rs1188337941 252 dbSNP
rs1241597508 252 dbSNP
rs57439758 252 dbSNP
rs796699592 252 dbSNP
rs1423025997 266 dbSNP
rs1239643362 273 dbSNP
rs1180854764 281 dbSNP
rs962770461 282 dbSNP
rs1455324102 283 dbSNP
rs1015664726 285 dbSNP
rs1326644105 288 dbSNP
rs920635386 290 dbSNP
rs982964020 303 dbSNP
rs972105350 308 dbSNP
rs754010470 318 dbSNP
rs1366149501 329 dbSNP
rs971940548 346 dbSNP
rs1024564867 350 dbSNP
rs1326014291 360 dbSNP
rs1207210431 361 dbSNP
rs1283894779 363 dbSNP
rs74568212 372 dbSNP
rs1218079514 373 dbSNP
rs1245005869 379 dbSNP
rs570941502 383 dbSNP
rs141959330 390 dbSNP
rs999792696 396 dbSNP
rs1157757035 403 dbSNP
rs1385268683 403 dbSNP
rs902952377 405 dbSNP
rs1041414049 407 dbSNP
rs1233682101 410 dbSNP
rs1348734759 416 dbSNP
rs572006436 428 dbSNP
rs1311783081 431 dbSNP
rs1226989306 435 dbSNP
rs1279298326 436 dbSNP
rs1351700612 440 dbSNP
rs1224585057 461 dbSNP
rs761292017 466 dbSNP
rs1225623655 487 dbSNP
rs1372317633 491 dbSNP
rs999993007 501 dbSNP
rs968514424 502 dbSNP
rs565702252 503 dbSNP
rs1223308563 505 dbSNP
rs1271028331 511 dbSNP
rs374933271 524 dbSNP
rs534374241 524 dbSNP
rs1009973846 529 dbSNP
rs75384951 531 dbSNP
rs941314945 533 dbSNP
rs529154613 545 dbSNP
rs563571226 553 dbSNP
rs1311692179 556 dbSNP
rs773730605 558 dbSNP
rs1304405300 561 dbSNP
rs867486724 578 dbSNP
rs1432360486 583 dbSNP
rs908637277 588 dbSNP
rs767825503 594 dbSNP
rs982828173 600 dbSNP
rs1444814770 610 dbSNP
rs971631019 618 dbSNP
rs917389898 620 dbSNP
rs193197511 621 dbSNP
rs1418203406 624 dbSNP
rs1407704352 639 dbSNP
rs991777462 644 dbSNP
rs187474696 650 dbSNP
rs1439411934 661 dbSNP
rs1175849714 666 dbSNP
rs1484494364 668 dbSNP
rs149893654 674 dbSNP
rs1242196904 675 dbSNP
rs1444824016 683 dbSNP
rs183507966 684 dbSNP
rs752821516 694 dbSNP
rs538130901 697 dbSNP
rs1167919043 700 dbSNP
rs999825446 711 dbSNP
rs1288311526 715 dbSNP
rs1335106915 728 dbSNP
rs535270482 730 dbSNP
rs930779272 731 dbSNP
rs573297706 733 dbSNP
rs1317267376 738 dbSNP
rs115512007 740 dbSNP
rs753293903 744 dbSNP
rs1226780079 747 dbSNP
rs940783475 750 dbSNP
rs917292027 755 dbSNP
rs1198556627 769 dbSNP
rs549417499 773 dbSNP
rs1292563496 775 dbSNP
rs1412907588 782 dbSNP
rs1361879759 783 dbSNP
rs1427473535 784 dbSNP
rs1193251303 787 dbSNP
rs1374190676 787 dbSNP
rs1463941742 788 dbSNP
rs958615898 792 dbSNP
rs1174752116 795 dbSNP
rs1289007440 797 dbSNP
rs927173126 803 dbSNP
rs1339018939 806 dbSNP
rs140197300 807 dbSNP
rs1381769549 810 dbSNP
rs1296349081 812 dbSNP
rs1157319308 813 dbSNP
rs1328154010 822 dbSNP
rs1425960974 824 dbSNP
rs1419085637 827 dbSNP
rs1324090010 828 dbSNP
rs996000934 828 dbSNP
rs1474547315 832 dbSNP
rs968983357 842 dbSNP
rs557213685 843 dbSNP
rs537374458 856 dbSNP
rs577187758 859 dbSNP
rs557748001 869 dbSNP
rs941345973 872 dbSNP
rs1430819720 877 dbSNP
rs190913752 883 dbSNP
rs1224105665 892 dbSNP
rs57103486 899 dbSNP
rs1343692783 909 dbSNP
rs950157372 910 dbSNP
rs1289538513 919 dbSNP
rs185367313 923 dbSNP
rs1302538266 925 dbSNP
rs1346050300 933 dbSNP
rs1225161461 944 dbSNP
rs763582058 946 dbSNP
rs995083040 947 dbSNP
rs1381187032 960 dbSNP
rs899369678 964 dbSNP
rs1489674363 968 dbSNP
rs1036524663 983 dbSNP
rs1359384035 991 dbSNP
rs1294894028 996 dbSNP
rs940782184 1003 dbSNP
rs1202081795 1008 dbSNP
rs1395657198 1011 dbSNP
rs1418729145 1012 dbSNP
rs1164740786 1021 dbSNP
rs745756342 1023 dbSNP
rs535635796 1024 dbSNP
rs781309525 1044 dbSNP
rs569895037 1046 dbSNP
rs954634959 1048 dbSNP
rs1427958533 1052 dbSNP
rs979107752 1053 dbSNP
rs1372255777 1055 dbSNP
rs947320004 1057 dbSNP
rs1193118854 1065 dbSNP
rs1469124784 1066 dbSNP
rs1356795363 1068 dbSNP
rs550071782 1093 dbSNP
rs563309254 1108 dbSNP
rs533282906 1110 dbSNP
rs913090600 1111 dbSNP
rs557237500 1112 dbSNP
rs1231669456 1116 dbSNP
rs1251852926 1116 dbSNP
rs571511725 1118 dbSNP
rs1178119628 1119 dbSNP
rs1252981210 1120 dbSNP
rs965101688 1124 dbSNP
rs1442967435 1127 dbSNP
rs1037663630 1137 dbSNP
rs1004798042 1139 dbSNP
rs1426476574 1141 dbSNP
rs1019297983 1162 dbSNP
rs887128631 1168 dbSNP
rs1305237915 1172 dbSNP
rs1462349055 1181 dbSNP
rs1299638591 1186 dbSNP
rs1302849242 1189 dbSNP
rs1380160650 1195 dbSNP
rs114284204 1196 dbSNP
rs1315147810 1200 dbSNP
rs151081651 1202 dbSNP
rs1212282853 1207 dbSNP
rs895895224 1216 dbSNP
rs1307397913 1217 dbSNP
rs1026606266 1224 dbSNP
rs73594274 1225 dbSNP
rs1260345906 1230 dbSNP
rs1439202878 1232 dbSNP
rs1460165572 1236 dbSNP
rs937549400 1248 dbSNP
rs1243969316 1267 dbSNP
rs1473848191 1272 dbSNP
rs1184829822 1274 dbSNP
rs1418762489 1274 dbSNP
rs73594272 1278 dbSNP
rs1461972402 1292 dbSNP
rs1403556069 1294 dbSNP
rs1469099380 1299 dbSNP
rs1371400076 1311 dbSNP
rs1015512304 1312 dbSNP
rs1407818140 1322 dbSNP
rs1269043256 1342 dbSNP
rs979011808 1343 dbSNP
rs946284043 1347 dbSNP
rs142929953 1348 dbSNP
rs1175601363 1362 dbSNP
rs1005030012 1368 dbSNP
rs1444310281 1379 dbSNP
rs11993194 1381 dbSNP
rs74854827 1386 dbSNP
rs895919250 1391 dbSNP
rs1057264947 1394 dbSNP
rs1213771324 1397 dbSNP
rs778992271 1403 dbSNP
rs1241542396 1405 dbSNP
rs937389445 1406 dbSNP
rs1195843918 1414 dbSNP
rs1454827470 1415 dbSNP
rs905899253 1420 dbSNP
rs1480016922 1421 dbSNP
rs1176849530 1423 dbSNP
rs1431019679 1433 dbSNP
rs1398546653 1447 dbSNP
rs563560185 1450 dbSNP
rs1317041791 1476 dbSNP
rs1252631762 1479 dbSNP
rs1432279563 1480 dbSNP
rs987556481 1481 dbSNP
rs1300646832 1488 dbSNP
rs1344146334 1489 dbSNP
rs1043052288 1493 dbSNP
rs1029163561 1503 dbSNP
rs947299315 1504 dbSNP
rs1347422697 1514 dbSNP
rs1222219945 1516 dbSNP
rs913108972 1531 dbSNP
rs15584 1536 dbSNP
rs543672619 1542 dbSNP
rs989068060 1556 dbSNP
rs1195146178 1557 dbSNP
rs1218859070 1560 dbSNP
rs943844106 1561 dbSNP
rs1266736838 1573 dbSNP
rs912377692 1577 dbSNP
rs1479656353 1581 dbSNP
rs182635843 1582 dbSNP
rs953788245 1587 dbSNP
rs919594625 1588 dbSNP
rs1248183328 1589 dbSNP
rs1468288685 1596 dbSNP
rs973727835 1600 dbSNP
rs139723624 1609 dbSNP
rs1408243769 1609 dbSNP
rs755266261 1612 dbSNP
rs1364284707 1619 dbSNP
rs541017265 1620 dbSNP
rs1304144784 1637 dbSNP
rs1241930903 1639 dbSNP
rs1004691959 1643 dbSNP
rs1333122543 1646 dbSNP
rs1440454253 1651 dbSNP
rs1330048488 1662 dbSNP
rs1005126780 1680 dbSNP
rs199621845 1681 dbSNP
rs767723499 1691 dbSNP
rs960217756 1692 dbSNP
rs886367541 1694 dbSNP
rs1358662580 1698 dbSNP
rs1291935574 1705 dbSNP
rs1435920193 1708 dbSNP
rs1180791272 1712 dbSNP
rs745969739 1713 dbSNP
rs1233138688 1720 dbSNP
rs1441112715 1729 dbSNP
rs1035855218 1740 dbSNP
rs1001651634 1742 dbSNP
rs905912217 1744 dbSNP
rs1164408336 1748 dbSNP
rs1393489281 1768 dbSNP
rs1394601870 1770 dbSNP
rs1408613740 1778 dbSNP
rs1024857081 1787 dbSNP
rs1377957220 1792 dbSNP
rs1014671964 1795 dbSNP
rs1471314997 1797 dbSNP
rs1364157928 1800 dbSNP
rs571987335 1802 dbSNP
rs1043453428 1807 dbSNP
rs1267194893 1812 dbSNP
rs1337329641 1829 dbSNP
rs1195037350 1835 dbSNP
rs1056317018 1842 dbSNP
rs1417174507 1855 dbSNP
rs1011552661 1859 dbSNP
rs937413596 1875 dbSNP
rs904723623 1876 dbSNP
rs1444767920 1879 dbSNP
rs1188983584 1883 dbSNP
rs753838503 1884 dbSNP
rs1043224918 1889 dbSNP
rs1474686051 1889 dbSNP
rs1167714659 1890 dbSNP
rs1401398757 1890 dbSNP
rs1467511163 1891 dbSNP
rs1335043298 1892 dbSNP
rs1405590083 1895 dbSNP
rs1485045759 1899 dbSNP
rs1226530430 1904 dbSNP
rs1270555312 1905 dbSNP
rs1277644076 1907 dbSNP
rs946190565 1909 dbSNP
rs1221451719 1910 dbSNP
rs1262165610 1915 dbSNP
rs200260560 1922 dbSNP
rs891719089 1922 dbSNP
rs145284198 1923 dbSNP
rs1491080904 1923 dbSNP
rs555036795 1923 dbSNP
rs573586591 1923 dbSNP
rs987702825 1923 dbSNP
rs1491339905 1924 dbSNP
rs1280443789 1926 dbSNP
rs1238802527 1928 dbSNP
rs933022279 1930 dbSNP
rs146386822 1935 dbSNP
rs780132826 1938 dbSNP
rs1298795909 1940 dbSNP
rs974521188 1942 dbSNP
rs963139369 1949 dbSNP
rs943956888 1950 dbSNP
rs1282346096 1951 dbSNP
rs1311214886 1959 dbSNP
rs191182522 1965 dbSNP
rs1385963680 1974 dbSNP
rs983289412 1977 dbSNP
rs1460085884 1978 dbSNP
rs535566137 1981 dbSNP
rs781384987 1985 dbSNP
rs950490917 1988 dbSNP
rs1157733331 1989 dbSNP
rs1489531926 1997 dbSNP
rs1025349711 2010 dbSNP
rs1197737890 2010 dbSNP
rs1049518075 2013 dbSNP
rs1013495469 2016 dbSNP
rs932407669 2017 dbSNP
rs919664932 2039 dbSNP
rs1362263456 2051 dbSNP
rs960343265 2058 dbSNP
rs1451317964 2063 dbSNP
rs974160454 2066 dbSNP
rs1159288692 2070 dbSNP
rs1362402480 2075 dbSNP
rs1034336148 2081 dbSNP
rs961102275 2082 dbSNP
rs1474877880 2083 dbSNP
rs1368124236 2091 dbSNP
rs1388285754 2097 dbSNP
rs1304483861 2106 dbSNP
rs569831572 2109 dbSNP
rs1240274652 2120 dbSNP
rs1194707966 2123 dbSNP
rs1356481798 2159 dbSNP
rs1220816427 2161 dbSNP
rs1447166275 2163 dbSNP
rs1248724537 2169 dbSNP
rs1489044128 2169 dbSNP
rs1418674136 2177 dbSNP
rs983741669 2185 dbSNP
rs960268189 2188 dbSNP
rs1283153848 2195 dbSNP
rs1035866444 2200 dbSNP
rs1422821293 2214 dbSNP
rs1203054466 2215 dbSNP
rs1162919799 2225 dbSNP
rs868478737 2228 dbSNP
rs970566261 2238 dbSNP
rs1459290106 2239 dbSNP
rs904629914 2243 dbSNP
rs1043089290 2255 dbSNP
rs1010364939 2267 dbSNP
rs1310816289 2269 dbSNP
rs143948006 2276 dbSNP
rs1052481763 2297 dbSNP
rs1291454157 2302 dbSNP
rs1433008734 2318 dbSNP
rs1322817373 2321 dbSNP
rs1224270430 2322 dbSNP
rs1211120160 2328 dbSNP
rs539695406 2338 dbSNP
rs1199582886 2350 dbSNP
rs1240250422 2352 dbSNP
rs1442912627 2353 dbSNP
rs570720054 2358 dbSNP
rs1317878266 2363 dbSNP
rs921620886 2371 dbSNP
rs547413288 2374 dbSNP
rs1414490794 2375 dbSNP
rs1399234079 2381 dbSNP
rs1168073248 2383 dbSNP
rs1038730695 2389 dbSNP
rs891835447 2390 dbSNP
rs1333018926 2409 dbSNP
rs1396404314 2409 dbSNP
rs941641474 2410 dbSNP
rs908962953 2411 dbSNP
rs1128143 2423 dbSNP
rs1380548665 2449 dbSNP
rs1230461392 2450 dbSNP
rs1294056437 2451 dbSNP
rs1317759410 2453 dbSNP
rs1219613642 2464 dbSNP
rs1260285844 2467 dbSNP
rs950641967 2468 dbSNP
rs1238063987 2471 dbSNP
rs1484195551 2474 dbSNP
rs1184776818 2495 dbSNP
rs565970905 2507 dbSNP
rs146061083 2521 dbSNP
rs1478052913 2522 dbSNP
rs891003446 2525 dbSNP
rs1169099310 2527 dbSNP
rs762148598 2537 dbSNP
rs1172511669 2539 dbSNP
rs917744912 2541 dbSNP
rs529364009 2543 dbSNP
rs1428025981 2545 dbSNP
rs959336685 2545 dbSNP
rs992508851 2545 dbSNP
rs1287686355 2546 dbSNP
rs1340420915 2547 dbSNP
rs1321692566 2549 dbSNP
rs1401028925 2549 dbSNP
rs919743535 2549 dbSNP
rs1218803706 2557 dbSNP
rs186751574 2559 dbSNP
rs1128144 2561 dbSNP
rs1001498751 2563 dbSNP
rs1195594761 2563 dbSNP
rs1213706517 2563 dbSNP
rs1266423778 2563 dbSNP
rs1488553610 2563 dbSNP
rs533408251 2563 dbSNP
rs968652365 2563 dbSNP
rs1398487983 2565 dbSNP
rs1021705652 2566 dbSNP
rs564792112 2567 dbSNP
rs541395297 2568 dbSNP
rs1300442444 2570 dbSNP
rs149010925 2570 dbSNP
rs571978767 2570 dbSNP
rs1128145 2580 dbSNP
rs1289486395 2582 dbSNP
rs1199265274 2584 dbSNP
rs1248124432 2584 dbSNP
rs1450868726 2584 dbSNP
rs527794676 2584 dbSNP
rs1214721809 2586 dbSNP
rs775028637 2591 dbSNP
rs1161039438 2596 dbSNP
rs1389178775 2597 dbSNP
rs1405184328 2601 dbSNP
rs555416726 2601 dbSNP
rs1324574998 2611 dbSNP
rs943392721 2630 dbSNP
rs1440209139 2637 dbSNP
rs1308796919 2644 dbSNP
rs111796461 2645 dbSNP
rs998062513 2654 dbSNP
rs900759805 2660 dbSNP
rs181239887 2661 dbSNP
rs1210231718 2665 dbSNP
rs941715224 2679 dbSNP
rs1197701041 2682 dbSNP
rs1238396334 2682 dbSNP
rs1441056813 2687 dbSNP
rs1216877583 2688 dbSNP
rs565642508 2692 dbSNP
rs73594268 2697 dbSNP
rs1367269743 2698 dbSNP
rs956284604 2702 dbSNP
rs1164213890 2706 dbSNP
rs1416494941 2712 dbSNP
rs1031635908 2714 dbSNP
rs1464378506 2715 dbSNP
rs1008161074 2716 dbSNP
rs1330988988 2717 dbSNP
rs891057349 2722 dbSNP
rs578249712 2728 dbSNP
rs539632200 2733 dbSNP
rs189066516 2742 dbSNP
rs1373482666 2747 dbSNP
rs1449128053 2747 dbSNP
rs1047535811 2750 dbSNP
rs1339814901 2753 dbSNP
rs771052243 2758 dbSNP
rs1439932318 2761 dbSNP
rs185761470 2767 dbSNP
rs898366448 2768 dbSNP
rs1258353231 2771 dbSNP
rs1458788637 2773 dbSNP
rs992023682 2797 dbSNP
rs1254793655 2806 dbSNP
rs959427679 2814 dbSNP
rs554008934 2818 dbSNP
rs149581341 2819 dbSNP
rs979309567 2823 dbSNP
rs12549293 2834 dbSNP
rs939792043 2835 dbSNP
rs886817828 2846 dbSNP
rs181923527 2849 dbSNP
rs1467322076 2859 dbSNP
rs1170893811 2864 dbSNP
rs968727745 2868 dbSNP
rs1021560925 2872 dbSNP
rs868624994 2876 dbSNP
rs1336148066 2877 dbSNP
rs1338299257 2877 dbSNP
rs754869334 2879 dbSNP
rs1395331111 2882 dbSNP
rs926262704 2884 dbSNP
rs1319573215 2885 dbSNP
rs1221235126 2895 dbSNP
rs1468295052 2900 dbSNP
rs1030794683 2901 dbSNP
rs138228101 2902 dbSNP
rs1258913321 2906 dbSNP
rs1487565268 2925 dbSNP
rs1438903181 2928 dbSNP
rs1272305963 2938 dbSNP
rs900662159 2944 dbSNP
rs1226299467 2946 dbSNP
rs1479002885 2948 dbSNP
rs1017910718 2952 dbSNP
rs1377265779 2961 dbSNP
rs948978990 2962 dbSNP
rs749483529 2969 dbSNP
rs1174353369 2971 dbSNP
rs189171827 2979 dbSNP
rs1006461806 2982 dbSNP
rs1298588164 2985 dbSNP
rs887471512 2990 dbSNP
rs1300212513 3003 dbSNP
rs1384841820 3003 dbSNP
rs71256590 3007 dbSNP
rs990684062 3007 dbSNP
rs1283186675 3010 dbSNP
rs866624698 3011 dbSNP
rs1047442411 3033 dbSNP
rs1159230459 3033 dbSNP
rs1216601113 3033 dbSNP
rs1266983752 3033 dbSNP
rs1287357759 3033 dbSNP
rs1292679614 3033 dbSNP
rs1362344653 3033 dbSNP
rs1378486427 3033 dbSNP
rs1421982257 3033 dbSNP
rs1433937673 3033 dbSNP
rs1439161232 3033 dbSNP
rs1456225533 3033 dbSNP
rs1489506353 3033 dbSNP
rs1491398434 3033 dbSNP
rs34779318 3033 dbSNP
rs780726144 3033 dbSNP
rs78916786 3033 dbSNP
rs928941962 3033 dbSNP
rs1211926261 3034 dbSNP
rs1265170881 3034 dbSNP
rs1491537852 3034 dbSNP
rs1457402501 3035 dbSNP
rs956167757 3036 dbSNP
rs1179289640 3041 dbSNP
rs1382118997 3042 dbSNP
rs1368504307 3045 dbSNP
rs1163810070 3049 dbSNP
rs1056581636 3055 dbSNP
rs569813781 3064 dbSNP
rs549904689 3075 dbSNP
rs1299739749 3077 dbSNP
rs1031690022 3088 dbSNP
rs926454245 3096 dbSNP
rs184363858 3100 dbSNP
rs1446929286 3101 dbSNP
rs1332738549 3104 dbSNP
rs986837114 3110 dbSNP
rs1353877210 3112 dbSNP
rs979339219 3119 dbSNP
rs1322760053 3124 dbSNP
rs1326226415 3129 dbSNP
rs1235490599 3138 dbSNP
rs946620783 3139 dbSNP
rs535017497 3140 dbSNP
rs988833233 3152 dbSNP
rs1234604253 3161 dbSNP
rs956202856 3165 dbSNP
rs1375565885 3170 dbSNP
rs1028280702 3175 dbSNP
rs564546607 3177 dbSNP
rs548035549 3178 dbSNP
rs1016768028 3184 dbSNP
rs1168227359 3185 dbSNP
rs1004429235 3186 dbSNP
rs886869665 3187 dbSNP
rs1422503779 3191 dbSNP
rs976571877 3193 dbSNP
rs1179332524 3196 dbSNP
rs1470768532 3205 dbSNP
rs756129133 3216 dbSNP
rs964899892 3217 dbSNP
rs1056253308 3218 dbSNP
rs1417031900 3220 dbSNP
rs1203683156 3232 dbSNP
rs750558082 3234 dbSNP
rs1486679724 3243 dbSNP
rs939063371 3248 dbSNP
rs527985601 3250 dbSNP
rs1310674614 3262 dbSNP
rs1275358765 3268 dbSNP
rs888048248 3270 dbSNP
rs1209473709 3271 dbSNP
rs1308809507 3274 dbSNP
rs1256551897 3279 dbSNP
rs192814519 3280 dbSNP
rs1191256245 3283 dbSNP
rs781660993 3294 dbSNP
rs1478024389 3297 dbSNP
rs541841832 3298 dbSNP
rs189145171 3307 dbSNP
rs993185028 3307 dbSNP
rs1413442913 3310 dbSNP
rs765781388 3313 dbSNP
rs896131418 3314 dbSNP
rs566217755 3316 dbSNP
rs1416597836 3321 dbSNP
rs760429435 3326 dbSNP
rs1311747935 3327 dbSNP
rs35399547 3329 dbSNP
rs1365711661 3330 dbSNP
rs763258794 3332 dbSNP
rs924766686 3333 dbSNP
rs1218744934 3334 dbSNP
rs1346622555 3338 dbSNP
rs1043551986 3339 dbSNP
rs1214446869 3347 dbSNP
rs373584461 3348 dbSNP
rs1488523532 3373 dbSNP
rs986887736 3375 dbSNP
rs1443277292 3385 dbSNP
rs1401615835 3386 dbSNP
rs955447048 3395 dbSNP
rs1244643552 3413 dbSNP
rs545606262 3414 dbSNP
rs376776964 3415 dbSNP
rs1180629282 3417 dbSNP
rs574032791 3422 dbSNP
rs1396426667 3431 dbSNP
rs1437258222 3434 dbSNP
rs576943563 3436 dbSNP
rs553703507 3437 dbSNP
rs1187333200 3451 dbSNP
rs1017233910 3453 dbSNP
rs1320637308 3454 dbSNP
rs1348376505 3460 dbSNP
rs1435948872 3467 dbSNP
rs1004119793 3479 dbSNP
rs1262748732 3480 dbSNP
rs1238032087 3489 dbSNP
rs1216825539 3494 dbSNP
rs535539090 3502 dbSNP
rs1034848792 3505 dbSNP
rs185029334 3510 dbSNP
rs1356025493 3513 dbSNP
rs1292081439 3515 dbSNP
rs1456096340 3517 dbSNP
rs904904130 3519 dbSNP
rs1380252479 3529 dbSNP
rs569842145 3533 dbSNP
rs1010960969 3539 dbSNP
rs952157199 3542 dbSNP
rs191709893 3558 dbSNP
rs142003278 3562 dbSNP
rs775951300 3563 dbSNP
rs960425465 3571 dbSNP
rs74704997 3577 dbSNP
rs1055140415 3578 dbSNP
rs1396924901 3578 dbSNP
rs569950223 3588 dbSNP
rs1463424959 3594 dbSNP
rs1010731318 3603 dbSNP
rs934913936 3604 dbSNP
rs569750521 3609 dbSNP
rs1282340315 3622 dbSNP
rs1419242192 3625 dbSNP
rs371551847 3625 dbSNP
rs924818842 3627 dbSNP
rs776349593 3640 dbSNP
rs1051170342 3646 dbSNP
rs1228640398 3664 dbSNP
rs934077527 3666 dbSNP
rs1164251688 3668 dbSNP
rs1422102091 3669 dbSNP
rs1315633060 3674 dbSNP
rs77755202 3677 dbSNP
rs1238187380 3690 dbSNP
rs1187320241 3696 dbSNP
rs975452181 3697 dbSNP
rs963060650 3699 dbSNP
rs1472699306 3705 dbSNP
rs1485666581 3711 dbSNP
rs760638259 3721 dbSNP
rs539565030 3724 dbSNP
rs796226130 3727 dbSNP
rs1335350240 3741 dbSNP
rs983143751 3745 dbSNP
rs773050710 3750 dbSNP
rs1411706669 3752 dbSNP
rs1034853920 3753 dbSNP
rs1332154982 3758 dbSNP
rs1339761176 3759 dbSNP
rs1415191044 3765 dbSNP
rs867534607 3767 dbSNP
rs969140887 3776 dbSNP
rs1337976082 3777 dbSNP
rs1217714125 3785 dbSNP
rs771830041 3786 dbSNP
rs533193223 3791 dbSNP
rs1340926240 3800 dbSNP
rs1198199939 3814 dbSNP
rs910647550 3816 dbSNP
rs780308794 3821 dbSNP
rs770067254 3824 dbSNP
rs1260134696 3830 dbSNP
rs1052101764 3837 dbSNP
rs1362603720 3841 dbSNP
rs1193272915 3845 dbSNP
rs187587612 3851 dbSNP
rs547676438 3853 dbSNP
rs141248294 3856 dbSNP
rs1170841546 3865 dbSNP
rs1401431786 3868 dbSNP
rs78551271 3871 dbSNP
rs199583518 3872 dbSNP
rs34715615 3872 dbSNP
rs1491147046 3873 dbSNP
rs1358456321 3875 dbSNP
rs1327791539 3879 dbSNP
rs1399142930 3879 dbSNP
rs113113938 3889 dbSNP
rs972370542 3890 dbSNP
rs899984790 3898 dbSNP
rs146133083 3900 dbSNP
rs1212299528 3904 dbSNP
rs1283061513 3917 dbSNP
rs941452113 3919 dbSNP
rs142282793 3920 dbSNP
rs137856188 3929 dbSNP
rs929896689 3935 dbSNP
rs927838275 3936 dbSNP
rs969020945 3939 dbSNP
rs982012919 3960 dbSNP
rs1010595693 3962 dbSNP
rs1454756059 3971 dbSNP
rs969236316 3972 dbSNP
rs1023466597 3974 dbSNP
rs1418901355 3978 dbSNP
rs892329419 3995 dbSNP
rs545852984 3997 dbSNP
rs1386703252 3999 dbSNP
rs1384783694 4001 dbSNP
rs957779251 4005 dbSNP
rs1052713213 4010 dbSNP
rs1031084974 4011 dbSNP
rs1238792749 4018 dbSNP
rs576877485 4019 dbSNP
rs999121472 4020 dbSNP
rs943383656 4023 dbSNP
rs1208350648 4030 dbSNP
rs910552568 4033 dbSNP
rs1049196653 4034 dbSNP
rs1195536975 4040 dbSNP
rs1378432244 4042 dbSNP
rs903457305 4043 dbSNP
rs1029896785 4056 dbSNP
rs116659612 4068 dbSNP
rs1365378920 4075 dbSNP
rs900038830 4086 dbSNP
rs1456177557 4087 dbSNP
rs1481579921 4090 dbSNP
rs1394710736 4099 dbSNP
rs778148048 4102 dbSNP
rs941444581 4104 dbSNP
rs1375330927 4110 dbSNP
rs919318250 4112 dbSNP
rs1308325528 4119 dbSNP
rs1319159612 4121 dbSNP
rs888515513 4141 dbSNP
rs1272821528 4144 dbSNP
rs1335663429 4161 dbSNP
rs1226091532 4163 dbSNP
rs972658110 4168 dbSNP
rs540052474 4171 dbSNP
rs1234635010 4173 dbSNP
rs1236364746 4175 dbSNP
rs1457359984 4178 dbSNP
rs1177756893 4182 dbSNP
rs1213527211 4185 dbSNP
rs939493109 4201 dbSNP
rs1372168174 4203 dbSNP
rs771859102 4205 dbSNP
rs574334217 4216 dbSNP
rs929990115 4219 dbSNP
rs927933637 4231 dbSNP
rs532989741 4233 dbSNP
rs982065269 4237 dbSNP
rs1462034231 4241 dbSNP
rs936545313 4245 dbSNP
rs537777795 4251 dbSNP
rs1376115634 4257 dbSNP
rs947991661 4264 dbSNP
rs1394676907 4271 dbSNP
rs1293003873 4275 dbSNP
rs1356344174 4282 dbSNP
rs576000261 4285 dbSNP
rs956680164 4286 dbSNP
rs1307032049 4298 dbSNP
rs1205259832 4299 dbSNP
rs1253026406 4302 dbSNP
rs989287592 4311 dbSNP
rs1186960351 4336 dbSNP
rs1175739704 4337 dbSNP
rs1476059249 4345 dbSNP
rs1191130184 4346 dbSNP
rs1454919221 4348 dbSNP
rs958042617 4349 dbSNP
rs556291131 4353 dbSNP
rs539874016 4355 dbSNP
rs977795980 4358 dbSNP
rs570852039 4366 dbSNP
rs1464926798 4372 dbSNP
rs954400687 4381 dbSNP
rs1376492670 4392 dbSNP
rs1416975330 4394 dbSNP
rs554280536 4399 dbSNP
rs534113518 4440 dbSNP
rs1281917776 4460 dbSNP
rs998427765 4470 dbSNP
rs1049102614 4490 dbSNP
rs1346712761 4490 dbSNP
rs1280932533 4500 dbSNP
rs753064053 4502 dbSNP
rs1018877481 4503 dbSNP
rs1005689862 4508 dbSNP
rs897904780 4513 dbSNP
rs888600897 4514 dbSNP
rs939556128 4517 dbSNP
rs1453241998 4518 dbSNP
rs568695609 4521 dbSNP
rs1047202543 4522 dbSNP
rs1348701935 4523 dbSNP
rs1396164932 4526 dbSNP
rs35532005 4526 dbSNP
rs994252834 4531 dbSNP
rs1296674677 4533 dbSNP
rs1436990601 4533 dbSNP
rs1344835341 4536 dbSNP
rs1290839249 4546 dbSNP
rs1431834212 4546 dbSNP
rs906568807 4548 dbSNP
rs1365645767 4549 dbSNP
rs981020015 4551 dbSNP
rs948322117 4554 dbSNP
rs1237709951 4556 dbSNP
rs1283217607 4559 dbSNP
rs11782817 4569 dbSNP
rs1435509401 4578 dbSNP
rs764979900 4579 dbSNP
rs1317293695 4591 dbSNP
rs1217576091 4595 dbSNP
rs915470840 4601 dbSNP
rs1467660625 4605 dbSNP
rs79450965 4608 dbSNP
rs1254187674 4617 dbSNP
rs956366249 4617 dbSNP
rs1031202774 4622 dbSNP
rs916475448 4627 dbSNP
rs1054039257 4633 dbSNP
rs532063125 4640 dbSNP
rs965611263 4641 dbSNP
rs1471608565 4649 dbSNP
rs923756714 4650 dbSNP
rs1006697608 4651 dbSNP
rs1188071497 4657 dbSNP
rs888382205 4658 dbSNP
rs747324350 4672 dbSNP
rs1225216877 4677 dbSNP
rs867576581 4687 dbSNP
rs1276030621 4688 dbSNP
rs977849880 4689 dbSNP
rs1353265266 4696 dbSNP
rs1274578343 4700 dbSNP
rs995252475 4706 dbSNP
rs1180348030 4712 dbSNP
rs954452872 4721 dbSNP
rs922948101 4725 dbSNP
rs1261746357 4731 dbSNP
rs1470735895 4733 dbSNP
rs568833676 4734 dbSNP
rs1228243768 4755 dbSNP
rs1415973837 4757 dbSNP
rs1327715098 4760 dbSNP
rs182900997 4764 dbSNP
rs1396860713 4783 dbSNP
rs780271719 4785 dbSNP
rs1006200565 4790 dbSNP
rs952950781 4793 dbSNP
rs1025811784 4797 dbSNP
rs753565381 4801 dbSNP
rs1384196945 4802 dbSNP
rs948185578 4809 dbSNP
rs906578879 4812 dbSNP
rs192540765 4815 dbSNP
rs1294720016 4817 dbSNP
rs113398485 4832 dbSNP
rs895123214 4839 dbSNP
rs540358839 4842 dbSNP
rs936581154 4843 dbSNP
rs923611766 4848 dbSNP
rs1419974199 4850 dbSNP
rs1475079463 4851 dbSNP
rs1188984572 4862 dbSNP
rs923808955 4873 dbSNP
rs1472163494 4877 dbSNP
rs1167344210 4888 dbSNP
rs145504313 4913 dbSNP
rs1411656045 4916 dbSNP
rs1310979252 4921 dbSNP
rs1194872449 4927 dbSNP
rs910948544 4930 dbSNP
rs1248969801 4932 dbSNP
rs372205271 4932 dbSNP
rs1337900747 4933 dbSNP
rs933073779 4943 dbSNP
rs760262413 4947 dbSNP
rs952488128 4956 dbSNP
rs1216892221 4959 dbSNP
rs1278789236 4962 dbSNP
rs528395419 4975 dbSNP
rs964433135 4976 dbSNP
rs1259888350 4978 dbSNP
rs1445424325 4982 dbSNP
rs1192736004 4985 dbSNP
rs367921968 4987 dbSNP
rs75301082 4993 dbSNP
rs1355720285 4997 dbSNP
rs1476419685 5002 dbSNP
rs73594266 5003 dbSNP
rs1025823028 5009 dbSNP
rs1314424133 5016 dbSNP
rs1229806414 5023 dbSNP
rs187682830 5024 dbSNP
rs778648434 5027 dbSNP
rs1438041938 5032 dbSNP
rs1301907156 5042 dbSNP
rs970812981 5050 dbSNP
rs1045094923 5053 dbSNP
rs1025091272 5061 dbSNP
rs1432594993 5066 dbSNP
rs1204825499 5071 dbSNP
rs893974314 5072 dbSNP
rs1326478229 5080 dbSNP
rs1191776059 5081 dbSNP
rs1404760395 5086 dbSNP
rs1454607992 5086 dbSNP
rs1054468479 5088 dbSNP
rs1361911652 5091 dbSNP
rs528977109 5093 dbSNP
rs1169155388 5100 dbSNP
rs935582753 5101 dbSNP
rs1386634301 5108 dbSNP
rs895186009 5109 dbSNP
rs1324555568 5121 dbSNP
rs1371080474 5126 dbSNP
rs868349376 5127 dbSNP
rs1000796578 5132 dbSNP
rs1442352323 5143 dbSNP
rs1389202710 5147 dbSNP
rs754956276 5150 dbSNP
rs1238730207 5157 dbSNP
rs902398618 5158 dbSNP
rs1261550166 5159 dbSNP
rs1448022548 5162 dbSNP
rs924159129 5174 dbSNP
rs1222949309 5176 dbSNP
rs1042216176 5180 dbSNP
rs1195480869 5181 dbSNP
rs1248291277 5186 dbSNP
rs1418320563 5188 dbSNP
rs1287748907 5189 dbSNP
rs1040732796 5195 dbSNP
rs1365185525 5196 dbSNP
rs933184897 5197 dbSNP
rs1163739364 5208 dbSNP
rs1394644425 5219 dbSNP
rs1462530076 5224 dbSNP
rs901666844 5236 dbSNP
rs1038823120 5246 dbSNP
rs1343010890 5255 dbSNP
rs1295833197 5259 dbSNP
rs943645179 5262 dbSNP
rs943106635 5265 dbSNP
rs1391193599 5266 dbSNP
rs1308073757 5267 dbSNP
rs1297109290 5268 dbSNP
rs910979770 5269 dbSNP
rs1352170030 5276 dbSNP
rs1297641518 5290 dbSNP
rs985197243 5291 dbSNP
rs1249571156 5292 dbSNP
rs1226537167 5300 dbSNP
rs1196300144 5304 dbSNP
rs908888276 5307 dbSNP
rs745671816 5308 dbSNP
rs984826017 5323 dbSNP
rs1372896054 5331 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUUAAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUUAAAUAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUUAAAUAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUUAAAUAAUAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000316981.3 | 3UTR | AUUUAAAAUAUUAAUUUGCUGCUAAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.73 3.8e-5 -0.608 1.0e-3 23 Click to see details
GSE21687 Ependynoma primary tumors 0.365 1.5e-3 0.325 4.4e-3 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.571 4.3e-3 0.653 9.0e-4 20 Click to see details
GSE32688 Pancreatic cancer 0.335 3.0e-2 0.440 5.9e-3 32 Click to see details
GSE17498 Multiple myeloma -0.297 3.1e-2 -0.163 1.6e-1 40 Click to see details
GSE21849 B cell lymphoma 0.314 4.9e-2 0.476 4.5e-3 29 Click to see details
GSE28544 Breast cancer -0.329 5.8e-2 -0.347 4.8e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.271 1.2e-1 0.424 3.1e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.131 1.2e-1 -0.053 3.2e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.238 1.3e-1 -0.224 1.5e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.209 1.6e-1 0.259 1.1e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.103 1.7e-1 -0.172 5.3e-2 90 Click to see details
GSE38226 Liver fibrosis -0.165 2.4e-1 0.061 4.0e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.137 3.1e-1 0.024 4.6e-1 16 Click to see details
GSE19536 Breast cancer -0.037 3.6e-1 0.078 2.2e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.104 3.7e-1 -0.077 4.0e-1 13 Click to see details
GSE17306 Multiple myeloma -0.047 3.7e-1 0.023 4.4e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.079 4.0e-1 -0.399 9.9e-2 12 Click to see details
GSE21032 Prostate cancer 0.005 4.8e-1 -0.012 4.6e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.004 4.9e-1 -0.032 4.4e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.004 4.9e-1 -0.032 4.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.352 0.01 -0.398 0 42 Click to see details
STAD 0.301 0.05 0.362 0.02 32 Click to see details
THCA 0.204 0.06 0.082 0.27 59 Click to see details
PCPG -0.979 0.07 -1.000 0.5 3 Click to see details
PAAD 0.855 0.07 0.400 0.3 4 Click to see details
COAD -0.536 0.09 -0.762 0.01 8 Click to see details
LIHC 0.189 0.1 0.175 0.11 49 Click to see details
KIRC -0.156 0.1 -0.122 0.16 68 Click to see details
UCEC -0.292 0.11 -0.226 0.18 19 Click to see details
ESCA -0.35 0.15 -0.355 0.14 11 Click to see details
LUAD -0.27 0.2 -0.245 0.22 12 Click to see details
LUSC -0.128 0.22 -0.038 0.41 38 Click to see details
CESC -0.764 0.22 -0.500 0.33 3 Click to see details
KIRP -0.135 0.23 -0.169 0.18 32 Click to see details
BLCA -0.14 0.29 -0.135 0.3 18 Click to see details
BRCA 0.047 0.34 0.048 0.33 84 Click to see details
CHOL -0.146 0.35 -0.100 0.4 9 Click to see details
PRAD -0.026 0.43 -0.054 0.35 50 Click to see details
KICH 0 0.5 -0.024 0.45 25 Click to see details
KICH 0 0.5 -0.024 0.45 25 Click to see details
KICH 0 0.5 -0.024 0.45 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1