Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT505930 [miRNA, hsa-miR-15a-5p :: RCAN3, target gene]
miRTarBase - #MIRT505930 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RCAN3   
Synonyms DSCR1L2, MCIP3, RCN3, hRCN3
Description RCAN family member 3
Transcript NM_013441   
Expression
Putative miRNA Targets on RCAN3
3'UTR of RCAN3
(miRNA target sites are highlighted)
>RCAN3|NM_013441|3'UTR
   1 GGCCCTTGGTTGTGGTGCGAGGCGGCTGCCCTGGTGGGCTCTGGCCATGGCGCTCTGTGCCTGCGGCCGATGCGTTGCTG
  81 CGAACAGCATAGGTGAGACTCTGCCGAGTGAGGTATAGGTCTTCTCACCACGCCTGTACTGCAGACACGGTCGTGTAGAG
 161 TAGCAGCTGATTTGACCTGTCCCAGATTTTAAGTGATATTCCAAAAGGGACTTTACATTAAAGGAGAAGCCCCCAAGATG
 241 TGGCCACCCTTAACCATTTTTAAATAGTAACAAATTAGGAAAACAGCTCCCCTCCCCTCCAGCCATGTAAGTCCTCCTGA
 321 TTCTGTATCACATGAGACACCAAAAACTGGAAATGTAGTCACACCCAGTACAGTACCATTTTTATGAATTTAAAAATAGT
 401 CTTATAATTTTAATTGTTTGTGGGTATTTTTCTACTGGTATAAATAGCTTCTAATTAATAAATCGATCAAAGGTTGTTAC
 481 TCAGTATACATGAAATTTTTTGCAGGAAAAGAAACCAGAAATACAGAATAATTCATAGAAATCATGGTTCTCAAGTATTT
 561 GTTCAATTAGCTTTGGGGAAGAAATGCCAAATCCACTTTGAGGATGAGTCTTACGACACAGATCCACCCACATGTTGCTC
 641 TTATCTGGAATTTGGGACAAAGCAATGCACAGGCCCTCATTCCTGATGTGGCGCCCTCCAGACATGGCTGCCCAGGAAGG
 721 ACGGCCACTTTAGAAGTGGGACGTATCACCAGTAAGCTTGAATGATTAGGATCGCAGGTGGCTACTGCATTCTGCCGTTC
 801 GTGACCGTGTTCTAGCCTGTAGACCACCCAGCTACCTTCATTCACCAGTTTTTATCCTTCACCTTTTCCAGTATCTTGTT
 881 AACCACTAGTTCTTGAGTTTTTTGGCTATGATGTGTACGTTTATGTATGTCATTCATGGACTTTCAACTAGAAAAGGTAA
 961 TGATAAGGTTTTCTGAAGACCATTTGTAAATTGTCCATTTAACCATTTTTCAGCTTGCTTTGAAACAAAAGTCACACCTA
1041 CTATTTTTCTATGAATTAGGGAATGAGGGGGAGATCATTCAGTTTTACTTTTCTTTTTGTTGAAATTTTGTACCCGGATT
1121 GCAGTTGGCACTTTTCCTAAAACAGAATTGTTTCCCACTTAGGTGTCAGAATGTACCTTTGAACTTCCCTAAGAAGCAGC
1201 AGGATCTTTTTAACTCTCTCTGGTCTGTTTAGACTTTGAAGTCCCTTCTGTAGAAAAGTCTCATAACTGAGAAGGCTCTG
1281 TTTTGGGCCGGGTGGGTCTGCTGGCCTCCACTCACTGTGCTGTTTCCTTTGAGTGGCACACTTGGGAAGCTCCGGGGCAT
1361 GTGAAGGAGCTGCAAACATGAGAACTAATGAACCAAGGCGGCTGCCACCAGGAAGGAACAGAACGCAGGCATTCAACCAT
1441 GACGTCTGCACAGTGTTAGTAACATGTCATTGTGGTTTCGTTCTCACTGTGGTAAAATTTATTTCTGAGCACTTAAACTG
1521 TGTTGCATACCCCTAATTTTTTTTTTTTCTGTATCTTCCTTGCCCTCAAATACCCTGAGGTGATAAACTGTTCCAGTTGT
1601 AGCCAACTACCACTGCTAGGCCTCAATGTAAATTCAGTTGAAATTTGCAATTCTATCAGCAATTTAATGTATTGAATTCA
1681 GATCATCATTTGTCATTTTAACCGACAACCACCCAATAAATTTACTCTGCAGTTCTGAACTCAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGU-AAU-ACACGACGAu 5'
                ||| | | |||||||:| 
Target 5' tggcctCCACTCACTGTGCTGTTt 3'
1302 - 1325 140.00 -12.90
2
miRNA  3' guGUUU-GGU-AAUACACGACGAu 5'
            ||:| |||   |  ||:|||| 
Target 5' caCAGATCCACCCACATGTTGCTc 3'
617 - 640 132.00 -13.50
3
miRNA  3' guguUUGGUAAUAC-ACGACGau 5'
              ::||: |: | ||||||  
Target 5' ctgcGGCCGATGCGTTGCTGCga 3'
61 - 83 130.00 -14.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN32067911 2 COSMIC
COSN26557080 9 COSMIC
COSN31561920 15 COSMIC
COSN13533798 19 COSMIC
COSN30161524 24 COSMIC
COSN26991843 36 COSMIC
COSN30506179 53 COSMIC
COSN30501675 70 COSMIC
COSN30158952 81 COSMIC
COSN30132428 82 COSMIC
COSN30161379 107 COSMIC
COSN18714683 114 COSMIC
COSN30120039 117 COSMIC
COSN30450526 120 COSMIC
COSN26436915 133 COSMIC
COSN32062871 139 COSMIC
COSN32062872 142 COSMIC
COSN27910628 406 COSMIC
COSN30004371 621 COSMIC
COSN5370325 834 COSMIC
COSN6032427 1363 COSMIC
COSN1101801 1549 COSMIC
COSN30755892 1808 COSMIC
COSN15566452 1813 COSMIC
COSN27499551 2002 COSMIC
COSN29081223 2002 COSMIC
COSN6450978 2242 COSMIC
COSN20982902 2257 COSMIC
COSN7215267 2293 COSMIC
COSN15338359 2812 COSMIC
COSN6450980 3274 COSMIC
COSN18777668 3315 COSMIC
COSN7215272 3327 COSMIC
COSN16902749 3434 COSMIC
COSN30638813 3901 COSMIC
COSN16129171 4126 COSMIC
COSN30568291 4137 COSMIC
COSN15734964 4243 COSMIC
COSN30644234 4307 COSMIC
COSN7989509 4308 COSMIC
COSN30722601 4573 COSMIC
COSN4749815 4645 COSMIC
COSN24370264 4656 COSMIC
COSN15857095 5592 COSMIC
COSN29095832 5623 COSMIC
COSN1101802 5687 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777362864 4 dbSNP
rs571999692 9 dbSNP
rs1429929038 11 dbSNP
rs760591245 12 dbSNP
rs16829816 15 dbSNP
rs778976370 18 dbSNP
rs745350068 19 dbSNP
rs771660919 20 dbSNP
rs1226693031 22 dbSNP
rs1274292013 23 dbSNP
rs1343299250 24 dbSNP
rs775172343 27 dbSNP
rs370329021 28 dbSNP
rs1242284068 29 dbSNP
rs764104917 29 dbSNP
rs1283353646 32 dbSNP
rs200892703 33 dbSNP
rs776849767 38 dbSNP
rs1274895304 39 dbSNP
rs762309286 40 dbSNP
rs765634624 41 dbSNP
rs377352584 42 dbSNP
rs773814023 46 dbSNP
rs763470619 48 dbSNP
rs766402676 52 dbSNP
rs576140088 53 dbSNP
rs1263346939 63 dbSNP
rs897678312 66 dbSNP
rs1186459696 68 dbSNP
rs192837118 69 dbSNP
rs994753677 71 dbSNP
rs1022548334 74 dbSNP
rs1157311135 75 dbSNP
rs1449889968 75 dbSNP
rs1380237458 78 dbSNP
rs563084681 81 dbSNP
rs1315481972 82 dbSNP
rs968287613 83 dbSNP
rs1237902332 87 dbSNP
rs1007516271 91 dbSNP
rs1340843530 93 dbSNP
rs1018949214 99 dbSNP
rs966111316 102 dbSNP
rs977967866 106 dbSNP
rs1261947289 107 dbSNP
rs1342332221 114 dbSNP
rs1199521704 115 dbSNP
rs1256427311 117 dbSNP
rs924785046 119 dbSNP
rs1177179198 128 dbSNP
rs957800119 130 dbSNP
rs1440811932 133 dbSNP
rs980971393 138 dbSNP
rs1375988354 139 dbSNP
rs1465668458 147 dbSNP
rs1173315825 149 dbSNP
rs1408593109 150 dbSNP
rs1200083429 153 dbSNP
rs1276840539 158 dbSNP
rs574966616 170 dbSNP
rs1444356151 171 dbSNP
rs926763847 172 dbSNP
rs778315093 181 dbSNP
rs1309141214 194 dbSNP
rs916167551 200 dbSNP
rs1237985574 208 dbSNP
rs947667618 212 dbSNP
rs992273747 214 dbSNP
rs919305763 215 dbSNP
rs185324356 228 dbSNP
rs781601636 231 dbSNP
rs746063017 232 dbSNP
rs770012911 233 dbSNP
rs995120485 235 dbSNP
rs1415855369 237 dbSNP
rs909840323 238 dbSNP
rs1048933489 247 dbSNP
rs1337096590 249 dbSNP
rs370289589 255 dbSNP
rs1007488448 257 dbSNP
rs1444436533 266 dbSNP
rs1018921236 268 dbSNP
rs1039537645 269 dbSNP
rs1462308142 274 dbSNP
rs1333357978 286 dbSNP
rs527750884 287 dbSNP
rs901876131 291 dbSNP
rs1336408115 295 dbSNP
rs1232545730 296 dbSNP
rs899695658 297 dbSNP
rs1273156543 300 dbSNP
rs1347346178 306 dbSNP
rs998937215 310 dbSNP
rs1216403577 312 dbSNP
rs1224376263 323 dbSNP
rs1277257225 331 dbSNP
rs1318961372 333 dbSNP
rs1032206913 334 dbSNP
rs771401413 341 dbSNP
rs187700768 350 dbSNP
rs990731391 355 dbSNP
rs1211003527 357 dbSNP
rs564119166 364 dbSNP
rs1023192645 369 dbSNP
rs1193131537 373 dbSNP
rs1424621811 398 dbSNP
rs1456770269 403 dbSNP
rs1201061031 405 dbSNP
rs1172304610 414 dbSNP
rs1347940760 417 dbSNP
rs867284795 421 dbSNP
rs1457321672 432 dbSNP
rs1303745516 439 dbSNP
rs1050873692 441 dbSNP
rs1251800701 447 dbSNP
rs892173010 448 dbSNP
rs1009276233 465 dbSNP
rs1297142365 466 dbSNP
rs1362252686 473 dbSNP
rs1216651872 516 dbSNP
rs192687395 527 dbSNP
rs968317064 529 dbSNP
rs1002436962 532 dbSNP
rs550043712 539 dbSNP
rs1246156379 545 dbSNP
rs927599500 559 dbSNP
rs149949714 562 dbSNP
rs1375452658 570 dbSNP
rs529192001 577 dbSNP
rs1216013428 579 dbSNP
rs781031400 587 dbSNP
rs960875639 594 dbSNP
rs1180385232 595 dbSNP
rs1411337987 596 dbSNP
rs919007061 615 dbSNP
rs1384726451 621 dbSNP
rs930462183 630 dbSNP
rs992701853 633 dbSNP
rs1422647812 634 dbSNP
rs1048896118 635 dbSNP
rs1157561847 636 dbSNP
rs74060398 641 dbSNP
rs950859095 645 dbSNP
rs1040297984 647 dbSNP
rs901835981 659 dbSNP
rs1453853618 669 dbSNP
rs1317717025 671 dbSNP
rs1352190247 674 dbSNP
rs1386169779 684 dbSNP
rs775669472 688 dbSNP
rs1240108839 689 dbSNP
rs1321615837 690 dbSNP
rs984842449 693 dbSNP
rs909199421 694 dbSNP
rs34205009 699 dbSNP
rs559101498 703 dbSNP
rs1023120302 706 dbSNP
rs1220776083 710 dbSNP
rs1437715497 711 dbSNP
rs386629591 711 dbSNP
rs773009703 711 dbSNP
rs921145936 714 dbSNP
rs760586545 716 dbSNP
rs766132124 720 dbSNP
rs1356207044 722 dbSNP
rs183746260 723 dbSNP
rs1264621152 724 dbSNP
rs1490715493 725 dbSNP
rs1199676589 726 dbSNP
rs1051369905 727 dbSNP
rs892250853 728 dbSNP
rs1339066091 729 dbSNP
rs1375204058 737 dbSNP
rs981680611 738 dbSNP
rs1446676104 740 dbSNP
rs569664497 743 dbSNP
rs1043434247 744 dbSNP
rs960365737 746 dbSNP
rs903537776 754 dbSNP
rs1195011143 768 dbSNP
rs1177929832 775 dbSNP
rs867551812 781 dbSNP
rs972150160 786 dbSNP
rs1470851417 790 dbSNP
rs1001839700 793 dbSNP
rs1373453024 794 dbSNP
rs918986649 797 dbSNP
rs1033936921 798 dbSNP
rs984530353 799 dbSNP
rs749184737 801 dbSNP
rs1367516656 805 dbSNP
rs1330075776 806 dbSNP
rs1425316430 807 dbSNP
rs896699618 808 dbSNP
rs1434347868 810 dbSNP
rs1013792767 823 dbSNP
rs1274300831 823 dbSNP
rs768595542 826 dbSNP
rs1276619491 835 dbSNP
rs1315767587 836 dbSNP
rs1195028816 841 dbSNP
rs536688765 847 dbSNP
rs1439455158 849 dbSNP
rs555348616 855 dbSNP
rs1402107697 871 dbSNP
rs1267540336 876 dbSNP
rs196433 877 dbSNP
rs196434 883 dbSNP
rs1243243520 884 dbSNP
rs1477672638 887 dbSNP
rs1168886890 898 dbSNP
rs145068311 899 dbSNP
rs767300053 909 dbSNP
rs1366273427 910 dbSNP
rs540451363 912 dbSNP
rs1296525148 916 dbSNP
rs1340157361 919 dbSNP
rs1053547026 920 dbSNP
rs1226529877 943 dbSNP
rs1290951828 949 dbSNP
rs1490353396 953 dbSNP
rs1224102765 968 dbSNP
rs6669881 983 dbSNP
rs1446036072 992 dbSNP
rs1193515499 1001 dbSNP
rs1244184944 1004 dbSNP
rs1222494716 1006 dbSNP
rs1472054827 1006 dbSNP
rs964690404 1010 dbSNP
rs1284724717 1011 dbSNP
rs759748802 1029 dbSNP
rs1487074809 1040 dbSNP
rs1426580436 1041 dbSNP
rs1156893016 1044 dbSNP
rs1360031830 1051 dbSNP
rs974675817 1052 dbSNP
rs544532452 1067 dbSNP
rs141147116 1069 dbSNP
rs1445558266 1070 dbSNP
rs1314235982 1076 dbSNP
rs906026471 1082 dbSNP
rs1248134150 1092 dbSNP
rs921222456 1099 dbSNP
rs1283236336 1100 dbSNP
rs1349407131 1103 dbSNP
rs1205353291 1106 dbSNP
rs188415375 1107 dbSNP
rs1035915134 1111 dbSNP
rs1183397545 1114 dbSNP
rs1423089555 1115 dbSNP
rs1185160644 1116 dbSNP
rs1244171526 1117 dbSNP
rs1446946783 1118 dbSNP
rs1177374423 1120 dbSNP
rs961944933 1124 dbSNP
rs1454378162 1126 dbSNP
rs993157490 1138 dbSNP
rs1386945693 1140 dbSNP
rs1026383331 1144 dbSNP
rs986682130 1146 dbSNP
rs765238556 1150 dbSNP
rs945205054 1151 dbSNP
rs1158077089 1161 dbSNP
rs1307086133 1171 dbSNP
rs752784214 1172 dbSNP
rs903568919 1173 dbSNP
rs531704600 1174 dbSNP
rs937662937 1179 dbSNP
rs1455516770 1184 dbSNP
rs1054793091 1189 dbSNP
rs1262081290 1198 dbSNP
rs1289743447 1204 dbSNP
rs896768347 1205 dbSNP
rs1264124251 1211 dbSNP
rs910341922 1214 dbSNP
rs1014240657 1217 dbSNP
rs1401921531 1218 dbSNP
rs1394588872 1219 dbSNP
rs1419698036 1223 dbSNP
rs1026545052 1233 dbSNP
rs1376036815 1246 dbSNP
rs886620164 1253 dbSNP
rs1177496778 1266 dbSNP
rs543405197 1274 dbSNP
rs1006312074 1276 dbSNP
rs1315273268 1277 dbSNP
rs1406542543 1281 dbSNP
rs562135790 1284 dbSNP
rs1384127224 1289 dbSNP
rs1016305262 1290 dbSNP
rs923189057 1291 dbSNP
rs1391932660 1308 dbSNP
rs1307868593 1309 dbSNP
rs529142924 1315 dbSNP
rs934554239 1327 dbSNP
rs964764494 1328 dbSNP
rs1350916586 1329 dbSNP
rs1053068904 1334 dbSNP
rs914547502 1341 dbSNP
rs996169428 1351 dbSNP
rs144975241 1354 dbSNP
rs1044456756 1360 dbSNP
rs1200327087 1363 dbSNP
rs1431741376 1366 dbSNP
rs905957847 1367 dbSNP
rs1003014996 1376 dbSNP
rs955342654 1379 dbSNP
rs1462417780 1397 dbSNP
rs987138914 1400 dbSNP
rs1363090967 1401 dbSNP
rs913789322 1402 dbSNP
rs758852452 1403 dbSNP
rs1303329046 1410 dbSNP
rs764747043 1421 dbSNP
rs1378549828 1422 dbSNP
rs979218318 1425 dbSNP
rs1295280625 1431 dbSNP
rs1421014077 1434 dbSNP
rs994814621 1437 dbSNP
rs1264212921 1439 dbSNP
rs1159936592 1444 dbSNP
rs925063790 1445 dbSNP
rs1271273614 1448 dbSNP
rs1487416453 1449 dbSNP
rs1186203736 1454 dbSNP
rs1351143694 1454 dbSNP
rs951713088 1467 dbSNP
rs1428897657 1478 dbSNP
rs373388511 1480 dbSNP
rs937736245 1481 dbSNP
rs1005844918 1492 dbSNP
rs1017279278 1493 dbSNP
rs1339049140 1495 dbSNP
rs1366953522 1496 dbSNP
rs1054824224 1512 dbSNP
rs11231 1519 dbSNP
rs1363011455 1520 dbSNP
rs1329996931 1531 dbSNP
rs1384291619 1532 dbSNP
rs1313500002 1533 dbSNP
rs1382742259 1537 dbSNP
rs551491607 1537 dbSNP
rs562742841 1537 dbSNP
rs57546483 1537 dbSNP
rs879001875 1537 dbSNP
rs1351680517 1549 dbSNP
rs1376183210 1549 dbSNP
rs1224901447 1550 dbSNP
rs1307125988 1551 dbSNP
rs1311200878 1552 dbSNP
rs1486043711 1553 dbSNP
rs923083289 1554 dbSNP
rs1241082653 1555 dbSNP
rs1264740113 1556 dbSNP
rs1324096749 1558 dbSNP
rs1197924858 1559 dbSNP
rs949053434 1568 dbSNP
rs1236223786 1569 dbSNP
rs58642905 1575 dbSNP
rs886655135 1576 dbSNP
rs1386553413 1586 dbSNP
rs1398457603 1596 dbSNP
rs1157846259 1607 dbSNP
rs1006384369 1612 dbSNP
rs1345447349 1629 dbSNP
rs1037829014 1635 dbSNP
rs900626568 1636 dbSNP
rs1266785720 1649 dbSNP
rs1335108223 1656 dbSNP
rs914496034 1658 dbSNP
rs1453981151 1659 dbSNP
rs1431632425 1663 dbSNP
rs996200582 1670 dbSNP
rs1307930017 1672 dbSNP
rs149969709 1682 dbSNP
rs537150399 1696 dbSNP
rs757685834 1704 dbSNP
rs1460760001 1707 dbSNP
rs1055703 1712 dbSNP
rs1057247785 1713 dbSNP
rs1356748647 1715 dbSNP
rs745518582 1723 dbSNP
rs1468117102 1729 dbSNP
rs1021291739 1738 dbSNP
rs1176161438 1740 dbSNP
rs1298230232 1748 dbSNP
rs1366342927 1756 dbSNP
rs1420484246 1757 dbSNP
rs10489444 1764 dbSNP
rs1405719717 1769 dbSNP
rs1470512947 1770 dbSNP
rs1284871845 1778 dbSNP
rs779459482 1782 dbSNP
rs1353300044 1784 dbSNP
rs925093557 1790 dbSNP
rs756336272 1794 dbSNP
rs1270657789 1796 dbSNP
rs535753797 1798 dbSNP
rs554092285 1805 dbSNP
rs1309130636 1808 dbSNP
rs965756450 1808 dbSNP
rs768128630 1809 dbSNP
rs917641923 1834 dbSNP
rs1322496317 1835 dbSNP
rs949075271 1845 dbSNP
rs774308593 1851 dbSNP
rs748068432 1853 dbSNP
rs1454663594 1869 dbSNP
rs1194266017 1873 dbSNP
rs1487584552 1873 dbSNP
rs1203795731 1883 dbSNP
rs908156420 1895 dbSNP
rs1201843360 1917 dbSNP
rs1269787909 1927 dbSNP
rs1477636694 1936 dbSNP
rs1196759803 1940 dbSNP
rs1030119439 1941 dbSNP
rs997665294 1941 dbSNP
rs1191896576 1944 dbSNP
rs1417875434 1947 dbSNP
rs956024620 1954 dbSNP
rs572298487 1970 dbSNP
rs1356286472 1972 dbSNP
rs988667883 1984 dbSNP
rs1302730761 1990 dbSNP
rs1273638786 1992 dbSNP
rs140283356 1992 dbSNP
rs370366780 1992 dbSNP
rs1422158575 1993 dbSNP
rs181206916 1994 dbSNP
rs1410990232 1997 dbSNP
rs1164780630 2001 dbSNP
rs1490405183 2003 dbSNP
rs56222283 2005 dbSNP
rs1422156464 2006 dbSNP
rs55996726 2007 dbSNP
rs1240715426 2008 dbSNP
rs557935833 2014 dbSNP
rs1168940760 2015 dbSNP
rs1422302965 2016 dbSNP
rs1422780986 2018 dbSNP
rs1162977971 2019 dbSNP
rs1366331311 2022 dbSNP
rs1426778590 2028 dbSNP
rs35931233 2032 dbSNP
rs536518341 2035 dbSNP
rs1316498508 2036 dbSNP
rs996270703 2041 dbSNP
rs553005110 2047 dbSNP
rs890504288 2049 dbSNP
rs938700321 2050 dbSNP
rs1290382001 2055 dbSNP
rs1359615992 2058 dbSNP
rs1211196674 2064 dbSNP
rs1281716938 2067 dbSNP
rs1010689532 2069 dbSNP
rs772996050 2071 dbSNP
rs993320728 2074 dbSNP
rs1194385554 2078 dbSNP
rs566627158 2087 dbSNP
rs1443304207 2097 dbSNP
rs1363860603 2100 dbSNP
rs1183580557 2108 dbSNP
rs1385941412 2112 dbSNP
rs1459518977 2116 dbSNP
rs902460118 2118 dbSNP
rs1048573362 2120 dbSNP
rs930101997 2120 dbSNP
rs1318700413 2122 dbSNP
rs1390634786 2123 dbSNP
rs1450350027 2127 dbSNP
rs888638714 2127 dbSNP
rs759711002 2128 dbSNP
rs1032236913 2134 dbSNP
rs749434768 2140 dbSNP
rs1349469107 2148 dbSNP
rs1270404378 2152 dbSNP
rs576102514 2156 dbSNP
rs1203520772 2162 dbSNP
rs1224765762 2163 dbSNP
rs1425588810 2164 dbSNP
rs1440840746 2180 dbSNP
rs1179707381 2189 dbSNP
rs543915296 2193 dbSNP
rs1470626379 2194 dbSNP
rs538837607 2198 dbSNP
rs990630831 2200 dbSNP
rs765452943 2201 dbSNP
rs970495410 2202 dbSNP
rs1468050962 2215 dbSNP
rs1488074505 2225 dbSNP
rs1160879463 2234 dbSNP
rs196435 2242 dbSNP
rs1244191785 2248 dbSNP
rs1475980670 2250 dbSNP
rs184629978 2257 dbSNP
rs1334722536 2263 dbSNP
rs1010463644 2266 dbSNP
rs1264184381 2266 dbSNP
rs1321790204 2266 dbSNP
rs373079224 2266 dbSNP
rs1412170321 2267 dbSNP
rs1194648859 2270 dbSNP
rs1447006222 2277 dbSNP
rs1164879974 2281 dbSNP
rs773266761 2282 dbSNP
rs1184543622 2298 dbSNP
rs1418681613 2299 dbSNP
rs1315864739 2300 dbSNP
rs1346731810 2309 dbSNP
rs1175407045 2313 dbSNP
rs941678598 2314 dbSNP
rs1378043473 2327 dbSNP
rs375764738 2340 dbSNP
rs5773092 2341 dbSNP
rs766769988 2341 dbSNP
rs200097313 2342 dbSNP
rs1283413405 2346 dbSNP
rs973640820 2362 dbSNP
rs189897192 2379 dbSNP
rs1248146025 2385 dbSNP
rs1303941889 2387 dbSNP
rs1034307160 2389 dbSNP
rs1315785665 2391 dbSNP
rs932151960 2394 dbSNP
rs1284309998 2400 dbSNP
rs960274998 2404 dbSNP
rs1353165726 2406 dbSNP
rs1051933972 2410 dbSNP
rs559721454 2412 dbSNP
rs1340098136 2418 dbSNP
rs868831763 2420 dbSNP
rs890570029 2422 dbSNP
rs533272686 2424 dbSNP
rs1490241958 2427 dbSNP
rs746905911 2430 dbSNP
rs1392989342 2432 dbSNP
rs1200493892 2452 dbSNP
rs551554743 2454 dbSNP
rs930058274 2457 dbSNP
rs56404812 2462 dbSNP
rs1190870011 2470 dbSNP
rs910045351 2476 dbSNP
rs1430372443 2478 dbSNP
rs1169910562 2482 dbSNP
rs770725258 2485 dbSNP
rs764266229 2491 dbSNP
rs752168273 2498 dbSNP
rs530488298 2506 dbSNP
rs7518680 2514 dbSNP
rs1039892596 2522 dbSNP
rs1463028083 2529 dbSNP
rs1032264928 2537 dbSNP
rs1184790423 2544 dbSNP
rs181492944 2547 dbSNP
rs1012529334 2548 dbSNP
rs1024798186 2554 dbSNP
rs970909292 2555 dbSNP
rs1358902993 2558 dbSNP
rs1385306815 2561 dbSNP
rs1223424049 2563 dbSNP
rs1438599724 2564 dbSNP
rs534656052 2571 dbSNP
rs1051459834 2572 dbSNP
rs1409619354 2575 dbSNP
rs1260834154 2576 dbSNP
rs1449988980 2579 dbSNP
rs7518774 2585 dbSNP
rs565985832 2586 dbSNP
rs973002209 2589 dbSNP
rs764817827 2596 dbSNP
rs1443494402 2597 dbSNP
rs922224302 2598 dbSNP
rs1351287782 2599 dbSNP
rs1042863539 2604 dbSNP
rs932242003 2609 dbSNP
rs750757975 2610 dbSNP
rs912045552 2611 dbSNP
rs533196458 2613 dbSNP
rs1034233582 2617 dbSNP
rs539769237 2618 dbSNP
rs1041818167 2619 dbSNP
rs1314984837 2623 dbSNP
rs374218627 2623 dbSNP
rs904569063 2624 dbSNP
rs1215404245 2627 dbSNP
rs149257289 2629 dbSNP
rs936027916 2632 dbSNP
rs185866801 2633 dbSNP
rs1241222475 2634 dbSNP
rs1460452678 2643 dbSNP
rs1055796964 2644 dbSNP
rs1181904776 2647 dbSNP
rs576612047 2649 dbSNP
rs537129385 2658 dbSNP
rs574762987 2661 dbSNP
rs1204850714 2672 dbSNP
rs748857815 2675 dbSNP
rs754544250 2682 dbSNP
rs778341763 2697 dbSNP
rs1046723078 2699 dbSNP
rs906381582 2705 dbSNP
rs1459171977 2721 dbSNP
rs964144884 2728 dbSNP
rs1436583717 2730 dbSNP
rs1405949291 2737 dbSNP
rs975562970 2745 dbSNP
rs1234162233 2746 dbSNP
rs1223363097 2749 dbSNP
rs922820015 2749 dbSNP
rs1246284806 2757 dbSNP
rs1005091393 2763 dbSNP
rs774979587 2772 dbSNP
rs555874468 2779 dbSNP
rs1311512340 2780 dbSNP
rs866100877 2780 dbSNP
rs994494122 2786 dbSNP
rs1426929188 2790 dbSNP
rs1210805598 2792 dbSNP
rs1028602996 2796 dbSNP
rs1238699623 2797 dbSNP
rs145711164 2801 dbSNP
rs1176213601 2805 dbSNP
rs1252119214 2808 dbSNP
rs1470801829 2809 dbSNP
rs7540973 2810 dbSNP
rs987758302 2812 dbSNP
rs1389623801 2813 dbSNP
rs1178871624 2819 dbSNP
rs1352777240 2824 dbSNP
rs912100446 2825 dbSNP
rs1441592091 2845 dbSNP
rs1308822838 2851 dbSNP
rs1042789630 2853 dbSNP
rs967575696 2854 dbSNP
rs1403389823 2856 dbSNP
rs1281128236 2858 dbSNP
rs1330947050 2871 dbSNP
rs904282054 2876 dbSNP
rs1001339795 2882 dbSNP
rs1219733969 2882 dbSNP
rs1305230677 2889 dbSNP
rs559783196 2896 dbSNP
rs1203857606 2902 dbSNP
rs977584249 2916 dbSNP
rs1274768000 2928 dbSNP
rs926061749 2934 dbSNP
rs1055617873 2935 dbSNP
rs1196845627 2940 dbSNP
rs936057666 2946 dbSNP
rs1055829738 2947 dbSNP
rs895667281 2948 dbSNP
rs763502912 2952 dbSNP
rs1418041625 2956 dbSNP
rs950065733 2960 dbSNP
rs1026020369 2961 dbSNP
rs1372503921 2962 dbSNP
rs1422901938 2968 dbSNP
rs1302843944 2984 dbSNP
rs951373228 2994 dbSNP
rs1436988476 2998 dbSNP
rs1005515429 3005 dbSNP
rs1359725195 3007 dbSNP
rs560446939 3010 dbSNP
rs376864334 3011 dbSNP
rs762680495 3018 dbSNP
rs906401740 3018 dbSNP
rs1336884772 3019 dbSNP
rs1288766089 3020 dbSNP
rs61358817 3023 dbSNP
rs1224187188 3025 dbSNP
rs1036144564 3031 dbSNP
rs190866348 3034 dbSNP
rs777452487 3038 dbSNP
rs994527312 3067 dbSNP
rs1449331416 3070 dbSNP
rs1028676639 3072 dbSNP
rs563456592 3081 dbSNP
rs988410567 3086 dbSNP
rs953086077 3102 dbSNP
rs1198086504 3104 dbSNP
rs1442915620 3104 dbSNP
rs530781412 3106 dbSNP
rs914142642 3111 dbSNP
rs1008946035 3113 dbSNP
rs1343224662 3114 dbSNP
rs1019233823 3115 dbSNP
rs1372333242 3119 dbSNP
rs1366717353 3120 dbSNP
rs1243194123 3122 dbSNP
rs745722997 3122 dbSNP
rs767305949 3122 dbSNP
rs978437550 3122 dbSNP
rs1229689985 3131 dbSNP
rs968027923 3132 dbSNP
rs1282512924 3142 dbSNP
rs1464779734 3143 dbSNP
rs1209891070 3146 dbSNP
rs1460371895 3151 dbSNP
rs1250492787 3152 dbSNP
rs977615671 3155 dbSNP
rs1186878455 3159 dbSNP
rs1460010652 3159 dbSNP
rs925669320 3160 dbSNP
rs1397280604 3167 dbSNP
rs926092506 3168 dbSNP
rs1456555308 3179 dbSNP
rs56899039 3181 dbSNP
rs1390695670 3182 dbSNP
rs1450385960 3186 dbSNP
rs1055986770 3187 dbSNP
rs991586305 3188 dbSNP
rs1277468296 3189 dbSNP
rs770601349 3190 dbSNP
rs1229436759 3197 dbSNP
rs895645617 3198 dbSNP
rs1321967107 3202 dbSNP
rs1200392569 3209 dbSNP
rs915949352 3214 dbSNP
rs950085294 3215 dbSNP
rs1046141054 3217 dbSNP
rs1230241583 3221 dbSNP
rs1473059977 3222 dbSNP
rs1159565526 3223 dbSNP
rs1271224594 3224 dbSNP
rs560998352 3229 dbSNP
rs546026973 3230 dbSNP
rs940596632 3235 dbSNP
rs1288980840 3240 dbSNP
rs1326406467 3253 dbSNP
rs1036176523 3254 dbSNP
rs1005482846 3256 dbSNP
rs899021388 3258 dbSNP
rs421481 3261 dbSNP
rs930448531 3266 dbSNP
rs1050141361 3267 dbSNP
rs1233150437 3269 dbSNP
rs1257151641 3273 dbSNP
rs196421 3274 dbSNP
rs1008598596 3277 dbSNP
rs899875547 3278 dbSNP
rs1039343800 3280 dbSNP
rs899110369 3281 dbSNP
rs996881543 3282 dbSNP
rs995072839 3284 dbSNP
rs546164235 3285 dbSNP
rs58478223 3286 dbSNP
rs999128836 3289 dbSNP
rs1161697913 3290 dbSNP
rs1389001840 3291 dbSNP
rs59895318 3292 dbSNP
rs1186595987 3295 dbSNP
rs1208973885 3295 dbSNP
rs1460650168 3295 dbSNP
rs1491081327 3295 dbSNP
rs34827408 3295 dbSNP
rs60151054 3295 dbSNP
rs1367571889 3296 dbSNP
rs1425529396 3297 dbSNP
rs1030200862 3311 dbSNP
rs1288569754 3312 dbSNP
rs1383089535 3313 dbSNP
rs1491290398 3314 dbSNP
rs397966276 3315 dbSNP
rs539730578 3315 dbSNP
rs61618818 3316 dbSNP
rs1319423340 3317 dbSNP
rs1340337790 3318 dbSNP
rs1244478506 3320 dbSNP
rs1320540191 3327 dbSNP
rs1433523543 3327 dbSNP
rs1312247330 3328 dbSNP
rs1448950613 3330 dbSNP
rs1361063426 3331 dbSNP
rs886485589 3338 dbSNP
rs1246245082 3339 dbSNP
rs1313045745 3340 dbSNP
rs1259724504 3341 dbSNP
rs1245810184 3344 dbSNP
rs1265738761 3353 dbSNP
rs1489376201 3354 dbSNP
rs550424830 3358 dbSNP
rs988724645 3359 dbSNP
rs1206634223 3362 dbSNP
rs1465317321 3378 dbSNP
rs1033235912 3379 dbSNP
rs1411016333 3380 dbSNP
rs957535287 3382 dbSNP
rs1165125640 3386 dbSNP
rs1021179362 3406 dbSNP
rs1456021100 3410 dbSNP
rs1159032690 3414 dbSNP
rs551687720 3417 dbSNP
rs991618266 3418 dbSNP
rs1301103432 3419 dbSNP
rs570145545 3421 dbSNP
rs979709200 3430 dbSNP
rs1315169695 3431 dbSNP
rs925600691 3432 dbSNP
rs537690050 3434 dbSNP
rs981492725 3435 dbSNP
rs991214814 3436 dbSNP
rs1235238837 3437 dbSNP
rs908517644 3440 dbSNP
rs1182061200 3450 dbSNP
rs1014358772 3451 dbSNP
rs1471422958 3452 dbSNP
rs768026983 3458 dbSNP
rs1181849076 3463 dbSNP
rs1413173966 3466 dbSNP
rs971967825 3467 dbSNP
rs1159482584 3468 dbSNP
rs949883474 3488 dbSNP
rs750769491 3496 dbSNP
rs1451096620 3499 dbSNP
rs930480994 3501 dbSNP
rs886964103 3503 dbSNP
rs1225382790 3511 dbSNP
rs1276476206 3515 dbSNP
rs1311072692 3518 dbSNP
rs1384203585 3528 dbSNP
rs1210156610 3535 dbSNP
rs1281870056 3545 dbSNP
rs376064980 3550 dbSNP
rs941270308 3555 dbSNP
rs1050678528 3561 dbSNP
rs775850073 3565 dbSNP
rs189610320 3573 dbSNP
rs1473807689 3575 dbSNP
rs1189956194 3577 dbSNP
rs1038285911 3606 dbSNP
rs944436289 3638 dbSNP
rs1040101233 3645 dbSNP
rs902863255 3646 dbSNP
rs182919153 3655 dbSNP
rs1308927129 3656 dbSNP
rs200059316 3656 dbSNP
rs576436467 3656 dbSNP
rs998489410 3657 dbSNP
rs1322618516 3659 dbSNP
rs1366759418 3676 dbSNP
rs891217778 3680 dbSNP
rs1304902437 3684 dbSNP
rs1339537143 3685 dbSNP
rs1203980792 3689 dbSNP
rs1033267098 3695 dbSNP
rs1439228069 3704 dbSNP
rs1009715580 3705 dbSNP
rs6682514 3708 dbSNP
rs535144402 3709 dbSNP
rs968241160 3711 dbSNP
rs553368926 3713 dbSNP
rs1448994096 3715 dbSNP
rs1461735717 3722 dbSNP
rs1169432216 3726 dbSNP
rs1392211803 3734 dbSNP
rs1013122947 3745 dbSNP
rs578095422 3755 dbSNP
rs1403836419 3777 dbSNP
rs6667481 3783 dbSNP
rs971528014 3787 dbSNP
rs186194443 3792 dbSNP
rs1015649226 3795 dbSNP
rs1160199892 3797 dbSNP
rs961367861 3798 dbSNP
rs974005568 3801 dbSNP
rs1429017287 3806 dbSNP
rs1297726285 3815 dbSNP
rs1468515079 3823 dbSNP
rs763253718 3828 dbSNP
rs575458762 3829 dbSNP
rs768870459 3840 dbSNP
rs1216075930 3844 dbSNP
rs1461941146 3853 dbSNP
rs774503907 3856 dbSNP
rs1246771319 3866 dbSNP
rs1464864726 3875 dbSNP
rs921336048 3875 dbSNP
rs971534935 3880 dbSNP
rs1453013518 3881 dbSNP
rs1370625922 3888 dbSNP
rs1162954418 3894 dbSNP
rs1412777769 3900 dbSNP
rs982580222 3901 dbSNP
rs908376971 3907 dbSNP
rs762439651 3927 dbSNP
rs1386305870 3928 dbSNP
rs930549772 3936 dbSNP
rs1434304616 3940 dbSNP
rs1392759388 3942 dbSNP
rs1320567522 3953 dbSNP
rs1288523053 3954 dbSNP
rs1344478619 3956 dbSNP
rs1221418998 3957 dbSNP
rs111550447 3959 dbSNP
rs1266647307 3959 dbSNP
rs1445339862 3959 dbSNP
rs1329012149 3960 dbSNP
rs1264791023 3965 dbSNP
rs1286420997 3968 dbSNP
rs542760858 3975 dbSNP
rs941238993 3976 dbSNP
rs1238307342 3979 dbSNP
rs560948147 3982 dbSNP
rs1038213838 3988 dbSNP
rs910395767 4002 dbSNP
rs921190046 4006 dbSNP
rs944529020 4012 dbSNP
rs1040536276 4015 dbSNP
rs1249688296 4016 dbSNP
rs1386465846 4027 dbSNP
rs1412301716 4029 dbSNP
rs768085965 4031 dbSNP
rs528144294 4032 dbSNP
rs1340650064 4036 dbSNP
rs755143336 4037 dbSNP
rs934356430 4040 dbSNP
rs1268368981 4041 dbSNP
rs1229531397 4044 dbSNP
rs1479598310 4046 dbSNP
rs1263062570 4062 dbSNP
rs1201983815 4073 dbSNP
rs1054113205 4075 dbSNP
rs1199897094 4080 dbSNP
rs1279440343 4085 dbSNP
rs893418845 4088 dbSNP
rs1249332969 4092 dbSNP
rs750870922 4092 dbSNP
rs1042533847 4100 dbSNP
rs1169026765 4100 dbSNP
rs1365427669 4101 dbSNP
rs1013566506 4102 dbSNP
rs539976169 4111 dbSNP
rs1477012025 4112 dbSNP
rs903983052 4121 dbSNP
rs141934713 4122 dbSNP
rs1044627275 4127 dbSNP
rs564518700 4136 dbSNP
rs907376805 4137 dbSNP
rs1003007160 4142 dbSNP
rs1463012216 4144 dbSNP
rs1308141080 4153 dbSNP
rs1364513146 4155 dbSNP
rs1410869148 4162 dbSNP
rs532028383 4167 dbSNP
rs370007998 4171 dbSNP
rs961438736 4172 dbSNP
rs1284923332 4175 dbSNP
rs1368116704 4181 dbSNP
rs1013859607 4186 dbSNP
rs1226432887 4189 dbSNP
rs1274242163 4196 dbSNP
rs1293288509 4198 dbSNP
rs995495527 4217 dbSNP
rs1196110929 4219 dbSNP
rs1026924592 4220 dbSNP
rs1309193654 4225 dbSNP
rs971122478 4233 dbSNP
rs1198157284 4236 dbSNP
rs1205912764 4258 dbSNP
rs1291164088 4262 dbSNP
rs1455228526 4263 dbSNP
rs982938907 4269 dbSNP
rs1389123135 4273 dbSNP
rs551647395 4274 dbSNP
rs1489914777 4293 dbSNP
rs954023770 4295 dbSNP
rs1389114714 4299 dbSNP
rs962487504 4302 dbSNP
rs766644747 4303 dbSNP
rs921157073 4308 dbSNP
rs1226225800 4311 dbSNP
rs910437470 4313 dbSNP
rs753546455 4314 dbSNP
rs1185144969 4315 dbSNP
rs975940718 4316 dbSNP
rs1429650278 4317 dbSNP
rs1252849089 4326 dbSNP
rs924392130 4338 dbSNP
rs1051051438 4339 dbSNP
rs570286738 4343 dbSNP
rs934382394 4345 dbSNP
rs1209138894 4351 dbSNP
rs1253585029 4352 dbSNP
rs1384109764 4356 dbSNP
rs372190016 4356 dbSNP
rs781476126 4356 dbSNP
rs1054143968 4371 dbSNP
rs531112298 4382 dbSNP
rs914258423 4388 dbSNP
rs948383411 4392 dbSNP
rs1045050153 4394 dbSNP
rs903951792 4396 dbSNP
rs1350126183 4401 dbSNP
rs1367067544 4404 dbSNP
rs1001009418 4408 dbSNP
rs907412758 4412 dbSNP
rs1055279181 4413 dbSNP
rs895344656 4430 dbSNP
rs1433546483 4432 dbSNP
rs1319891104 4435 dbSNP
rs1014245418 4441 dbSNP
rs1286937412 4442 dbSNP
rs549523826 4443 dbSNP
rs1037149176 4449 dbSNP
rs1314430924 4459 dbSNP
rs754562553 4470 dbSNP
rs778427888 4471 dbSNP
rs1015270886 4478 dbSNP
rs191436387 4481 dbSNP
rs1266926701 4482 dbSNP
rs1485939559 4496 dbSNP
rs1248278273 4497 dbSNP
rs1187873634 4504 dbSNP
rs752157153 4512 dbSNP
rs973817529 4513 dbSNP
rs535105880 4515 dbSNP
rs553530707 4527 dbSNP
rs1420477190 4528 dbSNP
rs953938211 4550 dbSNP
rs1159147768 4551 dbSNP
rs1455444650 4566 dbSNP
rs987081569 4566 dbSNP
rs1301197284 4567 dbSNP
rs1401702096 4569 dbSNP
rs1415639565 4571 dbSNP
rs138939816 4582 dbSNP
rs912488754 4590 dbSNP
rs1006853886 4595 dbSNP
rs1357200523 4598 dbSNP
rs1226478110 4613 dbSNP
rs1244239260 4614 dbSNP
rs567157547 4615 dbSNP
rs1183581924 4625 dbSNP
rs1253756933 4629 dbSNP
rs965983616 4640 dbSNP
rs1211239178 4657 dbSNP
rs925294741 4658 dbSNP
rs1471842722 4664 dbSNP
rs976347346 4665 dbSNP
rs1182048473 4667 dbSNP
rs936724279 4671 dbSNP
rs1421417921 4673 dbSNP
rs1173968151 4684 dbSNP
rs557081867 4692 dbSNP
rs575467402 4693 dbSNP
rs1435560354 4698 dbSNP
rs955832607 4707 dbSNP
rs989910090 4713 dbSNP
rs1407723420 4736 dbSNP
rs895303451 4738 dbSNP
rs949584178 4739 dbSNP
rs1164944018 4741 dbSNP
rs1414023650 4747 dbSNP
rs1399778751 4748 dbSNP
rs1346597696 4749 dbSNP
rs542575375 4753 dbSNP
rs1156642476 4754 dbSNP
rs914289610 4755 dbSNP
rs1204820436 4757 dbSNP
rs948392735 4758 dbSNP
rs886709093 4766 dbSNP
rs1322003030 4776 dbSNP
rs1190040749 4782 dbSNP
rs1435722015 4784 dbSNP
rs1335936829 4786 dbSNP
rs1454798562 4787 dbSNP
rs1388500855 4793 dbSNP
rs1429364014 4794 dbSNP
rs1380497422 4798 dbSNP
rs979789787 4799 dbSNP
rs1444276045 4804 dbSNP
rs1291761711 4805 dbSNP
rs928914473 4807 dbSNP
rs1454608499 4815 dbSNP
rs554736421 4816 dbSNP
rs551092667 4824 dbSNP
rs1213630587 4833 dbSNP
rs749583296 4833 dbSNP
rs1309684961 4834 dbSNP
rs1037222306 4839 dbSNP
rs1252876384 4844 dbSNP
rs1350198257 4855 dbSNP
rs1469326640 4856 dbSNP
rs72884438 4871 dbSNP
rs931448814 4875 dbSNP
rs953978447 4883 dbSNP
rs1168769606 4891 dbSNP
rs1330313693 4897 dbSNP
rs1048467595 4914 dbSNP
rs986664339 4924 dbSNP
rs889876517 4927 dbSNP
rs539938450 4928 dbSNP
rs1203451756 4932 dbSNP
rs1461905897 4936 dbSNP
rs1019925080 4945 dbSNP
rs1261748842 4946 dbSNP
rs538829394 4948 dbSNP
rs1188966276 4949 dbSNP
rs1429569269 4951 dbSNP
rs1270452544 4954 dbSNP
rs1363678083 4957 dbSNP
rs978030130 4957 dbSNP
rs1272965176 4959 dbSNP
rs558824309 4970 dbSNP
rs1019601688 4980 dbSNP
rs1237599430 4994 dbSNP
rs1216173762 4995 dbSNP
rs1266304986 4997 dbSNP
rs1446546963 5003 dbSNP
rs901779279 5004 dbSNP
rs925265146 5009 dbSNP
rs997450113 5014 dbSNP
rs1185458951 5020 dbSNP
rs74060399 5027 dbSNP
rs1475491313 5033 dbSNP
rs10903094 5039 dbSNP
rs989942777 5048 dbSNP
rs1021424211 5049 dbSNP
rs1318432839 5051 dbSNP
rs1346541252 5056 dbSNP
rs969824957 5066 dbSNP
rs1293060081 5068 dbSNP
rs980199944 5071 dbSNP
rs886629979 5077 dbSNP
rs1335315769 5079 dbSNP
rs1287043997 5081 dbSNP
rs553381537 5090 dbSNP
rs1350624110 5096 dbSNP
rs1286445818 5100 dbSNP
rs1440842238 5102 dbSNP
rs928338595 5109 dbSNP
rs1210516902 5110 dbSNP
rs1256521939 5117 dbSNP
rs1475437216 5123 dbSNP
rs1189840560 5138 dbSNP
rs7528038 5141 dbSNP
rs1469575720 5142 dbSNP
rs531200474 5154 dbSNP
rs1158576920 5155 dbSNP
rs143364092 5158 dbSNP
rs567824380 5159 dbSNP
rs147127733 5171 dbSNP
rs547226265 5173 dbSNP
rs1416962076 5175 dbSNP
rs931522398 5179 dbSNP
rs1261689555 5182 dbSNP
rs1028461501 5184 dbSNP
rs574735161 5187 dbSNP
rs1343030792 5202 dbSNP
rs1233810340 5206 dbSNP
rs889561607 5212 dbSNP
rs1486790606 5214 dbSNP
rs1212684126 5217 dbSNP
rs1248156066 5233 dbSNP
rs1326255574 5239 dbSNP
rs1048538755 5242 dbSNP
rs1182513148 5245 dbSNP
rs1201572623 5263 dbSNP
rs889899703 5265 dbSNP
rs183422198 5272 dbSNP
rs1278710740 5274 dbSNP
rs966566834 5282 dbSNP
rs942779076 5283 dbSNP
rs1201827999 5284 dbSNP
rs539158112 5286 dbSNP
rs1472726017 5290 dbSNP
rs72884439 5297 dbSNP
rs901185049 5308 dbSNP
rs1426986811 5310 dbSNP
rs1436209789 5316 dbSNP
rs1032265026 5330 dbSNP
rs1481373425 5332 dbSNP
rs1331518402 5334 dbSNP
rs957993608 5345 dbSNP
rs555755267 5347 dbSNP
rs569194628 5349 dbSNP
rs1173143939 5361 dbSNP
rs536528406 5376 dbSNP
rs1350242926 5380 dbSNP
rs916631473 5381 dbSNP
rs970818850 5382 dbSNP
rs554616823 5383 dbSNP
rs1196277322 5384 dbSNP
rs1031594331 5388 dbSNP
rs1252523907 5390 dbSNP
rs891714364 5402 dbSNP
rs1011449915 5403 dbSNP
rs1253082574 5416 dbSNP
rs1455301372 5416 dbSNP
rs1190651316 5419 dbSNP
rs796775254 5423 dbSNP
rs1404621927 5424 dbSNP
rs1281740129 5425 dbSNP
rs908029445 5433 dbSNP
rs1021445871 5434 dbSNP
rs1461382888 5435 dbSNP
rs1326659172 5436 dbSNP
rs1373364777 5438 dbSNP
rs970272107 5439 dbSNP
rs1234587873 5443 dbSNP
rs1327277749 5448 dbSNP
rs1037882837 5451 dbSNP
rs1252864000 5453 dbSNP
rs1270069173 5453 dbSNP
rs1338051106 5456 dbSNP
rs1213064508 5467 dbSNP
rs1273255925 5471 dbSNP
rs1212247082 5473 dbSNP
rs572693159 5475 dbSNP
rs1001304973 5484 dbSNP
rs920857837 5487 dbSNP
rs1428762876 5488 dbSNP
rs1483160235 5492 dbSNP
rs1195698948 5495 dbSNP
rs1035814995 5500 dbSNP
rs1221362565 5500 dbSNP
rs959703338 5507 dbSNP
rs1266489276 5508 dbSNP
rs187656068 5510 dbSNP
rs1451677324 5517 dbSNP
rs918875774 5521 dbSNP
rs952954717 5522 dbSNP
rs1199307608 5530 dbSNP
rs984280138 5531 dbSNP
rs911410976 5539 dbSNP
rs1474401280 5544 dbSNP
rs1170544503 5561 dbSNP
rs889475754 5566 dbSNP
rs1353392967 5568 dbSNP
rs1007967160 5577 dbSNP
rs1293872715 5578 dbSNP
rs558332213 5580 dbSNP
rs1236183294 5582 dbSNP
rs942832063 5598 dbSNP
rs192470093 5608 dbSNP
rs140306256 5610 dbSNP
rs1485988556 5613 dbSNP
rs1206589081 5633 dbSNP
rs1255826930 5646 dbSNP
rs902306448 5650 dbSNP
rs999369000 5668 dbSNP
rs1420584595 5671 dbSNP
rs922637609 5674 dbSNP
rs1032233839 5678 dbSNP
rs1364522565 5678 dbSNP
rs957961851 5681 dbSNP
rs1311344169 5693 dbSNP
rs1373360430 5696 dbSNP
rs935357337 5697 dbSNP
rs1313277452 5711 dbSNP
rs1381175127 5711 dbSNP
rs1052426329 5722 dbSNP
rs1305658604 5724 dbSNP
rs1318099169 5729 dbSNP
rs1325176651 5730 dbSNP
rs1230310647 5739 dbSNP
rs1277704306 5739 dbSNP
rs1023623409 5740 dbSNP
rs1211969825 5758 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            || |:: || | ||||||| 
Target 5' -cCAUAUUCUUCU-UGCUGCUu 3'
1 - 20
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000374395.4 | 3UTR | CCAUAUUCUUCUUGCUGCUUUUCAACCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000374395.4 | 3UTR | CCAUAUUCUUCUUGCUGCUUUUCAACCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000374395.4 | 3UTR | CCAUAUUCUUCUUGCUGCUUUUCAACCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.297 8.6e-3 0.243 2.7e-2 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.457 2.1e-2 -0.632 1.4e-3 20 Click to see details
GSE17498 Multiple myeloma 0.267 4.8e-2 0.004 4.9e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.319 8.5e-2 -0.355 6.2e-2 20 Click to see details
GSE38226 Liver fibrosis -0.31 8.6e-2 -0.210 1.8e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.25 1.2e-1 0.370 3.8e-2 24 Click to see details
GSE17306 Multiple myeloma 0.152 1.5e-1 0.151 1.5e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.223 1.5e-1 0.112 3.1e-1 23 Click to see details
GSE19350 CNS germ cell tumors 0.318 1.6e-1 -0.056 4.3e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.263 1.9e-1 -0.198 2.6e-1 13 Click to see details
GSE19783 ER- ER- breast cancer -0.084 2.3e-1 0.027 4.1e-1 79 Click to see details
GSE14794 Lymphoblastoid cells 0.072 2.5e-1 0.103 1.7e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.136 2.6e-1 0.245 1.2e-1 25 Click to see details
GSE19536 Breast cancer -0.055 2.9e-1 -0.005 4.8e-1 100 Click to see details
GSE21032 Prostate cancer -0.04 3.6e-1 -0.025 4.1e-1 83 Click to see details
GSE28544 Breast cancer 0.059 3.9e-1 0.209 1.6e-1 24 Click to see details
GSE21849 B cell lymphoma -0.053 3.9e-1 -0.094 3.1e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.041 4.2e-1 0.087 3.4e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.02 4.7e-1 0.124 3.2e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.012 4.7e-1 -0.035 4.2e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.012 4.7e-1 -0.035 4.2e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.715 0 0.567 0.01 18 Click to see details
BRCA -0.356 0 -0.367 0 84 Click to see details
CHOL -0.799 0 -0.850 0 9 Click to see details
STAD 0.397 0.01 0.409 0.01 32 Click to see details
LUAD 0.49 0.05 0.538 0.04 12 Click to see details
PRAD 0.191 0.09 0.113 0.22 50 Click to see details
UCEC -0.284 0.12 -0.277 0.13 19 Click to see details
LUSC -0.191 0.13 -0.223 0.09 38 Click to see details
PCPG -0.838 0.18 -1.000 0.5 3 Click to see details
PAAD 0.564 0.22 0.400 0.3 4 Click to see details
KICH 0.159 0.22 0.140 0.25 25 Click to see details
CESC 0.748 0.23 0.500 0.33 3 Click to see details
HNSC -0.097 0.27 -0.124 0.22 42 Click to see details
THCA 0.063 0.32 0.003 0.49 59 Click to see details
KIRP 0.085 0.32 -0.021 0.45 32 Click to see details
ESCA -0.156 0.32 -0.236 0.24 11 Click to see details
KIRC -0.056 0.33 -0.007 0.48 68 Click to see details
LIHC -0.066 0.33 0.000 0.5 49 Click to see details
COAD 0.181 0.33 -0.095 0.41 8 Click to see details
COAD 0.181 0.33 -0.095 0.41 8 Click to see details
COAD 0.181 0.33 -0.095 0.41 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449