miRTarBase - #MIRT505911 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RIMS3   
Synonyms NIM3, RIM3
Description regulating synaptic membrane exocytosis 3
Transcript NM_014747   
Expression
Putative miRNA Targets on RIMS3
3'UTR of RIMS3
(miRNA target sites are highlighted)
>RIMS3|NM_014747|3'UTR
   1 GGATGTCAGGAAGAGGCCAGGATGGTGGTGTGGGGAGGGGTGCCTGCTGGCCCCATGTCCTCCCCTGTACATAGTCTTCG
  81 TGTCTTTCTGGACCCCTTGTCCTGCTGCATGCCTGTTGGCTACTGGGCTCATCCCAGCTGGCAGTGGAGACTGTAGTGTG
 161 TGCGTGTGTGCGTGCGTGTGTGTGTGTGTGTACGTGACCACGTTCTATCTGTTCATTTGTCTGGGTATAGTCACTCCTGG
 241 TGATGATATGGGCTGAAATGTCTCCACGTCTCTTTGTGTCTTGTTGAAAAGAAACCCAAAGGAGTGTTGTGTGGACATGA
 321 CTCACCCTGAGGAGTCTCCAGGGATGGAGGTGGGGCATGCGGCCACTGGTCGGTGCTGCCTGGTCCTGGCCTGGGGCAGA
 401 GCCTGTGTGTTCTTCACCTGTGCCTGCTCCTGGTGGTCTCTGCTTTGTTTTCTGTCTTGTCTTTTGTTCCACTCTTGACT
 481 CTCCCGGCTCTGCCACTGTTTTCTGAGAAATGTAGCATCCGCTGCAGCTGGCCACACTGAGGGCCCTCTGGGAACCCCAC
 561 CCCACTGGAGCCGCTCCGGCAGCTCTTCCTGCCACTGAATGCGTTCTGCAGCATGTAGCATGCCCACCTAGCTCCCTGGC
 641 CAGGGCCCTGGGGAGGCAGAGGGTACCCAGGGGACTGAGGGCTTAGAAATGACTTTCTCTATGAGGCTGGAACCTCCTCC
 721 TTCTTCCAGTGAAGCACGAGGTCTTGGTTCCAGGGTTCCTGGCCAGGTGCCCCCTTAGCATTTGTTCTTCATCTCCTGTC
 801 TCTTCAAGCCTCCCCACTCCACCGTGCCGAAGGAGCTCTGCCAGTGGGCCTGGGCAGGCAGCCACAGAGGGCATGTTATC
 881 TGCTAAAGCAAACAGTCCTCCTGAGGCCCTGAGGGTGGCCCTGACCCCCTCAGGGCTCATTCCTGGTGGGCATGACTCGG
 961 TAAGGAGGTTCTGTGGGTAGGGCTGTTTGCTGGAATAAGGAGGGCTGAGGCTGAGTTGTTCCCCGCCACTGTTGAGGATC
1041 CCATCTGACATTTGGGGATTCACTGCATGAAGTTGTTCATTTGGGGCTCCAGTTTTTGTGCATTTCCAGACCAGGGTCCC
1121 TGTCTGGGAGCTCAGACTTAGCTGGGCTCCAGCAGCCTGGCTCCGGACTCTCGTCTGCCACCATCACCAGCTCTGTCTAA
1201 GCAATACTTACCCCTCCGGGCTTCCCTGCTTTCCTGTGCCCCACTGCTGCCCTCTGCAGAGCCATCTGCTCCAGGCACCC
1281 ACCTGCCTCTGCTTGCTTTCTCACCCATGTCTGGTTGGAGCTTCTCACAGCCACTCAAACCCTGACTTGATTTGACAACT
1361 GGGCCCTGTTGGTGGAGACCAGTGCCTGAACTGGACCCTGTGAAATCTGTCCCGTGGGAATCCTGAAGTCTGACTCAGGA
1441 ATGCCCAGACCTGTCCCTGTCCCTCCTCAGCTCTAGGGTGAAAGGCGAGAGGTTGCACAGGACATGGACAGAGCAGCCCT
1521 TGGGTTTGTATCTGGTAGGGGAGAAAGCAGCAGGACAGTGGAGGTGTGTGGAAGGCACTCTTTCCACCTCTCTCCAGGCA
1601 TTATCCCCAGGTGCTGAAATGGCTGTGGCCCCAGCACCTGAGGCAGGGGTACGCTACCTGGGGTAGCAGTAGAAAGGTCT
1681 TGGGGTCTGAATGACTTGGGGCCTCCATTCATAACCAAAGTTGTAGGGGCATGGAGGCAGTGGCGCCTTATGGATAGGTC
1761 ATCTCAGCCCAAAGGGCCTCCTTGGCTGGCATGGTTCTGTGTTACGTTGAAGCCAGAGTCTTATAACACCTCCCAAGAAA
1841 GATAGGGGAAGAAGCCAGAACCCCACCTGGCCTGCCCACAGGACAAGAAGTGGGTAAGGGCAGGAAGGAAATGAACGGAG
1921 TTAGCTCCCAGGCTCCTATCTCTGCCTGAGCCTCTATTCTTATATTATCAGAGAAAGGGACCATTGGGTGCATAGAGATG
2001 GGGAGGAGGCCACTGGGCTGAATTTTCTCTTTAGGCGGAAATGCTCTCCCCAGGCCCATTGCGTTCGTCAAGTTCTTGGA
2081 AATGGACAAAGGGCTCTGTCCTCCTCGACCCTAGTGGGGGATCAAGAAGGAAACTCCGTTGCAAAAGGGTATTTTAATCT
2161 CCTGTTTATGATATATTCACCTCTAGAGCAGTCACTGTCAGGGTGTTGCGAAAATACTCTACACCTTTGGGATGATAGGG
2241 TTGTTAGTGACCCACAGGACAGTATAGATGTTTGTGGATGTAGCACTGAGTGGTGATACCCAGACCAGCAGTCACCCCAG
2321 GAAGTGGGGGCTACCCATACCCTCATTCCTCTGGTGGGGAGCTGCCTGCAGAGAGGCCTGCCACTGGGGGTTCCAGGCCG
2401 TGGTGACCCTTGCCTCTGGGGAAGGGTTAGCACAGGGGAGGTTCTAGCTGGAGGAGGGGTCTGATGTGCTGGTAACTTGG
2481 GCTGACCTACCTACAGTCCCTGGCTGCCAAAACTGCTCAGCAGTTGGGCCACTCCACTATTCCACCTCTCTAAAAGAAGG
2561 TAATTTCCTCCCCAAATTGACCTTGGGGAATTATTCTTTTAACCCTTTGCACCAAATAAGTTACTCATCCCCACCTGGAT
2641 TTTACCCCATGAGGGTAAAGTTGTGTGAGGCTGACACGTCTGTGTGATGCAGTGTGGCTGCACTTAAGGGTCTGTTTCTC
2721 AGCATCATGGATGCAGGGGCTTGTCTGAAAAGCCACTCTGGACCTAGCCTGTCCCAGAAGAGGAGAATGCACAAGTGTAA
2801 CTCCTGGTTGTTTGCTGGGGTGGGGGAGCATCTGCTGTTTGAGGACGGGGGGTGGGGAAGGAAGGAACATGATCCCTCCA
2881 GAAGTCTCCCACCCTGGGGCCAACTCACTGCCATGTTCAGTGTCCCGGCTCCAAATGCCCCCTTGCCCAGATGAAACCCT
2961 GCAGTGGTTACAGGAATGGAGCTCTTTGTCATTCCACCTCCTCTGGTCAGGCGAGGTTCACTGTGCATATGGCAGAGACA
3041 GGAGTGGCCCTGCAGTGATGTTGGGTTGTGGGCAGGGACAGTGATGGATGACTCAGAGCGTCTGTCTTTGTATTTCTGCT
3121 CTGTTCATTCTGTCCCACTTTCTTCATAGACTCCTTTTCCCTGCAATGGGTTTTTGGTATGAAAAAGGCTCCAGTAAATG
3201 GAGCCAAGTCTTGGTTTGACAAGGGGAACTTGATCCTTCAGGGAAGAATCATCTCCAAAATGACTCCCCATCTGGTTTCT
3281 TCTACCACCCAATTCTACTAGGAAAGGAGCACTTAGGAGGCTCTTGGGATGCAGCAAGTCCCAGGCAATGCCAGCATTTC
3361 ATGGGGGCTGAGGCAGAACCCAGGAGCTCCAAGAAAGGCCACCCATAGAGCTCATCCTCTGTGGAATCACTGCCGGTTAG
3441 AACACTGAGGTCAAGCCAGTCCTCCCATGGTCATGCCACCCACCAGGGAAGCATGCCTGATCTCTTCTTTACTGCCAGCC
3521 TTGAGGAGAGCAGAAGCCTCCATTTTTAAAGACAATAAAGACCTCCAAGGGTACTTCTTTGGAAATGAAATGTAGCACAA
3601 TCTTAGCCTACGTTACCAGGAGCCCTGACATGCAACCAGGGTCCCTCTTCCATGCCCTGCTGCCCAGGAGTTGCTGAGCT
3681 CCTCTTCCCCTGGGGTTCCAGCCCTCCTAATACCTCATATTCCCCATCTTCCTCAGCCCAGAAAGCAATGGGGCTTTAGT
3761 GATGCTCCTCTTTTGTGTCTCTCTGGTTGCCTCTAGCACTGTGCAAACTCTGCAAGAAATTGCTGCCTTTGCTTGATGTT
3841 GTAGATGAGTTGCCCTCCACCTGGCTGGAGAGATGGCACATCATTCAGGGCCAGAAGGTTGTCCAGCAGTGTTTCTGCAG
3921 TGGCTGCAGGGAGATGGAAAAGAAGAGCCCTGCTTCCCTGCCTCCTCCTACCTTTCTCTTCCACTCCTCAGAGTTTTCTT
4001 CTCCAGTATCCTGACATGTAAAGAGATTCTTTAAAATGCTGCTTCTTCTACTGGACTGTCTTTCACTGAGTAGTCAGGGA
4081 GGAGATGAAAATGTGGACACATCCCCCCGCCTTCTCCCTCAACCTTTTCACTCACGTCAGAAGAGGTTGGGGCAAAACAA
4161 AACAAGCATGATTGAAGAGCAGGGGAAGCCCACACAATCAGGTGAGCCCTGATGGGGGCTGGACTGGCCTGGTCTGGCTG
4241 GGAAAGGATTCTTTTAAAAGCGTGCCTGAGCATCTCAGAGCAATGTCAGTGATGCCAAAGAGAGCAACTTGGCCTCCTTG
4321 GGCACCAACTCTGATGGCTGAGTTGCACAAACGTGGCTCAGATGTTGGCATGCCCGATGGTGGGACCTTGTTCTCTGATA
4401 AAGGGCTTAATCTTTCCATGTAGCAAAGCAACTTTCCCTCCCTCCCCTCCCCCCGAACCCTGAGCTTGGGCTTGTGTGGG
4481 CCCAGCATGGCTGTGCCTGTGAGGGAAGCCACATCAGTGAGAGAAAGTTGCATTCTCTCAGGGGCCTAGATTGGCTTGGG
4561 GCAGGTGCTTGTTGAAAAGCATGAGTGTTTCTGCTTTGGGAAACCCTTCCAGGGCTCTGGTTGGAAACTTGGCCAGTAAG
4641 GACAGGGCCTTGGGCCTCCCAAGGAGTTCACAATGATGCCAGGAAGGGTCCCTGAGCCTGGGTTCCAGTCAGCTTGGCTA
4721 ACAGAATGGGGCTTGGGAATTCCAGGGGCAACTGAGCATCCACCCCATTAGCCAGTGATCTGGACAGGGACAGCTGGCTA
4801 CAGGGAATCAAAGGCTGTTCTGTACAGTTTTACCAGAAACTGTGACCTTGGGTAAGGCTCCTCACTTTTCTGGGCCTCAA
4881 CTTCCTCATCTGCAAAATCAGAGCATTAGCTGCTCTCCCCATGATTCCCTCCCAGTTTTAATTAAAAGTCTCTGATCTGG
4961 AGCACATGAGGGTTGCGAGCCTGGTGCACCTGGTTCCTGTCTCCGTGGGCTGGTTTCCTTCAGCCCCTGATGCCCAGGCT
5041 GGGTGCAGGCTCTCATCTGGTCCATGCCCAGATGCTGCCTCAGACAAGAACTCTGGGAATCCTAACAGACTCTGCTTTCC
5121 TCTCTTCGTGGTTTGTCCTCCCTCTTTTATTCTTGTGTAATGATGAGACATAATTAAGGGTCATCTACAATGGACAATTT
5201 TCAAGGTGCTGATGTGATGTCACAACCTCCGCTACATCCTGAGTAAGTCAGTGTCCCCAACAGCAGATGAGGCTGGGTCT
5281 TTCCTCATTTCTGCTTCTGGGATGACATCAGTGGGAGAGTTGAAGATCTGAGAATTCTAAAGGAAATGTTCTCTGATGGG
5361 AGGAGAGAGGGAACTTATTTCCCTTCAAAGTAGTTTGCTTCTTAAGACCACTCCTCCCTCCAGAATGTCTTTAACCAGAC
5441 ATCATTTCAGAAGGTGGGGCAGCTGCTTCCTTAGGAAGAGTGGGCCTGATAGCTCAACCAACTCCTTTAGCATGTAAACT
5521 CACAGAAGGCAAGAACCCCTTTTTTTAGACTTTCCAAATGCATCCTGCAAAGAGAGAGATAGCTGATAGGGACTGACAAG
5601 CACACTGTTTAGATAAGAAGCAATTAGCCTTTTATATCTGTGCTCTATACATTTTCTATGTGCAGCATCTTTCCTAACTT
5681 GTTGTGGTTCCCGGGTGGCAGGTGCACAGCTGGGAGGGACTGCCGGCTGTTTCGTACAACATTCTTGCCAATTCCCTTGA
5761 GGAGAAAATTCTTCACATGGCTTCTGCATGTACAGTATTTGGGCAGCAAAACATGATTAAAGTCAGTTTGAAAATGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAA--UACACGACGAu 5'
             |:|:: ||  |  ||||||| 
Target 5' aagAGATTCTTTAAAATGCTGCTt 3'
4021 - 4044 149.00 -9.60
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:| |||||   |||||| 
Target 5' atCAGAGCATTA---GCTGCTc 3'
4897 - 4915 140.00 -13.80
3
miRNA  3' gugUUUGGUAAUA-CACGACGau 5'
             :| || ||:|  ||||||  
Target 5' ctgGACCCCTTGTCCTGCTGCat 3'
88 - 110 135.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30534254 5 COSMIC
COSN30128545 128 COSMIC
COSN27698321 135 COSMIC
COSN22787116 176 COSMIC
COSN8469460 429 COSMIC
COSN8469459 461 COSMIC
COSN26548992 494 COSMIC
COSN8469458 503 COSMIC
COSN31527539 507 COSMIC
COSN8469457 565 COSMIC
COSN31548811 578 COSMIC
COSN31577747 727 COSMIC
COSN21006321 976 COSMIC
COSN28744250 1062 COSMIC
COSN26563556 1107 COSMIC
COSN19179508 1206 COSMIC
COSN26548146 1241 COSMIC
COSN31601021 1246 COSMIC
COSN1445457 1345 COSMIC
COSN31547961 1449 COSMIC
COSN26275728 1599 COSMIC
COSN16820125 1652 COSMIC
COSN31486051 1679 COSMIC
COSN31534723 1710 COSMIC
COSN28680592 1804 COSMIC
COSN20090218 1809 COSMIC
COSN20090217 1816 COSMIC
COSN5168350 1837 COSMIC
COSN20090216 1841 COSMIC
COSN26754017 1856 COSMIC
COSN20090215 1858 COSMIC
COSN6456135 1939 COSMIC
COSN8469456 1962 COSMIC
COSN20090214 2038 COSMIC
COSN20090213 2126 COSMIC
COSN20090212 2258 COSMIC
COSN20090211 2686 COSMIC
COSN15200697 2857 COSMIC
COSN17132038 2927 COSMIC
COSN28762746 3300 COSMIC
COSN26134107 3302 COSMIC
COSN31603150 3397 COSMIC
COSN31549716 3497 COSMIC
COSN30165564 3647 COSMIC
COSN27957131 3816 COSMIC
COSN5371890 3927 COSMIC
COSN26178574 3929 COSMIC
COSN8469455 3930 COSMIC
COSN7219678 4135 COSMIC
COSN24297787 4299 COSMIC
COSN26538080 4311 COSMIC
COSN26553709 4323 COSMIC
COSN22301082 4376 COSMIC
COSN28681795 4455 COSMIC
COSN31517428 4574 COSMIC
COSN30164469 5488 COSMIC
COSN7219677 5540 COSMIC
COSN22926915 5628 COSMIC
COSN31513059 5692 COSMIC
COSN4750370 5693 COSMIC
COSN31990083 5725 COSMIC
COSN31562074 5743 COSMIC
COSN31609844 5759 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1335663437 1 dbSNP
rs1292297770 2 dbSNP
rs746333957 7 dbSNP
rs779146287 10 dbSNP
rs771264295 11 dbSNP
rs1330826001 13 dbSNP
rs749606970 14 dbSNP
rs780968887 22 dbSNP
rs1324576051 25 dbSNP
rs754597256 27 dbSNP
rs1288565672 30 dbSNP
rs200400859 33 dbSNP
rs779492636 34 dbSNP
rs368154204 35 dbSNP
rs1409071697 38 dbSNP
rs1419227609 40 dbSNP
rs975894658 46 dbSNP
rs758364843 48 dbSNP
rs201021968 50 dbSNP
rs893982577 52 dbSNP
rs1161638481 54 dbSNP
rs1389226495 55 dbSNP
rs1053912770 56 dbSNP
rs1456820963 62 dbSNP
rs1188796738 65 dbSNP
rs142823636 71 dbSNP
rs1318585067 76 dbSNP
rs1373233382 79 dbSNP
rs867534681 80 dbSNP
rs902295321 84 dbSNP
rs1264973848 88 dbSNP
rs1225248934 90 dbSNP
rs951269579 92 dbSNP
rs553201092 94 dbSNP
rs1488743666 99 dbSNP
rs1206395604 101 dbSNP
rs1274528109 104 dbSNP
rs374157039 109 dbSNP
rs995268419 112 dbSNP
rs949085254 123 dbSNP
rs1341530668 130 dbSNP
rs867127120 137 dbSNP
rs1275705477 138 dbSNP
rs1229848499 141 dbSNP
rs916477001 144 dbSNP
rs1157145322 146 dbSNP
rs1396795582 153 dbSNP
rs1462030978 157 dbSNP
rs183238400 163 dbSNP
rs1444164463 164 dbSNP
rs679663 171 dbSNP
rs909043184 172 dbSNP
rs1226201704 175 dbSNP
rs1294672636 175 dbSNP
rs983307317 175 dbSNP
rs1370303883 176 dbSNP
rs563999071 177 dbSNP
rs1306697380 179 dbSNP
rs951432965 179 dbSNP
rs1207190409 180 dbSNP
rs557113653 182 dbSNP
rs536782148 183 dbSNP
rs999127368 183 dbSNP
rs1180377703 184 dbSNP
rs1369399183 187 dbSNP
rs976757560 190 dbSNP
rs1043254005 192 dbSNP
rs1162709231 192 dbSNP
rs148325884 192 dbSNP
rs903395820 192 dbSNP
rs965764606 193 dbSNP
rs193299468 201 dbSNP
rs774340897 202 dbSNP
rs894097925 203 dbSNP
rs547924962 207 dbSNP
rs528044124 219 dbSNP
rs1355668071 221 dbSNP
rs1271022823 225 dbSNP
rs999677015 236 dbSNP
rs944105386 237 dbSNP
rs188732252 243 dbSNP
rs1340795901 246 dbSNP
rs1482807328 249 dbSNP
rs1046589161 255 dbSNP
rs982721182 267 dbSNP
rs1197786328 270 dbSNP
rs951310169 275 dbSNP
rs919879807 278 dbSNP
rs1187045663 280 dbSNP
rs552465776 286 dbSNP
rs138448540 288 dbSNP
rs563503424 299 dbSNP
rs969274956 302 dbSNP
rs1389466113 305 dbSNP
rs1255799071 316 dbSNP
rs182982710 325 dbSNP
rs1054839635 329 dbSNP
rs941908915 332 dbSNP
rs960714108 334 dbSNP
rs1395111557 338 dbSNP
rs909158716 354 dbSNP
rs1287081103 358 dbSNP
rs1047568777 360 dbSNP
rs754605172 361 dbSNP
rs1299062096 365 dbSNP
rs370752976 371 dbSNP
rs145782981 372 dbSNP
rs1226787071 373 dbSNP
rs574860467 391 dbSNP
rs1021923514 406 dbSNP
rs1171616314 412 dbSNP
rs1466394652 413 dbSNP
rs190698414 418 dbSNP
rs1193964561 430 dbSNP
rs541858805 436 dbSNP
rs1156925769 437 dbSNP
rs1447614333 438 dbSNP
rs1040245493 448 dbSNP
rs1252628291 453 dbSNP
rs140734695 454 dbSNP
rs1465357494 456 dbSNP
rs763828349 464 dbSNP
rs1440753809 465 dbSNP
rs944153488 466 dbSNP
rs1319341138 471 dbSNP
rs878940586 473 dbSNP
rs1362336939 477 dbSNP
rs958269448 477 dbSNP
rs1306190005 478 dbSNP
rs1201245656 483 dbSNP
rs749584930 483 dbSNP
rs778141259 485 dbSNP
rs1273345972 486 dbSNP
rs1353075799 497 dbSNP
rs1047128943 511 dbSNP
rs1267607686 516 dbSNP
rs553264265 520 dbSNP
rs1266565360 521 dbSNP
rs1267959635 532 dbSNP
rs1432435811 535 dbSNP
rs546119037 539 dbSNP
rs1025175803 544 dbSNP
rs1228324679 549 dbSNP
rs951521464 554 dbSNP
rs1365289461 557 dbSNP
rs1027096575 559 dbSNP
rs1470321503 562 dbSNP
rs1157883553 563 dbSNP
rs1317494376 566 dbSNP
rs1013751493 567 dbSNP
rs35360894 569 dbSNP
rs894917996 572 dbSNP
rs1055186908 573 dbSNP
rs111951189 577 dbSNP
rs887672748 578 dbSNP
rs947936826 584 dbSNP
rs916436514 585 dbSNP
rs1460547879 587 dbSNP
rs1047681407 592 dbSNP
rs557174962 596 dbSNP
rs537650943 602 dbSNP
rs568067001 603 dbSNP
rs1327236681 604 dbSNP
rs1235192897 609 dbSNP
rs554609751 611 dbSNP
rs1488137159 625 dbSNP
rs944100312 636 dbSNP
rs1452895589 639 dbSNP
rs911336471 642 dbSNP
rs985398046 647 dbSNP
rs865794669 649 dbSNP
rs1483223017 650 dbSNP
rs1021953004 655 dbSNP
rs1409292795 656 dbSNP
rs958050155 669 dbSNP
rs1475930005 673 dbSNP
rs1164970232 678 dbSNP
rs1456666331 689 dbSNP
rs534337890 696 dbSNP
rs565651044 709 dbSNP
rs978320377 710 dbSNP
rs1399084058 713 dbSNP
rs1018445691 714 dbSNP
rs1307716336 716 dbSNP
rs1322035232 717 dbSNP
rs1348827943 719 dbSNP
rs1301121832 721 dbSNP
rs1416815953 722 dbSNP
rs150263392 722 dbSNP
rs746580710 727 dbSNP
rs1242524120 734 dbSNP
rs562569600 737 dbSNP
rs1342684169 746 dbSNP
rs1367954930 749 dbSNP
rs76723950 753 dbSNP
rs1204147422 754 dbSNP
rs1249215164 763 dbSNP
rs532482385 765 dbSNP
rs185207429 770 dbSNP
rs549754392 774 dbSNP
rs1462772709 780 dbSNP
rs1254888591 782 dbSNP
rs1033449437 784 dbSNP
rs1005854051 791 dbSNP
rs752255314 805 dbSNP
rs1163368509 806 dbSNP
rs898517440 810 dbSNP
rs1038311780 812 dbSNP
rs1168385531 814 dbSNP
rs948001497 820 dbSNP
rs887451847 821 dbSNP
rs529847785 823 dbSNP
rs562047942 824 dbSNP
rs182730712 826 dbSNP
rs923749338 827 dbSNP
rs1287002327 828 dbSNP
rs190085039 829 dbSNP
rs943229061 835 dbSNP
rs1272232275 848 dbSNP
rs1349712043 853 dbSNP
rs967761462 854 dbSNP
rs1255044862 859 dbSNP
rs1021988337 862 dbSNP
rs889844262 867 dbSNP
rs1049802659 871 dbSNP
rs936640364 877 dbSNP
rs749927997 881 dbSNP
rs925284552 890 dbSNP
rs1188421853 894 dbSNP
rs1388716383 896 dbSNP
rs1384486640 898 dbSNP
rs1018983283 901 dbSNP
rs978088346 934 dbSNP
rs1434150959 952 dbSNP
rs1345564417 953 dbSNP
rs778346504 958 dbSNP
rs955567515 967 dbSNP
rs1389402442 976 dbSNP
rs1320279563 985 dbSNP
rs1434299713 986 dbSNP
rs945605762 991 dbSNP
rs559358037 998 dbSNP
rs1372997994 1002 dbSNP
rs1219570861 1003 dbSNP
rs900081273 1020 dbSNP
rs545785003 1021 dbSNP
rs1300217246 1022 dbSNP
rs1310108140 1032 dbSNP
rs1217433904 1036 dbSNP
rs756899400 1038 dbSNP
rs1463999905 1039 dbSNP
rs577167176 1045 dbSNP
rs1025741111 1047 dbSNP
rs1246717326 1048 dbSNP
rs1403481725 1049 dbSNP
rs557187141 1056 dbSNP
rs992715265 1057 dbSNP
rs959572420 1060 dbSNP
rs1164252040 1061 dbSNP
rs570671 1062 dbSNP
rs1412800971 1064 dbSNP
rs1456771795 1067 dbSNP
rs574943696 1073 dbSNP
rs554389951 1081 dbSNP
rs1012694989 1086 dbSNP
rs79568977 1097 dbSNP
rs78665158 1098 dbSNP
rs1388603694 1109 dbSNP
rs895143692 1118 dbSNP
rs1365154476 1120 dbSNP
rs34576828 1121 dbSNP
rs1225118534 1131 dbSNP
rs1056806916 1133 dbSNP
rs984532965 1134 dbSNP
rs951813452 1146 dbSNP
rs1453864194 1147 dbSNP
rs1222886211 1151 dbSNP
rs534924457 1157 dbSNP
rs1025965562 1164 dbSNP
rs993204511 1165 dbSNP
rs901726825 1166 dbSNP
rs1197386704 1171 dbSNP
rs923782366 1172 dbSNP
rs565787644 1173 dbSNP
rs1444188015 1179 dbSNP
rs1222518130 1180 dbSNP
rs1415993441 1185 dbSNP
rs914958595 1190 dbSNP
rs1007766487 1193 dbSNP
rs888956107 1197 dbSNP
rs974518007 1205 dbSNP
rs1054250077 1211 dbSNP
rs1349464333 1217 dbSNP
rs534743675 1218 dbSNP
rs572155330 1219 dbSNP
rs936740232 1226 dbSNP
rs34514774 1233 dbSNP
rs903975978 1236 dbSNP
rs752473326 1238 dbSNP
rs1229393935 1250 dbSNP
rs1227198140 1258 dbSNP
rs1362419713 1268 dbSNP
rs945415884 1270 dbSNP
rs1252861195 1272 dbSNP
rs955600074 1275 dbSNP
rs767465065 1278 dbSNP
rs186114730 1282 dbSNP
rs1239292197 1283 dbSNP
rs1434254241 1307 dbSNP
rs1181273111 1308 dbSNP
rs992432410 1311 dbSNP
rs938299660 1337 dbSNP
rs994263570 1340 dbSNP
rs1399082066 1341 dbSNP
rs1427435487 1354 dbSNP
rs1335701761 1357 dbSNP
rs962843917 1358 dbSNP
rs1017472595 1366 dbSNP
rs1303664241 1371 dbSNP
rs114243295 1374 dbSNP
rs984978750 1379 dbSNP
rs1275818701 1385 dbSNP
rs1341815143 1389 dbSNP
rs895164161 1397 dbSNP
rs181721891 1398 dbSNP
rs1168257802 1401 dbSNP
rs1186896204 1404 dbSNP
rs1235770619 1407 dbSNP
rs774482757 1411 dbSNP
rs569968139 1413 dbSNP
rs550007036 1414 dbSNP
rs1019244313 1424 dbSNP
rs1007468741 1428 dbSNP
rs1402444151 1442 dbSNP
rs1413449257 1444 dbSNP
rs953319881 1455 dbSNP
rs1032794858 1465 dbSNP
rs1270290620 1472 dbSNP
rs1298985877 1473 dbSNP
rs1364997594 1479 dbSNP
rs1225676788 1483 dbSNP
rs1000000440 1486 dbSNP
rs903925159 1487 dbSNP
rs1490715202 1495 dbSNP
rs190805337 1497 dbSNP
rs187141336 1498 dbSNP
rs1039224257 1501 dbSNP
rs896480643 1505 dbSNP
rs911567997 1511 dbSNP
rs535235899 1520 dbSNP
rs955631052 1531 dbSNP
rs1477500430 1536 dbSNP
rs938223564 1541 dbSNP
rs1170377975 1544 dbSNP
rs1413620335 1554 dbSNP
rs926889576 1564 dbSNP
rs528606420 1566 dbSNP
rs773522849 1582 dbSNP
rs1388515054 1592 dbSNP
rs962873013 1595 dbSNP
rs930815951 1599 dbSNP
rs1331979491 1609 dbSNP
rs918969793 1616 dbSNP
rs1017086707 1623 dbSNP
rs1281604465 1628 dbSNP
rs1331379394 1629 dbSNP
rs971846832 1631 dbSNP
rs991323440 1635 dbSNP
rs1484869975 1637 dbSNP
rs959461505 1643 dbSNP
rs140723827 1652 dbSNP
rs150920491 1653 dbSNP
rs750514293 1664 dbSNP
rs569848079 1667 dbSNP
rs1443239897 1672 dbSNP
rs532334137 1677 dbSNP
rs953267825 1682 dbSNP
rs1020908506 1685 dbSNP
rs1157819469 1695 dbSNP
rs1032910980 1699 dbSNP
rs999946654 1700 dbSNP
rs1452282767 1701 dbSNP
rs1165435812 1702 dbSNP
rs563844341 1715 dbSNP
rs893644148 1726 dbSNP
rs112269065 1730 dbSNP
rs1352527602 1732 dbSNP
rs1410621412 1733 dbSNP
rs1287831597 1738 dbSNP
rs1315136611 1745 dbSNP
rs1246989954 1751 dbSNP
rs943118039 1752 dbSNP
rs1355442164 1769 dbSNP
rs1219941103 1773 dbSNP
rs890180370 1776 dbSNP
rs1051454309 1778 dbSNP
rs533217217 1780 dbSNP
rs1471860483 1782 dbSNP
rs570815891 1790 dbSNP
rs575010445 1805 dbSNP
rs182268082 1806 dbSNP
rs1457753556 1812 dbSNP
rs776911403 1816 dbSNP
rs1372743248 1821 dbSNP
rs905419626 1836 dbSNP
rs77850885 1837 dbSNP
rs572216666 1842 dbSNP
rs558636546 1843 dbSNP
rs1397837075 1844 dbSNP
rs866731918 1847 dbSNP
rs747537515 1850 dbSNP
rs1243621894 1856 dbSNP
rs1276530248 1873 dbSNP
rs1036976661 1879 dbSNP
rs1225274049 1880 dbSNP
rs944460195 1887 dbSNP
rs1249242703 1894 dbSNP
rs538645143 1898 dbSNP
rs1483973935 1902 dbSNP
rs911644623 1903 dbSNP
rs959728755 1906 dbSNP
rs1444583433 1907 dbSNP
rs1182220621 1911 dbSNP
rs1392489499 1914 dbSNP
rs1035145303 1916 dbSNP
rs572545488 1917 dbSNP
rs1352952136 1921 dbSNP
rs1467740934 1924 dbSNP
rs931653244 1929 dbSNP
rs547433796 1930 dbSNP
rs1303524915 1935 dbSNP
rs370621550 1936 dbSNP
rs7520333 1939 dbSNP
rs1375582042 1957 dbSNP
rs978642576 1963 dbSNP
rs141219643 1965 dbSNP
rs1447505710 1969 dbSNP
rs1299722555 1976 dbSNP
rs1365728758 1977 dbSNP
rs1407307753 1984 dbSNP
rs966730192 1988 dbSNP
rs1020099739 1992 dbSNP
rs747061392 1993 dbSNP
rs1254916176 2000 dbSNP
rs993096332 2002 dbSNP
rs755811716 2020 dbSNP
rs1388613777 2029 dbSNP
rs1035531214 2030 dbSNP
rs1250423540 2034 dbSNP
rs1465664013 2036 dbSNP
rs535994111 2037 dbSNP
rs1409512819 2044 dbSNP
rs1179770138 2046 dbSNP
rs1017865259 2051 dbSNP
rs1176980344 2055 dbSNP
rs1007428170 2059 dbSNP
rs1428768728 2060 dbSNP
rs1002163902 2062 dbSNP
rs1205273591 2063 dbSNP
rs905201943 2066 dbSNP
rs1389244658 2067 dbSNP
rs890284037 2070 dbSNP
rs567441918 2077 dbSNP
rs1260111600 2088 dbSNP
rs995085444 2095 dbSNP
rs898094547 2101 dbSNP
rs752520755 2106 dbSNP
rs547619518 2107 dbSNP
rs929042794 2109 dbSNP
rs188210579 2112 dbSNP
rs890173961 2118 dbSNP
rs897507148 2126 dbSNP
rs1268165628 2131 dbSNP
rs565847268 2137 dbSNP
rs1050143084 2138 dbSNP
rs1489671172 2140 dbSNP
rs1383739423 2148 dbSNP
rs1192049248 2157 dbSNP
rs1317402281 2161 dbSNP
rs775767756 2167 dbSNP
rs1433401297 2176 dbSNP
rs1479519174 2180 dbSNP
rs1388359993 2187 dbSNP
rs1161498602 2189 dbSNP
rs1412735675 2200 dbSNP
rs1290028646 2202 dbSNP
rs1460224708 2208 dbSNP
rs552220570 2209 dbSNP
rs532393040 2210 dbSNP
rs767279294 2215 dbSNP
rs978424799 2216 dbSNP
rs991470800 2218 dbSNP
rs945974282 2219 dbSNP
rs1411223064 2222 dbSNP
rs1423626977 2224 dbSNP
rs1255958645 2225 dbSNP
rs1223785285 2236 dbSNP
rs112570698 2238 dbSNP
rs1282758045 2239 dbSNP
rs1323925665 2250 dbSNP
rs1222728674 2255 dbSNP
rs992649311 2261 dbSNP
rs1291445388 2262 dbSNP
rs1190902671 2279 dbSNP
rs1385528410 2282 dbSNP
rs938231410 2289 dbSNP
rs928105364 2300 dbSNP
rs1185014731 2310 dbSNP
rs960146661 2313 dbSNP
rs982207293 2315 dbSNP
rs772129003 2317 dbSNP
rs11208546 2325 dbSNP
rs966761418 2330 dbSNP
rs1035075215 2339 dbSNP
rs114969131 2340 dbSNP
rs761123890 2343 dbSNP
rs969499926 2355 dbSNP
rs1363424433 2356 dbSNP
rs751390790 2364 dbSNP
rs1027638564 2367 dbSNP
rs1353479793 2371 dbSNP
rs1439362937 2388 dbSNP
rs766446222 2390 dbSNP
rs1017562210 2393 dbSNP
rs994852889 2395 dbSNP
rs1357655645 2399 dbSNP
rs1007872901 2400 dbSNP
rs1275603460 2402 dbSNP
rs763090482 2414 dbSNP
rs954596047 2423 dbSNP
rs373997292 2424 dbSNP
rs1030091740 2426 dbSNP
rs773469390 2436 dbSNP
rs1383226261 2437 dbSNP
rs1451086989 2439 dbSNP
rs1015595622 2442 dbSNP
rs765536350 2445 dbSNP
rs890612793 2462 dbSNP
rs1050593984 2468 dbSNP
rs931717154 2471 dbSNP
rs1168893840 2475 dbSNP
rs1395274791 2477 dbSNP
rs1407813583 2485 dbSNP
rs1294306401 2494 dbSNP
rs904312162 2495 dbSNP
rs369855983 2496 dbSNP
rs1453989387 2497 dbSNP
rs530464099 2513 dbSNP
rs1381114416 2518 dbSNP
rs897537889 2521 dbSNP
rs945718585 2524 dbSNP
rs1296653156 2529 dbSNP
rs762001523 2534 dbSNP
rs777051280 2544 dbSNP
rs1280835661 2545 dbSNP
rs768837156 2563 dbSNP
rs1203028404 2565 dbSNP
rs1241179934 2567 dbSNP
rs1189009735 2575 dbSNP
rs1005918919 2577 dbSNP
rs1057422118 2581 dbSNP
rs747414285 2582 dbSNP
rs775935588 2584 dbSNP
rs927107788 2605 dbSNP
rs979954835 2612 dbSNP
rs1468820272 2615 dbSNP
rs1176397541 2624 dbSNP
rs1165142759 2628 dbSNP
rs969447606 2638 dbSNP
rs920696161 2647 dbSNP
rs973362565 2653 dbSNP
rs542458781 2658 dbSNP
rs1014962006 2667 dbSNP
rs1428971599 2676 dbSNP
rs183476118 2677 dbSNP
rs1324429416 2678 dbSNP
rs1222953626 2687 dbSNP
rs1261287770 2689 dbSNP
rs1430061725 2705 dbSNP
rs1331162350 2714 dbSNP
rs113902478 2738 dbSNP
rs1260779735 2740 dbSNP
rs1445059631 2754 dbSNP
rs1198594578 2758 dbSNP
rs1246904346 2762 dbSNP
rs1029106832 2771 dbSNP
rs1490550934 2785 dbSNP
rs996316905 2788 dbSNP
rs1271069049 2789 dbSNP
rs1203287033 2790 dbSNP
rs1046562698 2797 dbSNP
rs1338937888 2799 dbSNP
rs1252278866 2802 dbSNP
rs904254908 2806 dbSNP
rs945452428 2810 dbSNP
rs572629641 2822 dbSNP
rs1009869670 2826 dbSNP
rs1281468838 2831 dbSNP
rs1352339926 2835 dbSNP
rs1239761936 2840 dbSNP
rs1260058661 2841 dbSNP
rs1283282148 2843 dbSNP
rs563402871 2846 dbSNP
rs74354808 2847 dbSNP
rs1490088480 2848 dbSNP
rs1253431217 2849 dbSNP
rs958089264 2851 dbSNP
rs1183230762 2853 dbSNP
rs1056838254 2861 dbSNP
rs545094006 2872 dbSNP
rs191682556 2880 dbSNP
rs1165382681 2887 dbSNP
rs927223891 2889 dbSNP
rs910529184 2892 dbSNP
rs1044228499 2893 dbSNP
rs1301517336 2903 dbSNP
rs1372550344 2908 dbSNP
rs931137360 2910 dbSNP
rs1392013562 2914 dbSNP
rs117083668 2915 dbSNP
rs1333940427 2922 dbSNP
rs1246829724 2926 dbSNP
rs1407640509 2927 dbSNP
rs188532836 2932 dbSNP
rs1219873227 2936 dbSNP
rs1276310327 2937 dbSNP
rs755783871 2938 dbSNP
rs1194768722 2941 dbSNP
rs907851431 2950 dbSNP
rs961844686 2957 dbSNP
rs1016005837 2964 dbSNP
rs1463393548 2979 dbSNP
rs1375709944 2981 dbSNP
rs987520112 2985 dbSNP
rs1006364202 3000 dbSNP
rs1161954324 3010 dbSNP
rs1175635608 3011 dbSNP
rs756953917 3012 dbSNP
rs894155586 3013 dbSNP
rs542257719 3016 dbSNP
rs543504051 3018 dbSNP
rs954932834 3020 dbSNP
rs185449675 3023 dbSNP
rs906749545 3035 dbSNP
rs1046677577 3041 dbSNP
rs1437291688 3042 dbSNP
rs1249122986 3058 dbSNP
rs996259382 3059 dbSNP
rs968864857 3060 dbSNP
rs1483946249 3069 dbSNP
rs1206189314 3070 dbSNP
rs1244269156 3085 dbSNP
rs1251559862 3088 dbSNP
rs777270658 3097 dbSNP
rs1182166150 3098 dbSNP
rs1021780964 3099 dbSNP
rs1429343029 3100 dbSNP
rs1010398075 3105 dbSNP
rs914055091 3125 dbSNP
rs755822284 3127 dbSNP
rs28674759 3137 dbSNP
rs891566736 3143 dbSNP
rs1053905592 3144 dbSNP
rs533755254 3146 dbSNP
rs1002555309 3147 dbSNP
rs780905903 3148 dbSNP
rs1044342869 3151 dbSNP
rs931253051 3153 dbSNP
rs1450291289 3160 dbSNP
rs144387859 3176 dbSNP
rs192870346 3180 dbSNP
rs1326215865 3185 dbSNP
rs1036892625 3186 dbSNP
rs148657490 3188 dbSNP
rs910771563 3189 dbSNP
rs1236308574 3193 dbSNP
rs961875561 3196 dbSNP
rs1399844884 3200 dbSNP
rs1016497489 3201 dbSNP
rs1486389746 3206 dbSNP
rs1186195314 3208 dbSNP
rs1259874038 3223 dbSNP
rs1481516786 3229 dbSNP
rs907967558 3236 dbSNP
rs1200253722 3240 dbSNP
rs984576077 3251 dbSNP
rs1307338864 3252 dbSNP
rs538397273 3263 dbSNP
rs571162153 3265 dbSNP
rs922152125 3269 dbSNP
rs189165493 3270 dbSNP
rs968979679 3272 dbSNP
rs1025256394 3275 dbSNP
rs1282106746 3289 dbSNP
rs1470275240 3291 dbSNP
rs1222284859 3293 dbSNP
rs1286928501 3300 dbSNP
rs1317938502 3309 dbSNP
rs1050618666 3313 dbSNP
rs1022192325 3316 dbSNP
rs1259276655 3321 dbSNP
rs989021889 3323 dbSNP
rs1490904616 3332 dbSNP
rs955953612 3337 dbSNP
rs1035447477 3343 dbSNP
rs1002507145 3344 dbSNP
rs905519645 3346 dbSNP
rs570042572 3355 dbSNP
rs1469748347 3361 dbSNP
rs936770271 3367 dbSNP
rs1184261982 3370 dbSNP
rs1367143992 3373 dbSNP
rs1022678618 3374 dbSNP
rs1422247463 3376 dbSNP
rs1424977998 3379 dbSNP
rs367633136 3380 dbSNP
rs1302132630 3399 dbSNP
rs766948727 3404 dbSNP
rs754500717 3406 dbSNP
rs1462913728 3407 dbSNP
rs1266855272 3408 dbSNP
rs1279589174 3422 dbSNP
rs1205046725 3426 dbSNP
rs889163536 3434 dbSNP
rs550195224 3435 dbSNP
rs1050524842 3436 dbSNP
rs933361954 3449 dbSNP
rs923255726 3450 dbSNP
rs995406552 3455 dbSNP
rs1489892549 3467 dbSNP
rs1206756682 3482 dbSNP
rs1240779629 3485 dbSNP
rs1233479339 3488 dbSNP
rs1480276730 3490 dbSNP
rs1175344232 3498 dbSNP
rs1386924824 3511 dbSNP
rs12117629 3513 dbSNP
rs759535690 3514 dbSNP
rs1162578488 3529 dbSNP
rs1383034601 3536 dbSNP
rs1411245911 3538 dbSNP
rs1328960212 3553 dbSNP
rs1037245983 3556 dbSNP
rs940588568 3558 dbSNP
rs765809498 3571 dbSNP
rs958558003 3572 dbSNP
rs866788961 3577 dbSNP
rs886481006 3585 dbSNP
rs1314750900 3592 dbSNP
rs1357583933 3594 dbSNP
rs144162268 3595 dbSNP
rs1316198023 3597 dbSNP
rs548074357 3611 dbSNP
rs17412556 3612 dbSNP
rs565505517 3623 dbSNP
rs878964928 3629 dbSNP
rs1244859336 3639 dbSNP
rs115115440 3640 dbSNP
rs974737739 3656 dbSNP
rs947626352 3657 dbSNP
rs914841478 3660 dbSNP
rs1168128814 3664 dbSNP
rs1476190039 3664 dbSNP
rs989361881 3668 dbSNP
rs1009839906 3675 dbSNP
rs1422800574 3679 dbSNP
rs1408984928 3681 dbSNP
rs956241142 3693 dbSNP
rs1336502861 3695 dbSNP
rs1032516920 3696 dbSNP
rs1001472986 3707 dbSNP
rs1036303412 3708 dbSNP
rs1384896607 3713 dbSNP
rs1361408708 3726 dbSNP
rs981187237 3728 dbSNP
rs969819737 3729 dbSNP
rs1246515194 3744 dbSNP
rs1022626395 3745 dbSNP
rs1324199555 3748 dbSNP
rs1448040651 3753 dbSNP
rs995185945 3759 dbSNP
rs111813299 3762 dbSNP
rs1193520401 3767 dbSNP
rs867485279 3770 dbSNP
rs1356601836 3787 dbSNP
rs1015516599 3804 dbSNP
rs183973632 3807 dbSNP
rs1290660268 3824 dbSNP
rs1474201131 3825 dbSNP
rs542619593 3828 dbSNP
rs1470591635 3835 dbSNP
rs1176331379 3845 dbSNP
rs1400577813 3859 dbSNP
rs1402771473 3876 dbSNP
rs890952203 3879 dbSNP
rs1319344398 3885 dbSNP
rs149947491 3886 dbSNP
rs937197415 3887 dbSNP
rs927138427 3893 dbSNP
rs981203607 3898 dbSNP
rs1222885192 3899 dbSNP
rs997537429 3905 dbSNP
rs1272982936 3908 dbSNP
rs1352629426 3927 dbSNP
rs1205536717 3936 dbSNP
rs1361343096 3937 dbSNP
rs971111141 3942 dbSNP
rs868057192 3951 dbSNP
rs761958432 3956 dbSNP
rs1224172469 3961 dbSNP
rs912903568 3967 dbSNP
rs1479817020 3974 dbSNP
rs900623305 3977 dbSNP
rs61779210 3984 dbSNP
rs1403258722 3991 dbSNP
rs1159521537 3998 dbSNP
rs1384614856 3999 dbSNP
rs957050886 4006 dbSNP
rs1305169246 4011 dbSNP
rs1365024092 4015 dbSNP
rs1033046423 4016 dbSNP
rs1404381884 4023 dbSNP
rs1001105205 4025 dbSNP
rs953701884 4026 dbSNP
rs1239610952 4029 dbSNP
rs1029088840 4037 dbSNP
rs1351229492 4038 dbSNP
rs997560400 4039 dbSNP
rs947408540 4044 dbSNP
rs1417852961 4050 dbSNP
rs1036398062 4056 dbSNP
rs1251974702 4058 dbSNP
rs1005333325 4064 dbSNP
rs1183156563 4070 dbSNP
rs914769781 4078 dbSNP
rs1053366752 4079 dbSNP
rs1475932273 4085 dbSNP
rs934947875 4086 dbSNP
rs1386131913 4093 dbSNP
rs1197362657 4096 dbSNP
rs1424204223 4099 dbSNP
rs1291876924 4103 dbSNP
rs374718044 4103 dbSNP
rs1489669389 4104 dbSNP
rs1467257259 4107 dbSNP
rs530158302 4108 dbSNP
rs981636557 4109 dbSNP
rs1361098885 4114 dbSNP
rs927139719 4123 dbSNP
rs1045548817 4124 dbSNP
rs949786882 4132 dbSNP
rs79737651 4135 dbSNP
rs565424235 4136 dbSNP
rs760915856 4140 dbSNP
rs879084163 4145 dbSNP
rs973697335 4149 dbSNP
rs1185839246 4151 dbSNP
rs1244068814 4167 dbSNP
rs1271921635 4169 dbSNP
rs957284625 4171 dbSNP
rs1162943995 4172 dbSNP
rs1221551440 4174 dbSNP
rs1462543344 4179 dbSNP
rs962411254 4181 dbSNP
rs1015707128 4182 dbSNP
rs1004128352 4190 dbSNP
rs557571505 4193 dbSNP
rs1381758210 4201 dbSNP
rs953630725 4211 dbSNP
rs1297245013 4212 dbSNP
rs1029125079 4213 dbSNP
rs114894476 4214 dbSNP
rs996648867 4217 dbSNP
rs1328398631 4224 dbSNP
rs900572520 4230 dbSNP
rs1264217560 4247 dbSNP
rs569510644 4258 dbSNP
rs1180390403 4259 dbSNP
rs1264087145 4261 dbSNP
rs1429288171 4261 dbSNP
rs966180382 4262 dbSNP
rs562965080 4265 dbSNP
rs1014986404 4269 dbSNP
rs1470953447 4272 dbSNP
rs1410945943 4274 dbSNP
rs1039098326 4277 dbSNP
rs1464326507 4278 dbSNP
rs1290369321 4279 dbSNP
rs1004957969 4282 dbSNP
rs1381248102 4283 dbSNP
rs1275767103 4294 dbSNP
rs1012109636 4297 dbSNP
rs1174920919 4301 dbSNP
rs1225952800 4307 dbSNP
rs1284460779 4326 dbSNP
rs1480356315 4328 dbSNP
rs893133021 4339 dbSNP
rs1262803439 4341 dbSNP
rs1428022870 4347 dbSNP
rs549211982 4357 dbSNP
rs772553728 4373 dbSNP
rs79962397 4375 dbSNP
rs192410635 4376 dbSNP
rs1481444643 4379 dbSNP
rs928893045 4382 dbSNP
rs1045907092 4385 dbSNP
rs775855656 4386 dbSNP
rs949902079 4390 dbSNP
rs1161042407 4403 dbSNP
rs1364097170 4416 dbSNP
rs1438197277 4446 dbSNP
rs948866520 4452 dbSNP
rs186826295 4453 dbSNP
rs139695285 4454 dbSNP
rs10889501 4455 dbSNP
rs985110390 4455 dbSNP
rs922227675 4459 dbSNP
rs571969451 4462 dbSNP
rs1239754123 4465 dbSNP
rs1284105982 4469 dbSNP
rs1490889832 4472 dbSNP
rs745965537 4474 dbSNP
rs529448217 4476 dbSNP
rs982885256 4478 dbSNP
rs966212997 4483 dbSNP
rs12127656 4485 dbSNP
rs1178879061 4488 dbSNP
rs955290262 4493 dbSNP
rs1279250890 4496 dbSNP
rs1156504062 4503 dbSNP
rs1386742204 4508 dbSNP
rs1443124481 4520 dbSNP
rs552009370 4525 dbSNP
rs1335090526 4527 dbSNP
rs1435021214 4537 dbSNP
rs1300389761 4538 dbSNP
rs1469756550 4539 dbSNP
rs1446545656 4544 dbSNP
rs1307462843 4545 dbSNP
rs1407525195 4550 dbSNP
rs1246904823 4551 dbSNP
rs531773613 4560 dbSNP
rs1434461558 4568 dbSNP
rs1405096086 4581 dbSNP
rs963854229 4586 dbSNP
rs1206600024 4587 dbSNP
rs562620693 4595 dbSNP
rs952126990 4598 dbSNP
rs1457234502 4599 dbSNP
rs1176570535 4604 dbSNP
rs1244672504 4620 dbSNP
rs1176271106 4641 dbSNP
rs770941002 4645 dbSNP
rs1011642614 4648 dbSNP
rs893238396 4650 dbSNP
rs150613428 4651 dbSNP
rs1201585193 4652 dbSNP
rs1329738896 4653 dbSNP
rs528961857 4656 dbSNP
rs1385433650 4661 dbSNP
rs999278307 4673 dbSNP
rs1283800203 4687 dbSNP
rs559751704 4688 dbSNP
rs1377121154 4700 dbSNP
rs1216436374 4708 dbSNP
rs907412048 4711 dbSNP
rs1046019763 4721 dbSNP
rs1014167293 4748 dbSNP
rs1196668843 4771 dbSNP
rs1263753003 4771 dbSNP
rs1205469659 4777 dbSNP
rs891646348 4781 dbSNP
rs1461586167 4804 dbSNP
rs1052934028 4806 dbSNP
rs935751964 4810 dbSNP
rs1186603849 4816 dbSNP
rs1422206909 4823 dbSNP
rs904306099 4826 dbSNP
rs1169154149 4839 dbSNP
rs948985331 4855 dbSNP
rs1224570801 4857 dbSNP
rs1333876601 4860 dbSNP
rs894646962 4868 dbSNP
rs539833672 4869 dbSNP
rs941107869 4870 dbSNP
rs1357668720 4871 dbSNP
rs1278987450 4880 dbSNP
rs1339916984 4882 dbSNP
rs1216772951 4888 dbSNP
rs1375736655 4896 dbSNP
rs577562644 4903 dbSNP
rs577016331 4908 dbSNP
rs746781418 4913 dbSNP
rs908303471 4921 dbSNP
rs982446304 4924 dbSNP
rs933654928 4928 dbSNP
rs780055923 4932 dbSNP
rs922260129 4934 dbSNP
rs374700233 4940 dbSNP
rs758406992 4945 dbSNP
rs77231024 4946 dbSNP
rs575310175 4949 dbSNP
rs182104650 4952 dbSNP
rs944937338 4953 dbSNP
rs1487011640 4956 dbSNP
rs1192179826 4962 dbSNP
rs1022070597 4963 dbSNP
rs750321712 4966 dbSNP
rs536371819 4967 dbSNP
rs983607220 4968 dbSNP
rs1423498126 4971 dbSNP
rs989731330 4976 dbSNP
rs1342957959 4977 dbSNP
rs957452506 4985 dbSNP
rs1331622053 4989 dbSNP
rs1232356973 4993 dbSNP
rs1272927270 4996 dbSNP
rs1032174078 5001 dbSNP
rs778923600 5004 dbSNP
rs757236227 5005 dbSNP
rs190440222 5008 dbSNP
rs1181364372 5013 dbSNP
rs1284834379 5017 dbSNP
rs76796863 5020 dbSNP
rs369967282 5026 dbSNP
rs764200123 5027 dbSNP
rs1224101718 5041 dbSNP
rs1243465660 5044 dbSNP
rs1183526670 5045 dbSNP
rs1452700153 5050 dbSNP
rs1484827717 5059 dbSNP
rs1241615880 5062 dbSNP
rs1245392115 5067 dbSNP
rs138300736 5068 dbSNP
rs74582869 5070 dbSNP
rs1038508871 5078 dbSNP
rs185677359 5079 dbSNP
rs1379935566 5081 dbSNP
rs1418029446 5083 dbSNP
rs753054508 5085 dbSNP
rs886823651 5089 dbSNP
rs1165549544 5106 dbSNP
rs1047260785 5113 dbSNP
rs1391536209 5114 dbSNP
rs1386200234 5117 dbSNP
rs1014198544 5119 dbSNP
rs1337357069 5120 dbSNP
rs1447292114 5122 dbSNP
rs538456024 5127 dbSNP
rs146372144 5128 dbSNP
rs549539944 5134 dbSNP
rs922253602 5135 dbSNP
rs1317563988 5142 dbSNP
rs1381047488 5149 dbSNP
rs1265575319 5155 dbSNP
rs975077545 5162 dbSNP
rs942590954 5163 dbSNP
rs1209810132 5166 dbSNP
rs866143004 5167 dbSNP
rs1288385907 5179 dbSNP
rs1459440485 5180 dbSNP
rs1000072262 5181 dbSNP
rs1179664965 5182 dbSNP
rs1237881225 5187 dbSNP
rs767799190 5190 dbSNP
rs1185642998 5193 dbSNP
rs1369179881 5194 dbSNP
rs183808825 5197 dbSNP
rs1161497774 5203 dbSNP
rs1398575674 5214 dbSNP
rs1361880986 5223 dbSNP
rs559812569 5226 dbSNP
rs1330431895 5229 dbSNP
rs956752095 5230 dbSNP
rs996525059 5231 dbSNP
rs1339469847 5234 dbSNP
rs1030866757 5235 dbSNP
rs772660507 5245 dbSNP
rs142164870 5249 dbSNP
rs755910382 5253 dbSNP
rs747742711 5259 dbSNP
rs1199813712 5260 dbSNP
rs971497583 5269 dbSNP
rs1257882203 5275 dbSNP
rs372732666 5278 dbSNP
rs1202443785 5284 dbSNP
rs1257167665 5286 dbSNP
rs532724772 5335 dbSNP
rs1423418885 5347 dbSNP
rs1024300809 5348 dbSNP
rs1425787772 5351 dbSNP
rs1478147074 5360 dbSNP
rs1169843028 5364 dbSNP
rs1397893124 5367 dbSNP
rs1470849597 5371 dbSNP
rs1166584741 5374 dbSNP
rs1012936731 5387 dbSNP
rs1401070976 5397 dbSNP
rs1393865288 5407 dbSNP
rs958922097 5413 dbSNP
rs564053662 5419 dbSNP
rs780848795 5420 dbSNP
rs1187027675 5439 dbSNP
rs1489321865 5441 dbSNP
rs908150902 5446 dbSNP
rs544148964 5450 dbSNP
rs1017606924 5454 dbSNP
rs759905338 5455 dbSNP
rs148341793 5459 dbSNP
rs1198945673 5472 dbSNP
rs1265506173 5473 dbSNP
rs1047249853 5490 dbSNP
rs1192987063 5495 dbSNP
rs1421412626 5496 dbSNP
rs1434773909 5508 dbSNP
rs1225750176 5510 dbSNP
rs1176530354 5515 dbSNP
rs920746167 5519 dbSNP
rs1464281473 5522 dbSNP
rs1290243386 5523 dbSNP
rs980223310 5533 dbSNP
rs112914073 5538 dbSNP
rs112300496 5539 dbSNP
rs780342765 5546 dbSNP
rs574186747 5553 dbSNP
rs1302496985 5554 dbSNP
rs942371299 5557 dbSNP
rs1231402479 5566 dbSNP
rs915126231 5574 dbSNP
rs1054102953 5581 dbSNP
rs1288461935 5583 dbSNP
rs1341840046 5586 dbSNP
rs1300695700 5591 dbSNP
rs1403974136 5596 dbSNP
rs1365859743 5597 dbSNP
rs935299564 5603 dbSNP
rs1489461758 5607 dbSNP
rs956023504 5611 dbSNP
rs923753332 5613 dbSNP
rs1266468645 5616 dbSNP
rs1431201893 5623 dbSNP
rs1031611093 5634 dbSNP
rs981973262 5641 dbSNP
rs1294888139 5645 dbSNP
rs1156314151 5649 dbSNP
rs765644399 5656 dbSNP
rs554270847 5658 dbSNP
rs1000509029 5659 dbSNP
rs117472915 5662 dbSNP
rs917359102 5679 dbSNP
rs968595106 5681 dbSNP
rs1372234141 5686 dbSNP
rs1171070400 5692 dbSNP
rs1284043460 5693 dbSNP
rs578052560 5704 dbSNP
rs1028553174 5720 dbSNP
rs1427316225 5721 dbSNP
rs568807132 5724 dbSNP
rs958704215 5725 dbSNP
rs1238490129 5726 dbSNP
rs1438773906 5729 dbSNP
rs1269824474 5733 dbSNP
rs558112464 5734 dbSNP
rs1405416018 5737 dbSNP
rs1006215221 5738 dbSNP
rs1163399676 5739 dbSNP
rs951690468 5751 dbSNP
rs1026203997 5758 dbSNP
rs768183197 5759 dbSNP
rs998326581 5760 dbSNP
rs1460272270 5775 dbSNP
rs1333865959 5777 dbSNP
rs900890043 5785 dbSNP
rs1446383024 5788 dbSNP
rs1252179264 5790 dbSNP
rs116096348 5793 dbSNP
rs1321970598 5807 dbSNP
rs1228986388 5811 dbSNP
rs1048002957 5816 dbSNP
rs1319858829 5827 dbSNP
rs930860968 5833 dbSNP
rs1222412449 5835 dbSNP
rs113318801 5838 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAA-UACACGACGAu 5'
              | :| || |  ||||||| 
Target 5' ----AUUCUUUAAAAUGCUGCUu 3'
1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000372684.3 | 3UTR | AUUCUUUAAAAUGCUGCUUCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000372684.3 | 3UTR | AUUCUUUAAAAUGCUGCUUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000372684.3 | 3UTR | AUUCUUUAAAAUGCUGCUUCUUCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000372684.3 | 3UTR | AUUCUUUAAAAUGCUGCUUCUUCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.69 1.3e-4 -0.641 4.9e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.607 2.3e-3 -0.705 2.6e-4 20 Click to see details
GSE19783 ER- ER- breast cancer -0.3 3.6e-3 -0.314 2.4e-3 79 Click to see details
GSE21032 Prostate cancer -0.236 1.6e-2 -0.225 2.0e-2 83 Click to see details
GSE19536 Breast cancer -0.199 2.4e-2 -0.214 1.6e-2 100 Click to see details
GSE21687 Ependynoma primary tumors -0.249 2.4e-2 -0.262 1.8e-2 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.322 5.8e-2 -0.595 8.5e-4 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.23 1.3e-1 -0.278 8.9e-2 25 Click to see details
GSE21849 B cell lymphoma -0.198 1.5e-1 -0.180 1.8e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.196 2.0e-1 0.319 8.5e-2 20 Click to see details
GSE28260 Renal cortex and medulla 0.21 2.5e-1 0.044 4.4e-1 13 Click to see details
GSE17306 Multiple myeloma -0.1 2.5e-1 -0.069 3.2e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.061 2.8e-1 -0.067 2.7e-1 90 Click to see details
GSE38226 Liver fibrosis 0.096 3.4e-1 0.004 4.9e-1 21 Click to see details
GSE17498 Multiple myeloma -0.066 3.4e-1 -0.109 2.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.045 4.2e-1 0.081 3.5e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.041 4.5e-1 0.049 4.4e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.029 4.6e-1 -0.150 2.9e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.006 4.9e-1 -0.055 3.8e-1 32 Click to see details
GSE28544 Breast cancer 0.005 4.9e-1 -0.149 2.4e-1 24 Click to see details
GSE28544 Breast cancer 0.005 4.9e-1 -0.149 2.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.638 0 -0.630 0 32 Click to see details
BRCA -0.366 0 -0.384 0 84 Click to see details
BLCA -0.569 0.01 -0.579 0.01 18 Click to see details
PRAD -0.245 0.04 -0.244 0.04 50 Click to see details
THCA -0.16 0.11 -0.177 0.09 59 Click to see details
LIHC 0.157 0.14 0.203 0.08 49 Click to see details
CESC 0.877 0.16 0.500 0.33 3 Click to see details
KIRP 0.143 0.22 0.120 0.26 32 Click to see details
LUAD 0.242 0.22 0.217 0.25 12 Click to see details
PAAD 0.515 0.24 0.400 0.3 4 Click to see details
HNSC -0.092 0.28 -0.154 0.17 42 Click to see details
CHOL -0.166 0.33 -0.100 0.4 9 Click to see details
PCPG -0.39 0.37 -0.500 0.33 3 Click to see details
KICH 0.05 0.41 0.018 0.47 25 Click to see details
ESCA -0.061 0.43 0.155 0.32 11 Click to see details
COAD -0.063 0.44 -0.024 0.48 8 Click to see details
LUSC 0.022 0.45 0.048 0.39 38 Click to see details
UCEC 0.019 0.47 -0.082 0.37 19 Click to see details
KIRC 0.004 0.49 0.013 0.46 68 Click to see details
KIRC 0.004 0.49 0.013 0.46 68 Click to see details
KIRC 0.004 0.49 0.013 0.46 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11