miRTarBase - #MIRT505505 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SRSF1   
Synonyms ASF, SF2, SF2p33, SFRS1, SRp30a
Description serine and arginine rich splicing factor 1
Transcript NM_001078166   
Other Transcripts NM_006924   
Expression
Putative miRNA Targets on SRSF1
3'UTR of SRSF1
(miRNA target sites are highlighted)
>SRSF1|NM_001078166|3'UTR
   1 CAGTGGAATTTCAAGGTAAGGATTCAGGCAAGGTTGTCCAAGTAAATTGCCAGATTTCTGGTTTTAGTTACATTGTATTC
  81 ATTCAGCATGTCTGAAGATAGATGAAAGCTTAGATCTTTCAATGGAAAGTTCTGTCTATCCAATAGGGAGAAACTGCCTA
 161 CATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCAAGTTATGGAAGATCTCGATCTCGAAGCCGTAGTCGTAGCAGAAGCC
 241 GTAGCAGAAGCAACAGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGATCACCACGCTATTCTCCCCGTCATAGC
 321 AGATCTCGCTCTCGTACATAAGATGATTGGTGACACTTTTTGTAGAACCCATGTTGTATACAGTTTTCCTTTATTCAGTA
 401 CAATCTTTTCATTTTTTAATTCAAACTGTTTTGTTCAGAATGGGCTAAAGTGTTGAATTGCATTCTTGTAATATCCCCTT
 481 GCTCCTAACATCTACATTCCCTTCGTGTCTTTGATAAATTGTATTTTAAGTGATGTCATAGACAGGATTGTTTAAATTTA
 561 GTTAACTCCATACTCTTCAGACTGTGATATTGTGTAAATGTCTATCTGCCCTGGTTTGTGTGAACTGGGATGTTGGGGGT
 641 GTTTGTGGTTATCTTACCTGGGGAAGTTCTTATGTTTATCTTGCTTTTCATGTGTCTTTCTGTAGACATATCTGAAGAGA
 721 TGGATTAAGAATGCTTTGGATTAAGGATTGTGGAGCACATTTCAATCATTTTAGGATTGTCAAAAGGAGGATTGAGGAGG
 801 ATCAGATCAATAATGGAGGCAATGGTATGACTCCAAGTGCTATTGTCACAGATGAAATTGGCAGTATTGACCTTATACTA
 881 AAAGGCAGGGGTTAAAAATGATTATATACATTTTCCTTAAAACACTTGCAAACATTTTATTCAGTTGTCTTTAGCTACAA
 961 TTGCTTTGCTTTTTAAACCTTGGCAATTGTGGCAAAATTATATTGCCCATTTTGTAGCAACTTATTTTGCTCCCTTCCCC
1041 CCATTTTTGTTTTAATAGGGACTAATGTGGGAAGAACTGGCTAATTTGTCACAGTGCTTAGTTACAACTGTTAATGTGTG
1121 ACCTGCTGTTGGTGTACATGTGGGTACAGGGTGTTTTTAAATCCAACAAGATAGAGTATAATATCAATACTGCTAAATCT
1201 GCATGTCCTCTGTGTGACTGATAGAGCGTTGCTATTTCATTTTTTTAAGACAAAATGAAAGCAAAATATAGAGTTCCAAT
1281 GTATTGGTGTAGATAATCTAGTTGGGAATACTTTTAAGTCTCACCTTCCCCTTTAAACTAATATTCATAATTGGTTCATA
1361 TGTTTAAAAGACTTTAATTTACAAATTAAATTGCAAATGGGAGCATTAGATTTAGTTTTAGACTTAGGTGGGTAGCAATG
1441 CCAGTAAACTTAAATTACGTAACTTCTTGCAACCACGAAACCTGTAATACGCTGTACAGTAACAAGTGTTGGCATTATCA
1521 GTTGAACTGTAAATACAAAATGCTTCTTCCAATTAGTCTCTATGATGATTAAGTTTCTAAAATTTATCTGAACACCATTC
1601 AGAAACTTGTTTTGGGGAATTTGATAGTTATTGATGTGCATCTGTTAAACTGATGACAGACATAACTCATCATTCCCCAG
1681 AAACCTTTTTTGATTACAGTATCTAACATTTTGCCTCCTCTTTTTTGGTTTTGCTGGTTATAAAGGTTTGGATTGGAGAG
1761 GGCTCACTGGATCCCAATCCTTGGAGCTGGATCATTGGATTCAAATCATAATGTGGATAGGATAGGGAGGATGAATTACC
1841 AGGATTCATGGAGCGGGATCAGATTACCAGGAACATAGGAGTGGATTCCTGCCCCAACCAAACCGCATTCGTGTGGATTT
1921 TTTTATTCAACTTAATTGGCTATTCCAAAGATTTTTTTTTTCCTATTTTTGACGATTGGAGCCCTTAAGATGCACGATGG
2001 AATTGTGTTTTGCGTTTTTTGGTAAAAGGAGCAAAGCGAGGACCTGGAGATAAACGCTGGAGCAATCTCCTTGGAAGGAT
2081 TCAGCACGAGTAGATGGTAAACATTTAAAGGGGAAAGGGGGGGTTTGTTTAAAATAGTAAATCAGTAAGTCACTTCTAAA
2161 TTTAAAGAAAACAAAATTGGAGTTGAAGAATAAGTAGGTTTCCAATTGGCTATTGCCGTTTTCTTTGAAAAAATAAACAT
2241 TTTTTAAAAAACTATGCATGGTTGTCCTTTTTCCTCTTCATGTAAGATTCTAACTGGGTCTATCAGTTAATCTTTAAATT
2321 GTTAAGTAAGATAAGATTTTGACTCTTGTGTTAATGTGTTAGCAAATTAAAAGTTCTTAAAAGGCAATCTAATGGTATTA
2401 GCCATCTTTTATTGTTAATTGTAAAAGTCTTCAGGGGAAAGCAAAAGGGGAGAATAAGGCATTTGTGTATGTAACTTGGT
2481 AAATGACGGTGGGGGATGGATCTAGCATCTGAAAGATAAGCTTCTCTACTTTGTTATAAAGTGGTTAAAAAACTATAGAT
2561 GCTGCTTATTTTCTGGTGGTCATAGACAACATAGGCTTTTGTGCAAAATTGGTTGATGGCTACTAATGTTCACTTGGAGA
2641 TAGCTTTTGATATTCTCAATGAAACTCATCTCAAAAAAAGGTAAGTATTAAATGTTAACATCAGCACAGATGTATTAGAA
2721 CTGTTTTTTGTTTTTGAGACAGAGTCTCGCTCTGTTCTCCAGACTGGAGGGCAGTGGTGTGATCTAGGCTCACTGCAACC
2801 TCCACCCCTGGATTTGAGTGATTCTCGTGCCTCAGTCTCCCAAGTAGCTGAGACTACAAGTGTGTGCCACCCTTGCCCGG
2881 CTAATTTTGTATTTTTAGTAGAGATGTGGTTTCTCTGTGTTACCCAGGCTGGTCCCAAAACTCCTGGCCTCAAGTGATCT
2961 GCCTGCCTTGGCCTCCCAAAGTGTTAGGATTACAGGTGTGAGCCACCATGCTCAGCCTGTAGAACTTTTAACCCAAGTCT
3041 CATTTCTTTTTTGAAAGGGAAGAGTGCACAAGATTAACTGCTTCTTTGGATGAATCATTGTTAATAAAAAGCTGGGCATT
3121 TAGAATTTTGCCTTATAAGCCCTTCTCCAACCATAAGATTATTTTGTACCAAAAACTTTGGTGTTCTCTACCAAAGCAGT
3201 TAAAAACTTTTAGCCTGCTACTTCTTGTATTTGTCTACTGACAGCCCCTTGGTACTATTTAGGTTGGGGGAGGGGACCTA
3281 AAATAAATAGACTTTAACATTTCCCTTGGGTGCTAATCATAGTTGGAAGTTGAATTTAAGGTGATTATTTGGGTGACAAT
3361 TAAAAACCTAAGGAAAACCAGAAATCTTGGTAGTGGAAGAAATGTGTAAGGTCACCCCAATCGGTAGATTTTAATGAACG
3441 TTGTGGAATGTTGGGAAGAGGGGATGTTAAGTTGAATGCAGAATTTCACTAAGTACTTAGTGTAAGTTTAAGGATGTAGC
3521 TCTTTTTATCTAAGAATTCAATGTAATGGCCAAAAGGCAGATTTACTGTTTAAAAATTTGAATAATTTTACATGACATTC
3601 TTGAAATTCTAAGAAGTTTTATGTGTAGAACATTTTAAAAATTCATCAGATTATTAAAGGGAAAATAAATGATTAATGAT
3681 AATTTTGGAAGGTTAATGTGAGCTAGACTTAAGTAAACTTTGGTTCATTTGTGTTCATTGAATGTTTTGGAAATGACCAA
3761 AAAATGTAAATGGCCTTCACTCAAGTTTGAGTGTTTAAAGTTGAAAGATGTGCTCTACTAAAAGTTATAGTAATTCTAAC
3841 CTCACATTGAAATGAGACAGTATTCCTTGTTATACAGGCTGAATTTGAAGATTAGAGAGGATCTAATGTTTACTTAGGTA
3921 AAGGGGCATAGGTTTTGTAGTTAAGATGACCAGACAGCTAAAAGCTGTGATGGGAAGTATGGACTGCTCCTATTTATAGT
4001 CTCAGAAAATGGACCTTTAGGTCTCTATCCGTATTGGCAATTATTAGAAGAAAGTTACACCCTTTTGAAACTACAAAAGC
4081 TGTCTTGGAATTTCCCCCTCTTCTCCCTATTTATGTCCCCTTAGAATATTTTAGGGAGCCTATAATTATTTTCTAACCAA
4161 GGAAAAACTTAAGTCTCTTTAAGAAGCAATTACTTTTCATAACATCAGATTGAATAACCCACCTTGCTGTTCAGCCCACA
4241 TCCTACTGGAAACAAAAGGTAAGAAACCCATTTTCTGGTTCTTGATTGTTTGGGTCTGAATTTTGTTTTTAAAACTAAGC
4321 TAAGTTTAATGTTTTTTAAAATGCTGTTTGGAATATGAATAGATTCCCCGTAAAATGATTTTTCCTAAGTTTTATGCTTT
4401 AGTAAATATTCAGTGCTCACGTCTGTGCATCATAGTGCTTGCGTTTAATATGATTTATTGTAGAATCTCAACTTTTCTTG
4481 GTGTTTGTTGTCTTTGAAACATTGTCTTGGTCATTAGGGCTGGTGTTTTCACATTTCTGTGGTCAAGGTGGATTTCTTAT
4561 GTGTGCCTTTTTGCTTACTTTGTATATGAATTTTGTAATTTAAATTGCAAGTAAGTTATATATATGTATTTACCATAAAT
4641 AGTATTAAAAGATGAGAAACTGTTAGACTGAAGTTCTGTTGTAACATAACCATTATTTCCATCACAGTATGAAGACTGCA
4721 AACGCAGAAAACAGATTACAGTCTCTTATCCATTTTTTGAAATCCAAAAACTACGAAAACAAAAGATTTTCTGTTGTTGA
4801 GCTAATTAAATGTGAACCCTGACCAGAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:| ||  ||||||| 
Target 5' aaaAAACTA-TAGATGCTGCTt 3'
2547 - 2567 162.00 -13.20
2
miRNA  3' guguUUGGUAAU-----AC---ACGACGAu 5'
              |||::|||     ||   |||||:| 
Target 5' ttacAACTGTTAATGTGTGACCTGCTGTTg 3'
1102 - 1131 138.00 -14.10
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||  ||| | ||:||:| 
Target 5' aaCAAAAGATTTTCTGTTGTTg 3'
4778 - 4799 136.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168828 5 COSMIC
COSN31522212 36 COSMIC
COSN1199086 85 COSMIC
COSN1199085 90 COSMIC
COSN19521435 131 COSMIC
COSM1384645 146 COSMIC
COSM4500270 154 COSMIC
COSM3519957 159 COSMIC
COSM1734851 162 COSMIC
COSM6790584 162 COSMIC
COSM4500654 164 COSMIC
COSM9165555 167 COSMIC
COSM8877063 175 COSMIC
COSM3795853 177 COSMIC
COSM8396355 205 COSMIC
COSM6301719 209 COSMIC
COSM9220844 211 COSMIC
COSM9577350 216 COSMIC
COSM8536181 223 COSMIC
COSM9551034 223 COSMIC
COSM8411822 228 COSMIC
COSM9576162 232 COSMIC
COSM9890049 235 COSMIC
COSM7236697 295 COSMIC
COSM6147133 298 COSMIC
COSM8223026 304 COSMIC
COSM1303098 307 COSMIC
COSM8399777 312 COSMIC
COSM981712 325 COSMIC
COSM5418781 333 COSMIC
COSM6790583 334 COSMIC
COSM4068066 336 COSMIC
COSN30160014 365 COSMIC
COSN31486196 367 COSMIC
COSN30684653 380 COSMIC
COSN13733975 394 COSMIC
COSN30520148 396 COSMIC
COSN29994446 405 COSMIC
COSN506195 416 COSMIC
COSN30504412 422 COSMIC
COSN26677240 426 COSMIC
COSN1081991 450 COSMIC
COSN31492622 484 COSMIC
COSN31540346 504 COSMIC
COSN30506867 519 COSMIC
COSN24305931 623 COSMIC
COSN30105188 635 COSMIC
COSN31577385 730 COSMIC
COSN22788301 742 COSMIC
COSN20839408 761 COSMIC
COSN17316445 780 COSMIC
COSN16129855 790 COSMIC
COSN23073828 878 COSMIC
COSN26649514 909 COSMIC
COSN22007811 925 COSMIC
COSN8343013 1044 COSMIC
COSN19455175 1058 COSMIC
COSN31517226 1086 COSMIC
COSN9671502 1089 COSMIC
COSN15570874 1090 COSMIC
COSN28896609 1178 COSMIC
COSN30544836 1236 COSMIC
COSN7440839 1263 COSMIC
COSN27922843 1311 COSMIC
COSN7440838 1452 COSMIC
COSN8603455 1457 COSMIC
COSN30175282 1458 COSMIC
COSN32056888 1458 COSMIC
COSN31487984 1466 COSMIC
COSN31512982 1475 COSMIC
COSN31588482 1516 COSMIC
COSN6107916 1690 COSMIC
COSN31565437 1720 COSMIC
COSN26640157 1734 COSMIC
COSN8603454 1843 COSMIC
COSN29468471 1854 COSMIC
COSN19443164 1933 COSMIC
COSN31529689 1937 COSMIC
COSN31537401 1951 COSMIC
COSN15564859 1952 COSMIC
COSN19443163 1957 COSMIC
COSN4769841 1961 COSMIC
COSN22512480 2014 COSMIC
COSN26677704 2037 COSMIC
COSN505790 2055 COSMIC
COSN20114228 2554 COSMIC
COSN29343259 2645 COSMIC
COSN196193 2672 COSMIC
COSN15335785 2784 COSMIC
COSN22015427 2885 COSMIC
COSN22459164 2943 COSMIC
COSN8840561 3269 COSMIC
COSN8244465 3479 COSMIC
COSN7440837 3505 COSMIC
COSN23018563 3595 COSMIC
COSN22903405 3617 COSMIC
COSN24084400 3678 COSMIC
COSN20883732 3731 COSMIC
COSN20885300 3829 COSMIC
COSN27423484 4035 COSMIC
COSN32094103 4095 COSMIC
COSN21640478 4195 COSMIC
COSN26461793 4209 COSMIC
COSN17968531 4370 COSMIC
COSN24378562 4421 COSMIC
COSN5179722 4537 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1180324111 1 dbSNP
rs938787352 2 dbSNP
rs1379306192 5 dbSNP
rs763236608 11 dbSNP
rs773720503 14 dbSNP
rs1000390268 17 dbSNP
rs770234977 22 dbSNP
rs1156924836 29 dbSNP
rs751428451 29 dbSNP
rs546734595 31 dbSNP
rs371619540 33 dbSNP
rs1203544372 36 dbSNP
rs567721942 46 dbSNP
rs1460374173 50 dbSNP
rs927782094 53 dbSNP
rs549142905 58 dbSNP
rs371122113 72 dbSNP
rs946313896 82 dbSNP
rs1373239666 83 dbSNP
rs977961873 85 dbSNP
rs1390174150 86 dbSNP
rs1327410266 87 dbSNP
rs768597963 97 dbSNP
rs747314123 105 dbSNP
rs150523813 109 dbSNP
rs1293056729 110 dbSNP
rs915181765 111 dbSNP
rs1230193365 114 dbSNP
rs1365243803 120 dbSNP
rs1335505223 123 dbSNP
rs564017343 125 dbSNP
rs745603397 126 dbSNP
rs779019819 132 dbSNP
rs1461326095 134 dbSNP
rs757298380 138 dbSNP
rs749155326 140 dbSNP
rs777396915 142 dbSNP
rs755570514 156 dbSNP
rs1321037482 167 dbSNP
rs752398190 182 dbSNP
rs142072157 200 dbSNP
rs758783222 209 dbSNP
rs1201365357 210 dbSNP
rs1480485294 215 dbSNP
rs1250011832 228 dbSNP
rs750745277 240 dbSNP
rs765557047 241 dbSNP
rs922052603 242 dbSNP
rs762358763 245 dbSNP
rs776990823 250 dbSNP
rs766382386 252 dbSNP
rs1480234056 260 dbSNP
rs1342157800 266 dbSNP
rs1313406697 272 dbSNP
rs1390769743 276 dbSNP
rs147579081 278 dbSNP
rs973872647 286 dbSNP
rs777412938 301 dbSNP
rs953693927 313 dbSNP
rs1309625667 335 dbSNP
rs1431798380 340 dbSNP
rs1371477103 347 dbSNP
rs1451557004 348 dbSNP
rs1162977701 354 dbSNP
rs760610043 356 dbSNP
rs1370292987 359 dbSNP
rs201886207 367 dbSNP
rs1427444910 370 dbSNP
rs368232385 371 dbSNP
rs907735470 373 dbSNP
rs769477719 376 dbSNP
rs746053111 382 dbSNP
rs763039593 383 dbSNP
rs2233912 385 dbSNP
rs1292682232 388 dbSNP
rs770833120 388 dbSNP
rs749311042 389 dbSNP
rs983246710 392 dbSNP
rs747772404 403 dbSNP
rs976461011 405 dbSNP
rs1455971335 410 dbSNP
rs970643803 411 dbSNP
rs1165129949 418 dbSNP
rs1295963554 418 dbSNP
rs1024837007 420 dbSNP
rs1267120230 426 dbSNP
rs1490509974 428 dbSNP
rs1221835912 431 dbSNP
rs1266868027 433 dbSNP
rs965165571 436 dbSNP
rs1474609489 444 dbSNP
rs1016138004 446 dbSNP
rs767644683 447 dbSNP
rs1187354656 450 dbSNP
rs1419204203 450 dbSNP
rs1004402883 464 dbSNP
rs1427078273 466 dbSNP
rs1167415281 475 dbSNP
rs370739604 475 dbSNP
rs1424662916 476 dbSNP
rs1301921832 485 dbSNP
rs1363189872 495 dbSNP
rs1410943572 496 dbSNP
rs1401415651 499 dbSNP
rs1270376732 501 dbSNP
rs1187735224 504 dbSNP
rs781025039 505 dbSNP
rs1212573212 511 dbSNP
rs1359981344 513 dbSNP
rs1241430713 519 dbSNP
rs959276872 528 dbSNP
rs1289622768 530 dbSNP
rs1489330456 531 dbSNP
rs1032092592 532 dbSNP
rs560001615 535 dbSNP
rs532394151 538 dbSNP
rs1206656622 546 dbSNP
rs1485051525 553 dbSNP
rs1183963615 558 dbSNP
rs758743382 561 dbSNP
rs1162254436 565 dbSNP
rs902251403 567 dbSNP
rs541584596 572 dbSNP
rs1318474995 573 dbSNP
rs1344232466 578 dbSNP
rs1428218871 580 dbSNP
rs189451464 581 dbSNP
rs1383287603 592 dbSNP
rs890740837 595 dbSNP
rs1312794291 602 dbSNP
rs938716954 603 dbSNP
rs779400502 604 dbSNP
rs1224398870 605 dbSNP
rs561024789 610 dbSNP
rs1315287840 611 dbSNP
rs996198422 618 dbSNP
rs1287861646 628 dbSNP
rs1182180488 636 dbSNP
rs1395011102 637 dbSNP
rs1240557407 638 dbSNP
rs900467933 648 dbSNP
rs1216393153 653 dbSNP
rs1208553776 656 dbSNP
rs1219588699 673 dbSNP
rs1037700057 685 dbSNP
rs945244071 690 dbSNP
rs942148294 695 dbSNP
rs907933070 700 dbSNP
rs1357790481 702 dbSNP
rs1451620044 711 dbSNP
rs1274723889 746 dbSNP
rs915080762 750 dbSNP
rs1053625787 753 dbSNP
rs1442848493 762 dbSNP
rs570254352 769 dbSNP
rs1278978589 797 dbSNP
rs1230231538 807 dbSNP
rs1305081839 813 dbSNP
rs1263963506 834 dbSNP
rs1323165140 836 dbSNP
rs932602632 837 dbSNP
rs1202163620 839 dbSNP
rs757691283 842 dbSNP
rs878994541 850 dbSNP
rs949192002 869 dbSNP
rs917849196 877 dbSNP
rs1231778641 888 dbSNP
rs1468129726 889 dbSNP
rs1201020664 891 dbSNP
rs1429539204 895 dbSNP
rs1469033942 901 dbSNP
rs976390511 905 dbSNP
rs990656380 910 dbSNP
rs542300631 924 dbSNP
rs908299692 932 dbSNP
rs982968482 933 dbSNP
rs979119559 941 dbSNP
rs952893842 942 dbSNP
rs1345044692 947 dbSNP
rs1027196114 952 dbSNP
rs1221924913 953 dbSNP
rs1272240598 960 dbSNP
rs966887720 962 dbSNP
rs1195627544 967 dbSNP
rs1271478655 971 dbSNP
rs1013167168 978 dbSNP
rs375383584 980 dbSNP
rs754390602 999 dbSNP
rs184944409 1004 dbSNP
rs1479875124 1005 dbSNP
rs1002895823 1009 dbSNP
rs954836010 1014 dbSNP
rs116116775 1015 dbSNP
rs538555743 1016 dbSNP
rs1041784790 1017 dbSNP
rs116549295 1018 dbSNP
rs893630571 1028 dbSNP
rs1053555618 1030 dbSNP
rs932530344 1032 dbSNP
rs1303773862 1035 dbSNP
rs1006208252 1042 dbSNP
rs1327298051 1043 dbSNP
rs886537074 1043 dbSNP
rs1227138290 1052 dbSNP
rs192838949 1053 dbSNP
rs1040657760 1060 dbSNP
rs1362139442 1064 dbSNP
rs1291811489 1073 dbSNP
rs1263899697 1083 dbSNP
rs943703503 1099 dbSNP
rs917718341 1105 dbSNP
rs949222644 1105 dbSNP
rs1447285970 1106 dbSNP
rs190009390 1107 dbSNP
rs1371141273 1112 dbSNP
rs937966487 1121 dbSNP
rs114844757 1125 dbSNP
rs1384576606 1137 dbSNP
rs1422798234 1139 dbSNP
rs952604116 1144 dbSNP
rs920058136 1151 dbSNP
rs1385942103 1159 dbSNP
rs376615168 1163 dbSNP
rs1381723366 1169 dbSNP
rs1274586376 1172 dbSNP
rs1316611230 1178 dbSNP
rs1385471644 1183 dbSNP
rs991660697 1186 dbSNP
rs958922426 1187 dbSNP
rs184230752 1196 dbSNP
rs1357993296 1197 dbSNP
rs1241975143 1202 dbSNP
rs1261973746 1203 dbSNP
rs1003567670 1207 dbSNP
rs759311603 1208 dbSNP
rs549452282 1228 dbSNP
rs1462462637 1233 dbSNP
rs1184024725 1247 dbSNP
rs537495448 1252 dbSNP
rs1242441075 1257 dbSNP
rs1442780219 1261 dbSNP
rs967400703 1264 dbSNP
rs1183999403 1266 dbSNP
rs1453266462 1269 dbSNP
rs570074199 1269 dbSNP
rs774015718 1271 dbSNP
rs770822355 1274 dbSNP
rs1157082250 1277 dbSNP
rs376742514 1278 dbSNP
rs551763391 1279 dbSNP
rs1011624887 1281 dbSNP
rs1470497418 1282 dbSNP
rs1369349706 1289 dbSNP
rs1166673566 1293 dbSNP
rs1336558597 1293 dbSNP
rs1381135664 1296 dbSNP
rs893224849 1296 dbSNP
rs1053527419 1301 dbSNP
rs1393657283 1307 dbSNP
rs1308454621 1314 dbSNP
rs568599180 1318 dbSNP
rs1237753082 1319 dbSNP
rs996647187 1320 dbSNP
rs899704067 1322 dbSNP
rs1172857507 1324 dbSNP
rs533687155 1325 dbSNP
rs868395357 1329 dbSNP
rs1040950388 1330 dbSNP
rs913672206 1342 dbSNP
rs142446771 1344 dbSNP
rs762777963 1352 dbSNP
rs1179119822 1370 dbSNP
rs1262287194 1372 dbSNP
rs1482204076 1375 dbSNP
rs542688074 1388 dbSNP
rs769669133 1389 dbSNP
rs986509288 1396 dbSNP
rs955100771 1408 dbSNP
rs1180174261 1410 dbSNP
rs886769812 1417 dbSNP
rs773324255 1419 dbSNP
rs931041045 1422 dbSNP
rs1176085645 1432 dbSNP
rs1251230434 1434 dbSNP
rs1030543782 1438 dbSNP
rs547706823 1448 dbSNP
rs192550853 1449 dbSNP
rs1299212024 1452 dbSNP
rs1396474722 1453 dbSNP
rs1390299739 1455 dbSNP
rs1285988937 1458 dbSNP
rs965360543 1458 dbSNP
rs560868400 1459 dbSNP
rs1006651245 1461 dbSNP
rs886401106 1466 dbSNP
rs747684671 1474 dbSNP
rs991629406 1476 dbSNP
rs937481292 1477 dbSNP
rs1480304347 1486 dbSNP
rs1203024090 1488 dbSNP
rs542320267 1490 dbSNP
rs981707394 1491 dbSNP
rs1310746406 1496 dbSNP
rs574956607 1497 dbSNP
rs548753713 1498 dbSNP
rs759445577 1506 dbSNP
rs1199006568 1511 dbSNP
rs968040712 1512 dbSNP
rs558844941 1521 dbSNP
rs1430640865 1523 dbSNP
rs896574387 1526 dbSNP
rs990574273 1532 dbSNP
rs1373005833 1538 dbSNP
rs1460923573 1539 dbSNP
rs1308724781 1549 dbSNP
rs1055394515 1552 dbSNP
rs937848129 1558 dbSNP
rs957422917 1562 dbSNP
rs1302115318 1564 dbSNP
rs780923117 1568 dbSNP
rs776452678 1570 dbSNP
rs1296028745 1571 dbSNP
rs1416088566 1581 dbSNP
rs544577571 1590 dbSNP
rs945027028 1595 dbSNP
rs1226114525 1600 dbSNP
rs1375997938 1604 dbSNP
rs1490524878 1607 dbSNP
rs913536412 1613 dbSNP
rs1245187259 1626 dbSNP
rs1464377437 1631 dbSNP
rs1261488978 1638 dbSNP
rs996239688 1647 dbSNP
rs1448152894 1659 dbSNP
rs572069768 1662 dbSNP
rs1159528319 1668 dbSNP
rs1019900962 1669 dbSNP
rs1424721465 1671 dbSNP
rs1163534624 1679 dbSNP
rs1347683460 1682 dbSNP
rs1008112460 1683 dbSNP
rs887028483 1690 dbSNP
rs1361048584 1697 dbSNP
rs1432680747 1701 dbSNP
rs1317047607 1713 dbSNP
rs1046706624 1728 dbSNP
rs1360144707 1733 dbSNP
rs933751292 1777 dbSNP
rs1287819884 1794 dbSNP
rs1318900141 1795 dbSNP
rs1216804421 1808 dbSNP
rs746732967 1855 dbSNP
rs930981914 1865 dbSNP
rs1185868225 1870 dbSNP
rs1486653848 1873 dbSNP
rs779125208 1874 dbSNP
rs1444562489 1882 dbSNP
rs1055536528 1905 dbSNP
rs560049755 1910 dbSNP
rs937106436 1911 dbSNP
rs1411020127 1923 dbSNP
rs928784551 1924 dbSNP
rs1159336557 1925 dbSNP
rs757677377 1933 dbSNP
rs946295978 1941 dbSNP
rs1455393398 1961 dbSNP
rs1016928755 1962 dbSNP
rs1338461127 1962 dbSNP
rs1447276252 1962 dbSNP
rs1482499182 1964 dbSNP
rs553222634 1966 dbSNP
rs1375667401 1973 dbSNP
rs1224433796 1974 dbSNP
rs1216926402 1983 dbSNP
rs1283763834 1988 dbSNP
rs1328120341 1996 dbSNP
rs1205892996 2002 dbSNP
rs1264212205 2006 dbSNP
rs878910272 2014 dbSNP
rs1461247934 2031 dbSNP
rs1286000913 2037 dbSNP
rs985024168 2038 dbSNP
rs1235135209 2040 dbSNP
rs990443933 2055 dbSNP
rs10623 2072 dbSNP
rs1470853092 2083 dbSNP
rs957349112 2088 dbSNP
rs1311963872 2089 dbSNP
rs950962456 2103 dbSNP
rs1026314634 2108 dbSNP
rs187884103 2117 dbSNP
rs1178305225 2118 dbSNP
rs1183508131 2118 dbSNP
rs778272411 2123 dbSNP
rs1289292836 2124 dbSNP
rs1356226578 2125 dbSNP
rs1442942173 2127 dbSNP
rs1287809467 2139 dbSNP
rs772393944 2147 dbSNP
rs1348848097 2151 dbSNP
rs1225639346 2166 dbSNP
rs1284296565 2170 dbSNP
rs573782465 2190 dbSNP
rs1323231026 2194 dbSNP
rs1456506725 2204 dbSNP
rs555229680 2206 dbSNP
rs1033741139 2210 dbSNP
rs537555952 2212 dbSNP
rs1002466026 2213 dbSNP
rs966107882 2217 dbSNP
rs1019405133 2218 dbSNP
rs748288166 2228 dbSNP
rs1008499421 2229 dbSNP
rs530427084 2245 dbSNP
rs1025971240 2246 dbSNP
rs1429591623 2253 dbSNP
rs892368986 2254 dbSNP
rs752780899 2255 dbSNP
rs898154456 2258 dbSNP
rs1421482673 2266 dbSNP
rs767706144 2276 dbSNP
rs933614828 2280 dbSNP
rs1001243110 2282 dbSNP
rs1406881571 2288 dbSNP
rs921030422 2290 dbSNP
rs906962939 2294 dbSNP
rs558209311 2302 dbSNP
rs1231438945 2304 dbSNP
rs755146445 2314 dbSNP
rs1045869281 2315 dbSNP
rs946193976 2327 dbSNP
rs975148954 2331 dbSNP
rs1340662264 2338 dbSNP
rs1228375255 2345 dbSNP
rs913422982 2348 dbSNP
rs1339394012 2355 dbSNP
rs1224096959 2363 dbSNP
rs1187478083 2377 dbSNP
rs943538600 2382 dbSNP
rs200583172 2383 dbSNP
rs759762490 2383 dbSNP
rs985363399 2384 dbSNP
rs1054632311 2387 dbSNP
rs950993136 2389 dbSNP
rs936291979 2393 dbSNP
rs1167843893 2396 dbSNP
rs539824618 2401 dbSNP
rs1426567247 2405 dbSNP
rs73319836 2411 dbSNP
rs1390284910 2417 dbSNP
rs992134602 2423 dbSNP
rs200475713 2427 dbSNP
rs1320668102 2434 dbSNP
rs1335045397 2437 dbSNP
rs751860971 2439 dbSNP
rs1434863200 2440 dbSNP
rs966131013 2442 dbSNP
rs1295981214 2444 dbSNP
rs1264407022 2449 dbSNP
rs1247443677 2468 dbSNP
rs960672972 2474 dbSNP
rs548067553 2475 dbSNP
rs111291260 2479 dbSNP
rs983586200 2480 dbSNP
rs762839052 2487 dbSNP
rs1025517544 2488 dbSNP
rs1447316412 2495 dbSNP
rs568651397 2496 dbSNP
rs1246047193 2497 dbSNP
rs1356153438 2500 dbSNP
rs556504676 2504 dbSNP
rs1184273381 2518 dbSNP
rs183157352 2522 dbSNP
rs544773707 2536 dbSNP
rs1033990882 2543 dbSNP
rs192506251 2544 dbSNP
rs1318817399 2548 dbSNP
rs1456989830 2552 dbSNP
rs1009390016 2553 dbSNP
rs1408930647 2554 dbSNP
rs1454033252 2554 dbSNP
rs1463247231 2556 dbSNP
rs1050977590 2558 dbSNP
rs34441159 2558 dbSNP
rs397856316 2558 dbSNP
rs1242014943 2560 dbSNP
rs1280870590 2567 dbSNP
rs544640974 2576 dbSNP
rs1207875898 2578 dbSNP
rs906896087 2579 dbSNP
rs1456450852 2582 dbSNP
rs113040772 2583 dbSNP
rs559039072 2589 dbSNP
rs1010026463 2591 dbSNP
rs1189720939 2594 dbSNP
rs1039766573 2601 dbSNP
rs1184092901 2604 dbSNP
rs1449275186 2605 dbSNP
rs1246616120 2606 dbSNP
rs1157373475 2608 dbSNP
rs541326833 2609 dbSNP
rs1195874450 2612 dbSNP
rs891952439 2615 dbSNP
rs560078536 2622 dbSNP
rs941156780 2625 dbSNP
rs540276858 2626 dbSNP
rs909607382 2642 dbSNP
rs1315509166 2643 dbSNP
rs1393727637 2644 dbSNP
rs936219672 2645 dbSNP
rs116453883 2653 dbSNP
rs1038984079 2655 dbSNP
rs16942573 2659 dbSNP
rs911923281 2662 dbSNP
rs1340782531 2665 dbSNP
rs983941884 2665 dbSNP
rs1251837798 2668 dbSNP
rs1227518052 2673 dbSNP
rs1233734266 2680 dbSNP
rs34361648 2680 dbSNP
rs1255277797 2681 dbSNP
rs1482237442 2683 dbSNP
rs558098529 2683 dbSNP
rs960999409 2685 dbSNP
rs918382123 2687 dbSNP
rs1305415653 2693 dbSNP
rs973919728 2694 dbSNP
rs962589106 2696 dbSNP
rs1034254501 2721 dbSNP
rs1441348398 2724 dbSNP
rs926679181 2726 dbSNP
rs1001474886 2727 dbSNP
rs1323078339 2730 dbSNP
rs1431754933 2730 dbSNP
rs1434069195 2730 dbSNP
rs981161647 2730 dbSNP
rs1385183978 2736 dbSNP
rs1398678771 2740 dbSNP
rs971467983 2741 dbSNP
rs1169267574 2742 dbSNP
rs1175808046 2742 dbSNP
rs1024006582 2743 dbSNP
rs779589105 2745 dbSNP
rs755594237 2748 dbSNP
rs1478524405 2749 dbSNP
rs1376726548 2754 dbSNP
rs1196244678 2758 dbSNP
rs538579116 2759 dbSNP
rs543617264 2774 dbSNP
rs956486138 2780 dbSNP
rs746611300 2791 dbSNP
rs1310352279 2796 dbSNP
rs11654058 2798 dbSNP
rs998133611 2804 dbSNP
rs1341490281 2806 dbSNP
rs899742867 2808 dbSNP
rs1482066082 2809 dbSNP
rs1282375644 2811 dbSNP
rs1190967262 2823 dbSNP
rs1265770382 2824 dbSNP
rs375744288 2826 dbSNP
rs1169740842 2827 dbSNP
rs891547044 2829 dbSNP
rs1005619788 2845 dbSNP
rs1166176051 2848 dbSNP
rs558272465 2851 dbSNP
rs1458145207 2856 dbSNP
rs115432946 2860 dbSNP
rs1365273436 2861 dbSNP
rs866060279 2864 dbSNP
rs900710090 2867 dbSNP
rs1231389506 2872 dbSNP
rs929479910 2875 dbSNP
rs1039244486 2878 dbSNP
rs373322132 2879 dbSNP
rs1226272692 2884 dbSNP
rs1337733714 2900 dbSNP
rs780523210 2906 dbSNP
rs1294118480 2907 dbSNP
rs1221163873 2915 dbSNP
rs143082553 2917 dbSNP
rs1487025220 2921 dbSNP
rs536165176 2925 dbSNP
rs549745834 2936 dbSNP
rs939659831 2937 dbSNP
rs1369253162 2941 dbSNP
rs926854647 2951 dbSNP
rs929356690 2955 dbSNP
rs920689535 2962 dbSNP
rs980809723 2967 dbSNP
rs1163580354 2973 dbSNP
rs138458137 2981 dbSNP
rs941154387 2988 dbSNP
rs927150291 2998 dbSNP
rs1432874116 2999 dbSNP
rs1317214324 3011 dbSNP
rs778184375 3015 dbSNP
rs1227832772 3017 dbSNP
rs1470984261 3019 dbSNP
rs750658113 3028 dbSNP
rs1318961203 3029 dbSNP
rs549990771 3034 dbSNP
rs1412235887 3039 dbSNP
rs1267955686 3040 dbSNP
rs1463915770 3041 dbSNP
rs980419076 3044 dbSNP
rs1180909506 3045 dbSNP
rs1206165369 3046 dbSNP
rs1238584815 3057 dbSNP
rs1472809712 3060 dbSNP
rs956767501 3061 dbSNP
rs1471285263 3064 dbSNP
rs1473404250 3065 dbSNP
rs1159601474 3069 dbSNP
rs971347887 3072 dbSNP
rs1029538595 3075 dbSNP
rs1455474470 3076 dbSNP
rs118016688 3083 dbSNP
rs1359684529 3106 dbSNP
rs1447298764 3107 dbSNP
rs1301239128 3112 dbSNP
rs964025009 3114 dbSNP
rs1018581026 3115 dbSNP
rs1288076316 3121 dbSNP
rs1327471985 3125 dbSNP
rs1225757058 3128 dbSNP
rs143659719 3136 dbSNP
rs187823513 3145 dbSNP
rs1032711658 3152 dbSNP
rs755125375 3154 dbSNP
rs1361555080 3166 dbSNP
rs1206665055 3171 dbSNP
rs999927005 3179 dbSNP
rs527342950 3184 dbSNP
rs900679039 3187 dbSNP
rs1025356911 3191 dbSNP
rs1289151261 3192 dbSNP
rs993912223 3197 dbSNP
rs1182400694 3200 dbSNP
rs1348655148 3203 dbSNP
rs1250646345 3204 dbSNP
rs532848051 3206 dbSNP
rs1449447325 3207 dbSNP
rs372132653 3210 dbSNP
rs1425777252 3211 dbSNP
rs1413895605 3214 dbSNP
rs1174014422 3218 dbSNP
rs1359069560 3220 dbSNP
rs751692032 3223 dbSNP
rs1402803110 3224 dbSNP
rs1348870583 3226 dbSNP
rs879487427 3227 dbSNP
rs890728967 3227 dbSNP
rs1157881682 3229 dbSNP
rs1455217983 3230 dbSNP
rs766647320 3237 dbSNP
rs1419443521 3240 dbSNP
rs1205271546 3242 dbSNP
rs1181914567 3251 dbSNP
rs929308487 3252 dbSNP
rs559315650 3254 dbSNP
rs1250525762 3259 dbSNP
rs1481906447 3263 dbSNP
rs1200717220 3274 dbSNP
rs540638553 3278 dbSNP
rs529212240 3281 dbSNP
rs116236837 3288 dbSNP
rs1465138498 3290 dbSNP
rs543680575 3295 dbSNP
rs1168117135 3296 dbSNP
rs1269038461 3296 dbSNP
rs199907196 3296 dbSNP
rs531512541 3296 dbSNP
rs866830256 3303 dbSNP
rs1407346924 3304 dbSNP
rs576303180 3313 dbSNP
rs1324587013 3316 dbSNP
rs1330846208 3322 dbSNP
rs1208298358 3325 dbSNP
rs1327296266 3328 dbSNP
rs1434789921 3341 dbSNP
rs750237731 3343 dbSNP
rs148916087 3348 dbSNP
rs1366565812 3353 dbSNP
rs761818476 3359 dbSNP
rs1228488486 3361 dbSNP
rs1273357389 3364 dbSNP
rs1379162897 3364 dbSNP
rs1337017834 3365 dbSNP
rs1211308836 3367 dbSNP
rs949985381 3368 dbSNP
rs917188894 3371 dbSNP
rs989164171 3373 dbSNP
rs1282872471 3377 dbSNP
rs1433342064 3382 dbSNP
rs922670770 3384 dbSNP
rs1450074413 3386 dbSNP
rs955690520 3389 dbSNP
rs546291439 3405 dbSNP
rs1388446675 3406 dbSNP
rs1164000886 3411 dbSNP
rs1032680379 3413 dbSNP
rs964197941 3416 dbSNP
rs572417705 3418 dbSNP
rs1389998837 3420 dbSNP
rs1435074219 3422 dbSNP
rs978475849 3423 dbSNP
rs1246371898 3424 dbSNP
rs964440397 3439 dbSNP
rs1432514742 3440 dbSNP
rs1185572749 3441 dbSNP
rs1396208008 3442 dbSNP
rs1018163929 3443 dbSNP
rs368996875 3445 dbSNP
rs767194148 3445 dbSNP
rs1207993152 3448 dbSNP
rs1009077570 3450 dbSNP
rs369417442 3451 dbSNP
rs375356032 3453 dbSNP
rs764130833 3461 dbSNP
rs955072469 3462 dbSNP
rs1025304426 3466 dbSNP
rs1161795194 3473 dbSNP
rs1411558258 3479 dbSNP
rs535460835 3481 dbSNP
rs1169531280 3491 dbSNP
rs1457073091 3493 dbSNP
rs1449877843 3494 dbSNP
rs1404996523 3496 dbSNP
rs575112157 3499 dbSNP
rs1186416138 3505 dbSNP
rs1026546811 3507 dbSNP
rs1231121858 3513 dbSNP
rs994192931 3514 dbSNP
rs1463756209 3520 dbSNP
rs899156704 3522 dbSNP
rs776670019 3524 dbSNP
rs1035378777 3528 dbSNP
rs1201093166 3528 dbSNP
rs115948718 3529 dbSNP
rs1184565295 3536 dbSNP
rs1252834128 3549 dbSNP
rs1002250477 3568 dbSNP
rs1472433413 3571 dbSNP
rs1157400232 3591 dbSNP
rs905324308 3592 dbSNP
rs1467048998 3595 dbSNP
rs1172627233 3596 dbSNP
rs201319069 3599 dbSNP
rs375963036 3599 dbSNP
rs73995414 3604 dbSNP
rs1309408382 3611 dbSNP
rs1350735379 3613 dbSNP
rs1408987049 3623 dbSNP
rs894041839 3636 dbSNP
rs1332734088 3637 dbSNP
rs191237734 3642 dbSNP
rs1233930199 3644 dbSNP
rs1255371609 3645 dbSNP
rs186157666 3646 dbSNP
rs10553501 3649 dbSNP
rs183154996 3661 dbSNP
rs190556722 3665 dbSNP
rs1053041306 3668 dbSNP
rs1435163689 3669 dbSNP
rs1198722611 3675 dbSNP
rs934615325 3676 dbSNP
rs138721546 3678 dbSNP
rs1432253907 3678 dbSNP
rs911080834 3696 dbSNP
rs1347575394 3697 dbSNP
rs1296207084 3707 dbSNP
rs776537989 3712 dbSNP
rs1387158168 3721 dbSNP
rs1330270893 3726 dbSNP
rs1368698353 3734 dbSNP
rs1230690374 3757 dbSNP
rs1298494239 3762 dbSNP
rs1341689925 3763 dbSNP
rs371723538 3775 dbSNP
rs1430381814 3788 dbSNP
rs760251430 3792 dbSNP
rs1267483902 3797 dbSNP
rs1488980817 3810 dbSNP
rs1209621963 3815 dbSNP
rs1251678646 3824 dbSNP
rs1390293094 3828 dbSNP
rs910287006 3829 dbSNP
rs1427438504 3841 dbSNP
rs987648999 3851 dbSNP
rs1166551731 3858 dbSNP
rs954897896 3862 dbSNP
rs1026931990 3872 dbSNP
rs983968469 3873 dbSNP
rs1392181027 3874 dbSNP
rs1437247124 3877 dbSNP
rs993716905 3882 dbSNP
rs963624626 3901 dbSNP
rs1321177862 3904 dbSNP
rs1364488291 3905 dbSNP
rs1212899152 3907 dbSNP
rs796417083 3917 dbSNP
rs918474433 3922 dbSNP
rs1016250771 3925 dbSNP
rs774944776 3931 dbSNP
rs1274468949 3936 dbSNP
rs771758526 3948 dbSNP
rs1046458590 3952 dbSNP
rs1271722304 3955 dbSNP
rs1466612400 3964 dbSNP
rs972389921 3965 dbSNP
rs1014127971 3968 dbSNP
rs186592168 3974 dbSNP
rs1301585350 3975 dbSNP
rs150230563 3980 dbSNP
rs959659064 3987 dbSNP
rs1424086821 3988 dbSNP
rs1035452249 3998 dbSNP
rs1415346446 3999 dbSNP
rs115810782 4004 dbSNP
rs1262755297 4010 dbSNP
rs1289738632 4010 dbSNP
rs969829744 4010 dbSNP
rs1428718229 4014 dbSNP
rs1304722805 4015 dbSNP
rs934541835 4018 dbSNP
rs1024244497 4019 dbSNP
rs925882872 4030 dbSNP
rs116877375 4031 dbSNP
rs1267979128 4033 dbSNP
rs1315727414 4036 dbSNP
rs1213016424 4037 dbSNP
rs1238748159 4040 dbSNP
rs1467411787 4044 dbSNP
rs1186721354 4052 dbSNP
rs1359483633 4058 dbSNP
rs1473412474 4060 dbSNP
rs1052666779 4061 dbSNP
rs1407151386 4066 dbSNP
rs34592492 4071 dbSNP
rs1432879548 4081 dbSNP
rs1178291121 4092 dbSNP
rs901141998 4093 dbSNP
rs1434203915 4094 dbSNP
rs910248588 4098 dbSNP
rs1423323110 4100 dbSNP
rs987229128 4100 dbSNP
rs1184446337 4107 dbSNP
rs1410824349 4108 dbSNP
rs1472927975 4115 dbSNP
rs564292402 4118 dbSNP
rs1288180927 4119 dbSNP
rs1371781499 4124 dbSNP
rs1221470691 4125 dbSNP
rs528947062 4138 dbSNP
rs1251759622 4145 dbSNP
rs1209534474 4151 dbSNP
rs933072831 4153 dbSNP
rs770196243 4173 dbSNP
rs1182609036 4175 dbSNP
rs1232132101 4177 dbSNP
rs1468440830 4179 dbSNP
rs1192797838 4181 dbSNP
rs560145501 4193 dbSNP
rs572530644 4194 dbSNP
rs911292126 4198 dbSNP
rs963595750 4199 dbSNP
rs1353077724 4207 dbSNP
rs1257000461 4210 dbSNP
rs1016513071 4211 dbSNP
rs781738197 4214 dbSNP
rs1439070644 4222 dbSNP
rs560368658 4232 dbSNP
rs1370997996 4236 dbSNP
rs1232910485 4238 dbSNP
rs1300695151 4244 dbSNP
rs1310140493 4258 dbSNP
rs1205383311 4269 dbSNP
rs931124912 4270 dbSNP
rs969415026 4271 dbSNP
rs542250960 4273 dbSNP
rs918505765 4274 dbSNP
rs1191802769 4275 dbSNP
rs1453784287 4275 dbSNP
rs1025432799 4278 dbSNP
rs1392145383 4280 dbSNP
rs1013639496 4281 dbSNP
rs892549782 4288 dbSNP
rs1286412993 4289 dbSNP
rs754964791 4294 dbSNP
rs1379789297 4299 dbSNP
rs998630667 4304 dbSNP
rs1302117463 4309 dbSNP
rs1394367564 4319 dbSNP
rs182365817 4320 dbSNP
rs747127822 4322 dbSNP
rs1366683238 4325 dbSNP
rs1042950426 4329 dbSNP
rs1227534325 4332 dbSNP
rs943314324 4333 dbSNP
rs1269153209 4336 dbSNP
rs1337112191 4337 dbSNP
rs1229802759 4341 dbSNP
rs970237816 4343 dbSNP
rs1404205339 4351 dbSNP
rs376814122 4363 dbSNP
rs1249841765 4365 dbSNP
rs556097175 4366 dbSNP
rs1411383616 4369 dbSNP
rs8819 4370 dbSNP
rs1426131968 4371 dbSNP
rs758677908 4373 dbSNP
rs1181640717 4376 dbSNP
rs1051870601 4377 dbSNP
rs933060468 4385 dbSNP
rs919015261 4388 dbSNP
rs901423590 4393 dbSNP
rs577093421 4394 dbSNP
rs1161925710 4395 dbSNP
rs1041468544 4400 dbSNP
rs942158843 4413 dbSNP
rs909420504 4420 dbSNP
rs555499820 4421 dbSNP
rs1265758893 4423 dbSNP
rs1449827839 4429 dbSNP
rs1246347656 4443 dbSNP
rs970054203 4450 dbSNP
rs559131168 4451 dbSNP
rs1269939246 4452 dbSNP
rs1311850420 4452 dbSNP
rs1351384583 4457 dbSNP
rs1204610206 4460 dbSNP
rs1048434590 4461 dbSNP
rs534113403 4463 dbSNP
rs1188452615 4469 dbSNP
rs1257098527 4470 dbSNP
rs1474391130 4472 dbSNP
rs1184867530 4477 dbSNP
rs750722287 4479 dbSNP
rs1453731476 4480 dbSNP
rs1367046052 4483 dbSNP
rs1320948139 4485 dbSNP
rs1382091718 4488 dbSNP
rs1313045286 4490 dbSNP
rs918453319 4490 dbSNP
rs565806612 4491 dbSNP
rs1412690260 4492 dbSNP
rs956758025 4493 dbSNP
rs1459446068 4496 dbSNP
rs763554742 4496 dbSNP
rs1369559190 4501 dbSNP
rs1347146470 4508 dbSNP
rs1211688894 4509 dbSNP
rs1164630011 4512 dbSNP
rs938622232 4513 dbSNP
rs1484845074 4523 dbSNP
rs189215485 4530 dbSNP
rs535488542 4532 dbSNP
rs1418893599 4537 dbSNP
rs1180222249 4539 dbSNP
rs980187007 4540 dbSNP
rs1478723181 4558 dbSNP
rs1173784510 4559 dbSNP
rs1374452579 4559 dbSNP
rs948391760 4560 dbSNP
rs778819549 4561 dbSNP
rs914310616 4563 dbSNP
rs568074495 4574 dbSNP
rs1304702564 4575 dbSNP
rs147622919 4577 dbSNP
rs201751732 4581 dbSNP
rs531662828 4581 dbSNP
rs955769164 4584 dbSNP
rs753666128 4586 dbSNP
rs778629821 4599 dbSNP
rs1356382781 4601 dbSNP
rs904356285 4619 dbSNP
rs1252131984 4626 dbSNP
rs1480476421 4626 dbSNP
rs978237926 4626 dbSNP
rs1264829037 4631 dbSNP
rs1270081565 4633 dbSNP
rs1469345868 4639 dbSNP
rs564351783 4640 dbSNP
rs966044505 4645 dbSNP
rs1344205767 4648 dbSNP
rs1019836284 4661 dbSNP
rs1021420378 4665 dbSNP
rs1452059968 4669 dbSNP
rs1298134094 4676 dbSNP
rs1227385434 4682 dbSNP
rs1373297760 4683 dbSNP
rs1364736167 4684 dbSNP
rs145207777 4685 dbSNP
rs1388614107 4707 dbSNP
rs1325174442 4709 dbSNP
rs1368814845 4710 dbSNP
rs764102528 4723 dbSNP
rs1296480257 4724 dbSNP
rs1307194035 4733 dbSNP
rs1051407550 4737 dbSNP
rs771466508 4741 dbSNP
rs995588491 4745 dbSNP
rs897226047 4747 dbSNP
rs768264233 4748 dbSNP
rs773605296 4748 dbSNP
rs932968326 4749 dbSNP
rs938498839 4750 dbSNP
rs760033969 4759 dbSNP
rs1187833788 4763 dbSNP
rs907131288 4766 dbSNP
rs1169630145 4770 dbSNP
rs1449183525 4772 dbSNP
rs1371009470 4774 dbSNP
rs752244803 4775 dbSNP
rs1461788041 4776 dbSNP
rs1044282919 4788 dbSNP
rs1451793538 4788 dbSNP
rs914280517 4789 dbSNP
rs989815040 4790 dbSNP
rs1266119685 4792 dbSNP
rs1207540736 4793 dbSNP
rs1315135817 4793 dbSNP
rs759033686 4794 dbSNP
rs572973696 4800 dbSNP
rs1036113048 4803 dbSNP
rs1233067509 4806 dbSNP
rs941794729 4819 dbSNP
rs1271825504 4821 dbSNP
rs1331922908 4823 dbSNP
rs1217279633 4824 dbSNP
rs1164531365 4829 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:| ||  ||||||| 
Target 5' aaaAAACUA-UAGAUGCUGCUu 3'
3 - 23
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:| ||  ||||||| 
Target 5' aaaAAACUA-UAGAUGCUGCUu 3'
3 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000258962.4 | 3UTR | UUAAAAAACUAUAGAUGCUGCUUAUUUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000258962.4 | 3UTR | UUAAAAAACUAUAGAUGCUGCUUAUUUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000258962.4 | 3UTR | UUAAAAAACUAUAGAUGCUGCUUAUUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.329 1.2e-3 0.302 2.8e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.616 1.9e-3 0.800 1.1e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.489 8.9e-3 -0.243 1.3e-1 23 Click to see details
GSE32688 Pancreatic cancer 0.294 5.1e-2 0.292 5.2e-2 32 Click to see details
GSE19350 CNS germ cell tumors 0.417 8.9e-2 0.238 2.3e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.276 9.1e-2 0.273 9.3e-2 25 Click to see details
GSE19783 ER- ER- breast cancer -0.144 1.0e-1 -0.149 9.5e-2 79 Click to see details
GSE38226 Liver fibrosis 0.244 1.4e-1 0.377 4.6e-2 21 Click to see details
GSE17306 Multiple myeloma 0.114 2.2e-1 0.129 1.9e-1 49 Click to see details
GSE21849 B cell lymphoma -0.149 2.2e-1 0.080 3.4e-1 29 Click to see details
GSE17498 Multiple myeloma 0.105 2.6e-1 -0.014 4.7e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.19 2.7e-1 -0.115 3.5e-1 13 Click to see details
GSE19536 Breast cancer -0.053 3.0e-1 -0.069 2.5e-1 100 Click to see details
GSE21687 Ependynoma primary tumors 0.055 3.3e-1 0.060 3.2e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.091 3.4e-1 -0.187 1.9e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.031 3.9e-1 0.050 3.2e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.07 4.0e-1 -0.012 4.8e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.046 4.2e-1 -0.068 3.9e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.009 4.8e-1 0.125 2.8e-1 25 Click to see details
GSE28544 Breast cancer -0.008 4.9e-1 0.270 1.0e-1 24 Click to see details
GSE28544 Breast cancer -0.008 4.9e-1 0.270 1.0e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.362 0.01 0.388 0.01 42 Click to see details
PRAD 0.323 0.01 0.381 0 50 Click to see details
STAD 0.356 0.02 0.327 0.03 32 Click to see details
KIRP 0.336 0.03 0.383 0.02 32 Click to see details
COAD 0.657 0.04 0.619 0.05 8 Click to see details
PCPG -0.991 0.04 -1.000 0.5 3 Click to see details
LIHC 0.225 0.06 0.259 0.04 49 Click to see details
PAAD 0.818 0.09 0.200 0.4 4 Click to see details
THCA 0.17 0.1 0.207 0.06 59 Click to see details
LUAD 0.365 0.12 0.371 0.12 12 Click to see details
UCEC 0.204 0.2 0.265 0.14 19 Click to see details
BLCA 0.196 0.22 0.377 0.06 18 Click to see details
ESCA -0.18 0.3 -0.282 0.2 11 Click to see details
KIRC 0.05 0.34 0.065 0.3 68 Click to see details
BRCA -0.037 0.37 0.000 0.5 84 Click to see details
CESC 0.388 0.37 0.500 0.33 3 Click to see details
CHOL -0.105 0.39 -0.033 0.47 9 Click to see details
LUSC 0.022 0.45 0.031 0.43 38 Click to see details
KICH 0.011 0.48 0.084 0.34 25 Click to see details
KICH 0.011 0.48 0.084 0.34 25 Click to see details
KICH 0.011 0.48 0.084 0.34 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2