Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT505349 [miRNA, hsa-miR-15a-5p :: TMEM245, target gene]
miRTarBase - #MIRT505349 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM245   
Synonyms C9orf5, CG-2, CG2
Description transmembrane protein 245
Transcript NM_032012   
Putative miRNA Targets on TMEM245
3'UTR of TMEM245
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            :|||  |||  ||||    ||||||:| 
2977 - 3006 146.00 -16.00
             ||| ||  | ||| |||||:| 
4474 - 4498 145.00 -10.30
            |:|:  |||: |||:|||| 
Target 5' taCGAG--ATTG-GTGTTGCTa 3'
1243 - 1261 139.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168412 49 COSMIC
COSN30491978 49 COSMIC
COSN30681190 62 COSMIC
COSN15316028 70 COSMIC
COSN30118287 123 COSMIC
COSN23688503 126 COSMIC
COSN26999002 126 COSMIC
COSN31573387 159 COSMIC
COSN30139235 177 COSMIC
COSN1371654 287 COSMIC
COSN19082410 315 COSMIC
COSN23475168 435 COSMIC
COSN20847843 442 COSMIC
COSN2459074 462 COSMIC
COSN6375298 527 COSMIC
COSN31487181 832 COSMIC
COSN5695122 838 COSMIC
COSN17652785 1023 COSMIC
COSN23713166 1491 COSMIC
COSN9694838 1658 COSMIC
COSN5241251 1808 COSMIC
COSN8293268 2030 COSMIC
COSN9694837 2291 COSMIC
COSN8293267 2533 COSMIC
COSN23511107 3231 COSMIC
COSN20106455 3510 COSMIC
COSN9275284 3572 COSMIC
COSN27132762 3607 COSMIC
COSN2305077 3818 COSMIC
COSN9694836 4180 COSMIC
COSN2305075 4234 COSMIC
COSN31592874 4290 COSMIC
COSN27479315 4349 COSMIC
COSN32063472 4387 COSMIC
COSN28718628 4399 COSMIC
COSN21435013 4476 COSMIC
COSN31528726 4618 COSMIC
COSN8519780 4688 COSMIC
COSN31487679 4719 COSMIC
COSN28202082 4775 COSMIC
COSN26640066 4791 COSMIC
COSN31583265 4931 COSMIC
COSN31567647 5074 COSMIC
COSN20106451 5218 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1365074172 1 dbSNP
rs1288587104 5 dbSNP
rs748329530 9 dbSNP
rs774889802 17 dbSNP
rs771719970 22 dbSNP
rs1460984351 27 dbSNP
rs1424497653 31 dbSNP
rs1172928354 32 dbSNP
rs1476928265 33 dbSNP
rs374974089 38 dbSNP
rs1191500039 40 dbSNP
rs1419306357 43 dbSNP
rs1489366859 46 dbSNP
rs779404324 48 dbSNP
rs116143242 49 dbSNP
rs372879625 56 dbSNP
rs1259363525 57 dbSNP
rs1216259562 59 dbSNP
rs778283867 61 dbSNP
rs1261010464 63 dbSNP
rs756602912 64 dbSNP
rs752782390 68 dbSNP
rs1370264819 69 dbSNP
rs10816767 70 dbSNP
rs755172628 72 dbSNP
rs751840161 74 dbSNP
rs1467650696 75 dbSNP
rs1333407260 76 dbSNP
rs771788193 77 dbSNP
rs761534512 80 dbSNP
rs1177099839 86 dbSNP
rs1357611857 87 dbSNP
rs1455722600 91 dbSNP
rs1289842463 116 dbSNP
rs774283809 121 dbSNP
rs1001702956 122 dbSNP
rs1388311779 123 dbSNP
rs1422868996 126 dbSNP
rs776428087 130 dbSNP
rs906136867 132 dbSNP
rs545982860 136 dbSNP
rs760565418 139 dbSNP
rs775040453 140 dbSNP
rs1433531447 148 dbSNP
rs1045965278 149 dbSNP
rs942122598 161 dbSNP
rs1239406968 169 dbSNP
rs887763575 170 dbSNP
rs532943631 171 dbSNP
rs949093530 172 dbSNP
rs932240349 183 dbSNP
rs7776 209 dbSNP
rs1245186790 214 dbSNP
rs1339630337 216 dbSNP
rs1052145555 222 dbSNP
rs1215551179 224 dbSNP
rs1253547715 236 dbSNP
rs1468996060 241 dbSNP
rs1423093692 242 dbSNP
rs1421142640 244 dbSNP
rs1333805499 245 dbSNP
rs560464422 254 dbSNP
rs935040049 268 dbSNP
rs778628556 274 dbSNP
rs976244413 276 dbSNP
rs556802290 280 dbSNP
rs935517571 287 dbSNP
rs1328596563 289 dbSNP
rs924112671 308 dbSNP
rs1435186238 314 dbSNP
rs925030054 315 dbSNP
rs1298828487 316 dbSNP
rs754919220 318 dbSNP
rs1224008516 322 dbSNP
rs979266913 326 dbSNP
rs1383391690 333 dbSNP
rs977128109 334 dbSNP
rs542131859 345 dbSNP
rs968890094 351 dbSNP
rs764376583 358 dbSNP
rs1265266828 363 dbSNP
rs1273789853 370 dbSNP
rs1450988480 373 dbSNP
rs1021261218 379 dbSNP
rs991591518 383 dbSNP
rs1368222639 394 dbSNP
rs868562983 398 dbSNP
rs541117494 402 dbSNP
rs1251353331 422 dbSNP
rs1002753574 424 dbSNP
rs1167517200 428 dbSNP
rs1418963718 435 dbSNP
rs961815142 441 dbSNP
rs1478590149 465 dbSNP
rs911152646 468 dbSNP
rs1014729488 470 dbSNP
rs1355836031 475 dbSNP
rs986712444 477 dbSNP
rs1307073237 478 dbSNP
rs1215179600 479 dbSNP
rs1348218028 479 dbSNP
rs781289186 486 dbSNP
rs1416192856 487 dbSNP
rs1025615465 489 dbSNP
rs1487285547 492 dbSNP
rs1293715216 498 dbSNP
rs972727271 500 dbSNP
rs1226549534 503 dbSNP
rs1292001928 512 dbSNP
rs1210327422 521 dbSNP
rs1309407536 522 dbSNP
rs556089513 524 dbSNP
rs1482207813 525 dbSNP
rs1017017165 527 dbSNP
rs1472668390 528 dbSNP
rs751769767 539 dbSNP
rs996621509 545 dbSNP
rs1342538853 553 dbSNP
rs906009926 561 dbSNP
rs1410092448 563 dbSNP
rs1167441719 565 dbSNP
rs1278956142 568 dbSNP
rs1024993584 573 dbSNP
rs1339713690 574 dbSNP
rs1271897621 577 dbSNP
rs1445536060 577 dbSNP
rs1399431855 588 dbSNP
rs111785105 593 dbSNP
rs924081380 597 dbSNP
rs1340053735 604 dbSNP
rs576483402 607 dbSNP
rs1213366655 609 dbSNP
rs1326154219 610 dbSNP
rs1406453805 611 dbSNP
rs558238558 621 dbSNP
rs1163152648 627 dbSNP
rs1466865398 632 dbSNP
rs1052086873 643 dbSNP
rs147740431 648 dbSNP
rs566751621 653 dbSNP
rs1401012623 654 dbSNP
rs1412593810 659 dbSNP
rs145695797 662 dbSNP
rs1474164135 663 dbSNP
rs1345520940 666 dbSNP
rs1295236437 667 dbSNP
rs1043462933 669 dbSNP
rs1363201954 685 dbSNP
rs1247945517 689 dbSNP
rs118139780 691 dbSNP
rs958581900 692 dbSNP
rs928306882 694 dbSNP
rs1450907089 696 dbSNP
rs770222370 698 dbSNP
rs868519241 710 dbSNP
rs1271046950 712 dbSNP
rs911029111 713 dbSNP
rs536917016 715 dbSNP
rs987128958 719 dbSNP
rs1208712705 730 dbSNP
rs933935743 731 dbSNP
rs1198925777 732 dbSNP
rs1376522704 735 dbSNP
rs1476853196 736 dbSNP
rs569474599 738 dbSNP
rs550907387 754 dbSNP
rs1159868596 757 dbSNP
rs58033846 765 dbSNP
rs1014698533 767 dbSNP
rs1006493335 769 dbSNP
rs1258998088 771 dbSNP
rs1456506681 772 dbSNP
rs918500469 773 dbSNP
rs952163034 779 dbSNP
rs1218211612 792 dbSNP
rs1396572497 793 dbSNP
rs1441491656 802 dbSNP
rs113020697 806 dbSNP
rs147468959 809 dbSNP
rs112441017 813 dbSNP
rs1330960759 815 dbSNP
rs1324335685 824 dbSNP
rs980184279 825 dbSNP
rs527458524 830 dbSNP
rs1337612223 832 dbSNP
rs1024440211 836 dbSNP
rs1266055861 843 dbSNP
rs573608207 845 dbSNP
rs1043882773 847 dbSNP
rs1426683523 852 dbSNP
rs1252051984 854 dbSNP
rs1472172216 855 dbSNP
rs1156717476 864 dbSNP
rs768103274 865 dbSNP
rs1419710001 867 dbSNP
rs1172589231 868 dbSNP
rs189172458 875 dbSNP
rs892079083 878 dbSNP
rs1180412737 880 dbSNP
rs139784686 888 dbSNP
rs999169694 889 dbSNP
rs1055912818 913 dbSNP
rs562643977 925 dbSNP
rs1237332109 933 dbSNP
rs753084907 935 dbSNP
rs937126952 938 dbSNP
rs1286875514 943 dbSNP
rs13293236 951 dbSNP
rs1246179093 953 dbSNP
rs889619589 958 dbSNP
rs3087979 961 dbSNP
rs933800309 962 dbSNP
rs1219843667 965 dbSNP
rs1197013921 970 dbSNP
rs1274671962 973 dbSNP
rs1482544786 978 dbSNP
rs1344951828 979 dbSNP
rs770629067 982 dbSNP
rs1259372683 998 dbSNP
rs1424164476 1004 dbSNP
rs765856723 1007 dbSNP
rs941357294 1023 dbSNP
rs558209525 1026 dbSNP
rs1366611309 1030 dbSNP
rs909852194 1031 dbSNP
rs1170588846 1035 dbSNP
rs980597777 1040 dbSNP
rs1437204223 1043 dbSNP
rs78345702 1047 dbSNP
rs74928846 1049 dbSNP
rs1396966343 1063 dbSNP
rs141269884 1065 dbSNP
rs536451076 1083 dbSNP
rs1028826105 1101 dbSNP
rs748668244 1104 dbSNP
rs1413464334 1114 dbSNP
rs1297701769 1117 dbSNP
rs975208120 1119 dbSNP
rs1392684316 1120 dbSNP
rs966129836 1123 dbSNP
rs1160449386 1125 dbSNP
rs1018942334 1126 dbSNP
rs1483476588 1127 dbSNP
rs1199641709 1131 dbSNP
rs1440220028 1131 dbSNP
rs1253758594 1132 dbSNP
rs1430269567 1134 dbSNP
rs1189054953 1136 dbSNP
rs1031900822 1140 dbSNP
rs569497061 1141 dbSNP
rs967694997 1146 dbSNP
rs1361092466 1151 dbSNP
rs557412877 1152 dbSNP
rs1479797822 1158 dbSNP
rs1239381580 1169 dbSNP
rs138700809 1179 dbSNP
rs1011160611 1180 dbSNP
rs1321794644 1187 dbSNP
rs878959076 1189 dbSNP
rs1278268703 1191 dbSNP
rs73527223 1207 dbSNP
rs1363916812 1213 dbSNP
rs889573135 1222 dbSNP
rs1051269787 1228 dbSNP
rs998037127 1233 dbSNP
rs1219452403 1236 dbSNP
rs1354970256 1237 dbSNP
rs1306778968 1240 dbSNP
rs1044905 1245 dbSNP
rs1381772442 1250 dbSNP
rs1284469898 1257 dbSNP
rs1486690871 1261 dbSNP
rs1055312157 1277 dbSNP
rs1247335686 1281 dbSNP
rs547099308 1282 dbSNP
rs1464531126 1307 dbSNP
rs1036960717 1309 dbSNP
rs1427309184 1314 dbSNP
rs1446824006 1323 dbSNP
rs539776698 1339 dbSNP
rs909789098 1346 dbSNP
rs1160609059 1348 dbSNP
rs528558590 1350 dbSNP
rs1245375604 1355 dbSNP
rs948714847 1361 dbSNP
rs1420233156 1381 dbSNP
rs567782106 1392 dbSNP
rs1367607595 1401 dbSNP
rs917361386 1404 dbSNP
rs768363107 1420 dbSNP
rs1045373607 1431 dbSNP
rs1228744568 1433 dbSNP
rs1267207439 1438 dbSNP
rs776331465 1442 dbSNP
rs1327038771 1444 dbSNP
rs1215416415 1447 dbSNP
rs940397052 1448 dbSNP
rs956220383 1448 dbSNP
rs749196588 1452 dbSNP
rs978984245 1454 dbSNP
rs7023890 1456 dbSNP
rs1425384795 1460 dbSNP
rs769922948 1462 dbSNP
rs985072261 1467 dbSNP
rs930593433 1469 dbSNP
rs921730554 1475 dbSNP
rs1474970444 1478 dbSNP
rs1167449813 1496 dbSNP
rs530184406 1498 dbSNP
rs974631840 1498 dbSNP
rs142711105 1504 dbSNP
rs1019079426 1506 dbSNP
rs1291470019 1507 dbSNP
rs770115607 1508 dbSNP
rs1218837379 1523 dbSNP
rs1410014837 1532 dbSNP
rs34617541 1533 dbSNP
rs868037873 1534 dbSNP
rs1230017271 1535 dbSNP
rs953819722 1535 dbSNP
rs1290505065 1536 dbSNP
rs1322450995 1539 dbSNP
rs1260708565 1556 dbSNP
rs1220905294 1559 dbSNP
rs1162129318 1560 dbSNP
rs1171180085 1560 dbSNP
rs1183079721 1560 dbSNP
rs1184180355 1560 dbSNP
rs1251557002 1560 dbSNP
rs1284106579 1560 dbSNP
rs1289618268 1560 dbSNP
rs1307012923 1560 dbSNP
rs1371797972 1560 dbSNP
rs1415116733 1560 dbSNP
rs1422777984 1560 dbSNP
rs1471807275 1560 dbSNP
rs1484175566 1560 dbSNP
rs34086900 1560 dbSNP
rs35246999 1560 dbSNP
rs398011819 1560 dbSNP
rs978079213 1567 dbSNP
rs1029427739 1569 dbSNP
rs766180447 1571 dbSNP
rs1022313323 1572 dbSNP
rs905054921 1574 dbSNP
rs1182224162 1578 dbSNP
rs1291016798 1587 dbSNP
rs10123791 1588 dbSNP
rs1232312709 1589 dbSNP
rs544209193 1592 dbSNP
rs1036908104 1594 dbSNP
rs1279574738 1597 dbSNP
rs1005383697 1610 dbSNP
rs531965378 1619 dbSNP
rs1415775505 1623 dbSNP
rs58928086 1625 dbSNP
rs1445746950 1636 dbSNP
rs1287086296 1637 dbSNP
rs1044683865 1639 dbSNP
rs1459368421 1640 dbSNP
rs948765319 1645 dbSNP
rs895774502 1657 dbSNP
rs1163728107 1661 dbSNP
rs758663571 1662 dbSNP
rs1034246899 1663 dbSNP
rs934704671 1664 dbSNP
rs752896165 1666 dbSNP
rs568430635 1682 dbSNP
rs539864443 1684 dbSNP
rs978933318 1688 dbSNP
rs112151886 1690 dbSNP
rs910824672 1692 dbSNP
rs1250417205 1693 dbSNP
rs1003707989 1694 dbSNP
rs528287602 1695 dbSNP
rs1239824842 1700 dbSNP
rs1261129391 1702 dbSNP
rs1185342676 1710 dbSNP
rs1172738051 1711 dbSNP
rs1489718719 1711 dbSNP
rs986759739 1717 dbSNP
rs1247658603 1718 dbSNP
rs1045425953 1721 dbSNP
rs1323484121 1721 dbSNP
rs138720360 1721 dbSNP
rs756922466 1722 dbSNP
rs940444557 1723 dbSNP
rs183741338 1724 dbSNP
rs1048733149 1726 dbSNP
rs953746859 1729 dbSNP
rs1275657810 1731 dbSNP
rs1029294797 1737 dbSNP
rs1222047919 1739 dbSNP
rs930541958 1743 dbSNP
rs779288362 1744 dbSNP
rs961152617 1756 dbSNP
rs34766602 1762 dbSNP
rs554379533 1763 dbSNP
rs1452816634 1783 dbSNP
rs190561744 1786 dbSNP
rs1292749088 1792 dbSNP
rs1184104234 1793 dbSNP
rs1412383273 1807 dbSNP
rs755312267 1815 dbSNP
rs754303228 1821 dbSNP
rs1388453354 1839 dbSNP
rs1368166726 1841 dbSNP
rs575797695 1843 dbSNP
rs1407124528 1844 dbSNP
rs1325001911 1845 dbSNP
rs114531063 1847 dbSNP
rs1330769718 1850 dbSNP
rs1005405259 1856 dbSNP
rs1351420699 1859 dbSNP
rs888251659 1860 dbSNP
rs1022892449 1861 dbSNP
rs911735800 1875 dbSNP
rs1357891379 1876 dbSNP
rs879804391 1882 dbSNP
rs1013214310 1887 dbSNP
rs1372587928 1892 dbSNP
rs1168326162 1893 dbSNP
rs978148146 1894 dbSNP
rs1435452870 1897 dbSNP
rs1268606915 1899 dbSNP
rs895818087 1903 dbSNP
rs1057100031 1909 dbSNP
rs1473059477 1911 dbSNP
rs966797680 1912 dbSNP
rs539373025 1913 dbSNP
rs989520516 1933 dbSNP
rs903300757 1938 dbSNP
rs1371628285 1939 dbSNP
rs1480069039 1939 dbSNP
rs959889019 1945 dbSNP
rs1033971775 1947 dbSNP
rs1003760659 1948 dbSNP
rs1246113824 1950 dbSNP
rs185718293 1961 dbSNP
rs1043099103 1962 dbSNP
rs1004558161 1968 dbSNP
rs886216919 1981 dbSNP
rs1331717411 1984 dbSNP
rs1049185944 1988 dbSNP
rs1257967087 1996 dbSNP
rs947594371 1999 dbSNP
rs910678233 2000 dbSNP
rs78397412 2002 dbSNP
rs1395988737 2007 dbSNP
rs1296544034 2010 dbSNP
rs1467689948 2022 dbSNP
rs1186683223 2024 dbSNP
rs1384745807 2033 dbSNP
rs534869394 2033 dbSNP
rs1442849479 2044 dbSNP
rs1170755560 2045 dbSNP
rs1395732371 2046 dbSNP
rs994551380 2053 dbSNP
rs1296840731 2055 dbSNP
rs1404713360 2070 dbSNP
rs986404082 2071 dbSNP
rs1336648259 2078 dbSNP
rs757336149 2078 dbSNP
rs1133868 2079 dbSNP
rs1297633031 2083 dbSNP
rs137858607 2103 dbSNP
rs1224713263 2106 dbSNP
rs1382557830 2117 dbSNP
rs1257558457 2125 dbSNP
rs777996131 2130 dbSNP
rs961011428 2131 dbSNP
rs1179606947 2134 dbSNP
rs1460072082 2136 dbSNP
rs1190619187 2137 dbSNP
rs1248679108 2142 dbSNP
rs567710938 2143 dbSNP
rs915369773 2154 dbSNP
rs371312177 2156 dbSNP
rs181220845 2159 dbSNP
rs1201783018 2160 dbSNP
rs1176397611 2165 dbSNP
rs536425350 2170 dbSNP
rs1437856776 2177 dbSNP
rs1278971847 2186 dbSNP
rs1320648691 2191 dbSNP
rs1208663207 2194 dbSNP
rs1355687296 2202 dbSNP
rs1380231517 2202 dbSNP
rs1331507184 2203 dbSNP
rs989881089 2211 dbSNP
rs1260965857 2212 dbSNP
rs749909869 2217 dbSNP
rs190299919 2220 dbSNP
rs926630889 2229 dbSNP
rs1268864367 2231 dbSNP
rs185440827 2235 dbSNP
rs952581967 2239 dbSNP
rs532247302 2250 dbSNP
rs564841305 2252 dbSNP
rs970964528 2266 dbSNP
rs1433939375 2267 dbSNP
rs368773555 2268 dbSNP
rs748835370 2268 dbSNP
rs528118580 2269 dbSNP
rs1398002462 2278 dbSNP
rs561037237 2280 dbSNP
rs570103853 2284 dbSNP
rs895771700 2286 dbSNP
rs1344163909 2288 dbSNP
rs1450952242 2294 dbSNP
rs1294971869 2299 dbSNP
rs1367890872 2300 dbSNP
rs1004359834 2305 dbSNP
rs950516722 2305 dbSNP
rs1433434212 2308 dbSNP
rs1027439521 2309 dbSNP
rs995002657 2311 dbSNP
rs1469981491 2315 dbSNP
rs900126833 2316 dbSNP
rs767051090 2322 dbSNP
rs998831896 2324 dbSNP
rs1475295093 2330 dbSNP
rs1221954126 2331 dbSNP
rs1008806102 2332 dbSNP
rs890402734 2343 dbSNP
rs1183582569 2350 dbSNP
rs1185111041 2353 dbSNP
rs1407861968 2353 dbSNP
rs1489244863 2360 dbSNP
rs1349884445 2362 dbSNP
rs1286715247 2369 dbSNP
rs1042242991 2376 dbSNP
rs1204450632 2385 dbSNP
rs1372249556 2387 dbSNP
rs79184925 2395 dbSNP
rs1266976462 2396 dbSNP
rs1297345823 2401 dbSNP
rs761411321 2406 dbSNP
rs1356293669 2435 dbSNP
rs1292771254 2440 dbSNP
rs1229896740 2443 dbSNP
rs1314961465 2444 dbSNP
rs575775390 2446 dbSNP
rs1360243676 2471 dbSNP
rs755865638 2472 dbSNP
rs1342415102 2474 dbSNP
rs1012037466 2475 dbSNP
rs1484267241 2476 dbSNP
rs143449947 2480 dbSNP
rs1400619945 2481 dbSNP
rs1479946004 2483 dbSNP
rs1184045676 2490 dbSNP
rs545637841 2499 dbSNP
rs1165301738 2503 dbSNP
rs938110279 2504 dbSNP
rs926594911 2509 dbSNP
rs578237985 2511 dbSNP
rs1429952028 2512 dbSNP
rs1416653831 2513 dbSNP
rs1162323795 2514 dbSNP
rs1352490304 2516 dbSNP
rs1450200121 2525 dbSNP
rs868682895 2526 dbSNP
rs933493709 2527 dbSNP
rs773893389 2528 dbSNP
rs1478540625 2534 dbSNP
rs908836955 2547 dbSNP
rs1242191590 2549 dbSNP
rs1344617500 2551 dbSNP
rs1215314483 2564 dbSNP
rs1272756807 2566 dbSNP
rs1306110897 2569 dbSNP
rs1212939808 2571 dbSNP
rs796959036 2576 dbSNP
rs1181251169 2577 dbSNP
rs148840932 2581 dbSNP
rs1475546341 2584 dbSNP
rs952876421 2590 dbSNP
rs908173368 2599 dbSNP
rs1415934890 2616 dbSNP
rs983888540 2617 dbSNP
rs1176771828 2640 dbSNP
rs973148412 2641 dbSNP
rs1468127030 2652 dbSNP
rs952607323 2679 dbSNP
rs1367370320 2683 dbSNP
rs1269237342 2685 dbSNP
rs1269823702 2686 dbSNP
rs1360359753 2690 dbSNP
rs1210162270 2694 dbSNP
rs1264100751 2703 dbSNP
rs915655965 2708 dbSNP
rs1202270652 2712 dbSNP
rs1269540586 2716 dbSNP
rs1008608066 2721 dbSNP
rs991760074 2725 dbSNP
rs890371809 2736 dbSNP
rs1272828718 2744 dbSNP
rs959842770 2753 dbSNP
rs138479287 2762 dbSNP
rs150120875 2767 dbSNP
rs181001714 2768 dbSNP
rs1161264127 2771 dbSNP
rs1022086071 2772 dbSNP
rs1430643200 2782 dbSNP
rs1401325168 2785 dbSNP
rs769834993 2789 dbSNP
rs1011570818 2790 dbSNP
rs889230768 2795 dbSNP
rs1325975431 2796 dbSNP
rs537115742 2803 dbSNP
rs142518974 2804 dbSNP
rs374552554 2805 dbSNP
rs1290724861 2810 dbSNP
rs1394169258 2827 dbSNP
rs997700531 2828 dbSNP
rs1323561174 2832 dbSNP
rs1204065520 2833 dbSNP
rs745842291 2839 dbSNP
rs1036622068 2841 dbSNP
rs1452975750 2846 dbSNP
rs1222692528 2850 dbSNP
rs1267984231 2864 dbSNP
rs1479330124 2873 dbSNP
rs1184307818 2874 dbSNP
rs550315250 2884 dbSNP
rs1166739303 2886 dbSNP
rs147730628 2892 dbSNP
rs571200464 2893 dbSNP
rs909461295 2895 dbSNP
rs1303979811 2898 dbSNP
rs1048567858 2899 dbSNP
rs1365392351 2917 dbSNP
rs1403473323 2917 dbSNP
rs145661068 2919 dbSNP
rs908556497 2922 dbSNP
rs915669483 2923 dbSNP
rs1238873300 2928 dbSNP
rs991226172 2931 dbSNP
rs1357831600 2932 dbSNP
rs1250891419 2933 dbSNP
rs983015113 2941 dbSNP
rs959873890 2945 dbSNP
rs931575950 2952 dbSNP
rs752657941 2960 dbSNP
rs1489812356 2961 dbSNP
rs772300908 2964 dbSNP
rs1207062040 2969 dbSNP
rs1250890603 2976 dbSNP
rs1437180466 2978 dbSNP
rs928433388 2981 dbSNP
rs1273845647 2984 dbSNP
rs141863466 2987 dbSNP
rs748345586 2988 dbSNP
rs560753646 2991 dbSNP
rs1021532570 2993 dbSNP
rs976010589 2994 dbSNP
rs1422936663 2998 dbSNP
rs1170008500 3001 dbSNP
rs1277162749 3006 dbSNP
rs1391379074 3011 dbSNP
rs548975612 3016 dbSNP
rs767825302 3027 dbSNP
rs1327430562 3030 dbSNP
rs1341785000 3031 dbSNP
rs1012017643 3033 dbSNP
rs953379775 3037 dbSNP
rs1356829870 3040 dbSNP
rs1017401329 3042 dbSNP
rs530492741 3043 dbSNP
rs1251734414 3052 dbSNP
rs1029501870 3057 dbSNP
rs1370799157 3058 dbSNP
rs1194047656 3060 dbSNP
rs151237873 3064 dbSNP
rs1461677566 3067 dbSNP
rs954323478 3069 dbSNP
rs1448538546 3082 dbSNP
rs902013798 3085 dbSNP
rs76119286 3087 dbSNP
rs1443020833 3089 dbSNP
rs189050862 3094 dbSNP
rs1195573308 3095 dbSNP
rs1327739335 3108 dbSNP
rs117159648 3114 dbSNP
rs142281368 3120 dbSNP
rs1166709771 3122 dbSNP
rs1032156405 3123 dbSNP
rs1470566271 3126 dbSNP
rs1335512243 3131 dbSNP
rs533311976 3135 dbSNP
rs1002485460 3137 dbSNP
rs574290621 3146 dbSNP
rs779006803 3154 dbSNP
rs1453659555 3155 dbSNP
rs755294688 3157 dbSNP
rs555449596 3166 dbSNP
rs1257503534 3177 dbSNP
rs1013626663 3184 dbSNP
rs185738163 3189 dbSNP
rs145236324 3191 dbSNP
rs1202886542 3201 dbSNP
rs181936264 3209 dbSNP
rs1460032665 3210 dbSNP
rs1047536024 3213 dbSNP
rs1204061085 3223 dbSNP
rs1436220382 3225 dbSNP
rs938474024 3230 dbSNP
rs928382465 3231 dbSNP
rs752010688 3238 dbSNP
rs1481083555 3242 dbSNP
rs920211507 3246 dbSNP
rs189082878 3255 dbSNP
rs1454871694 3259 dbSNP
rs1242828532 3261 dbSNP
rs34384122 3266 dbSNP
rs1374472249 3268 dbSNP
rs1278656667 3272 dbSNP
rs1439553049 3275 dbSNP
rs977255613 3276 dbSNP
rs1039866944 3277 dbSNP
rs1312881011 3281 dbSNP
rs1434056702 3322 dbSNP
rs945867114 3323 dbSNP
rs184712675 3329 dbSNP
rs1160365412 3330 dbSNP
rs912740259 3331 dbSNP
rs990051766 3333 dbSNP
rs41278373 3341 dbSNP
rs913552401 3342 dbSNP
rs988234665 3343 dbSNP
rs957976396 3345 dbSNP
rs528897391 3349 dbSNP
rs368427601 3362 dbSNP
rs1259708176 3363 dbSNP
rs1421354551 3371 dbSNP
rs1159196737 3374 dbSNP
rs976077283 3379 dbSNP
rs1359548250 3383 dbSNP
rs1002082965 3393 dbSNP
rs1485372491 3408 dbSNP
rs969153510 3410 dbSNP
rs534576164 3416 dbSNP
rs966150728 3421 dbSNP
rs144338996 3422 dbSNP
rs1301013805 3425 dbSNP
rs762572113 3428 dbSNP
rs1015002333 3438 dbSNP
rs11705 3442 dbSNP
rs766961030 3443 dbSNP
rs756727902 3446 dbSNP
rs772958055 3447 dbSNP
rs763645026 3455 dbSNP
rs1360376073 3463 dbSNP
rs1267126201 3466 dbSNP
rs1481911989 3467 dbSNP
rs1178271553 3472 dbSNP
rs7581 3493 dbSNP
rs1416763027 3506 dbSNP
rs1356926847 3509 dbSNP
rs7340 3511 dbSNP
rs898505484 3519 dbSNP
rs10717187 3520 dbSNP
rs201261744 3520 dbSNP
rs373809550 3520 dbSNP
rs551546974 3520 dbSNP
rs763111349 3520 dbSNP
rs1040318999 3521 dbSNP
rs942948396 3521 dbSNP
rs1317196210 3525 dbSNP
rs1444682978 3525 dbSNP
rs533543325 3534 dbSNP
rs912704393 3538 dbSNP
rs559952678 3547 dbSNP
rs192116774 3549 dbSNP
rs933041469 3550 dbSNP
rs906987115 3553 dbSNP
rs913682662 3557 dbSNP
rs188806077 3561 dbSNP
rs945881281 3570 dbSNP
rs1184935589 3574 dbSNP
rs1243151281 3577 dbSNP
rs957909464 3582 dbSNP
rs1181357358 3596 dbSNP
rs562415848 3614 dbSNP
rs1410299919 3616 dbSNP
rs990474369 3623 dbSNP
rs1470875450 3627 dbSNP
rs1338792511 3628 dbSNP
rs1420231204 3629 dbSNP
rs1452280046 3638 dbSNP
rs1282617208 3647 dbSNP
rs1364588404 3653 dbSNP
rs1165884388 3659 dbSNP
rs931955331 3661 dbSNP
rs921835671 3662 dbSNP
rs1474959567 3665 dbSNP
rs1255473302 3674 dbSNP
rs976108602 3677 dbSNP
rs543445677 3678 dbSNP
rs1263285446 3682 dbSNP
rs1486439786 3682 dbSNP
rs1024745140 3689 dbSNP
rs1013411004 3694 dbSNP
rs1207645782 3698 dbSNP
rs1015034919 3709 dbSNP
rs1241923099 3716 dbSNP
rs866143215 3718 dbSNP
rs1421129494 3722 dbSNP
rs1214024933 3724 dbSNP
rs983501836 3736 dbSNP
rs952316042 3739 dbSNP
rs184665282 3742 dbSNP
rs1012823345 3743 dbSNP
rs1469339142 3748 dbSNP
rs959679992 3751 dbSNP
rs1035218302 3758 dbSNP
rs1347213254 3762 dbSNP
rs1232299371 3763 dbSNP
rs1332109176 3764 dbSNP
rs1338886582 3764 dbSNP
rs139917359 3769 dbSNP
rs1215095144 3773 dbSNP
rs1361137828 3776 dbSNP
rs1286923859 3778 dbSNP
rs1442882557 3779 dbSNP
rs1216998705 3780 dbSNP
rs1394937680 3781 dbSNP
rs1447230927 3781 dbSNP
rs1326898087 3782 dbSNP
rs75539595 3782 dbSNP
rs1461064643 3783 dbSNP
rs1415771083 3784 dbSNP
rs1172568230 3785 dbSNP
rs1429648192 3786 dbSNP
rs906851368 3790 dbSNP
rs1170900319 3791 dbSNP
rs1041453597 3792 dbSNP
rs1009946340 3793 dbSNP
rs1254008807 3794 dbSNP
rs1359081831 3795 dbSNP
rs892872577 3796 dbSNP
rs1054328711 3797 dbSNP
rs931793651 3798 dbSNP
rs921869150 3799 dbSNP
rs1040291354 3800 dbSNP
rs1293430060 3801 dbSNP
rs1491385514 3801 dbSNP
rs1222994655 3802 dbSNP
rs1223831291 3802 dbSNP
rs1267837163 3802 dbSNP
rs1283415837 3802 dbSNP
rs1361097449 3802 dbSNP
rs1378733815 3802 dbSNP
rs1390446123 3802 dbSNP
rs1491126027 3802 dbSNP
rs200140955 3802 dbSNP
rs60869717 3802 dbSNP
rs73654214 3802 dbSNP
rs746242596 3802 dbSNP
rs758033354 3802 dbSNP
rs763246221 3802 dbSNP
rs878911117 3802 dbSNP
rs1236390042 3803 dbSNP
rs1246184583 3804 dbSNP
rs1306409088 3804 dbSNP
rs1384554698 3804 dbSNP
rs138872014 3804 dbSNP
rs1440873144 3804 dbSNP
rs555809476 3804 dbSNP
rs796905500 3804 dbSNP
rs891973318 3804 dbSNP
rs1290839848 3806 dbSNP
rs1197526151 3808 dbSNP
rs1353987208 3808 dbSNP
rs1273654975 3809 dbSNP
rs1371474588 3809 dbSNP
rs1437121927 3810 dbSNP
rs1052576951 3811 dbSNP
rs907836184 3814 dbSNP
rs1446730437 3819 dbSNP
rs1440481442 3820 dbSNP
rs1388781556 3825 dbSNP
rs1300089014 3830 dbSNP
rs1368289416 3830 dbSNP
rs983855348 3840 dbSNP
rs952197197 3850 dbSNP
rs1169962039 3851 dbSNP
rs576211953 3857 dbSNP
rs146000741 3859 dbSNP
rs1465504391 3863 dbSNP
rs991028418 3865 dbSNP
rs1354011719 3868 dbSNP
rs947971072 3869 dbSNP
rs41278371 3872 dbSNP
rs1407641379 3874 dbSNP
rs959783355 3877 dbSNP
rs1035249978 3878 dbSNP
rs1338535064 3884 dbSNP
rs1193356162 3889 dbSNP
rs1003714512 3906 dbSNP
rs1025493113 3909 dbSNP
rs13296895 3912 dbSNP
rs768403873 3913 dbSNP
rs112571676 3914 dbSNP
rs1480058414 3917 dbSNP
rs1290300375 3918 dbSNP
rs1249050390 3926 dbSNP
rs192761258 3928 dbSNP
rs1018267692 3934 dbSNP
rs765157421 3937 dbSNP
rs1006937910 3946 dbSNP
rs1348447527 3951 dbSNP
rs1477814480 3953 dbSNP
rs1019945222 3958 dbSNP
rs557968442 3959 dbSNP
rs1010491834 3968 dbSNP
rs1301708291 3974 dbSNP
rs201744855 3975 dbSNP
rs1399614253 3977 dbSNP
rs1337274072 3979 dbSNP
rs891936254 3986 dbSNP
rs1318789491 3988 dbSNP
rs1054643802 3990 dbSNP
rs1285087409 3993 dbSNP
rs1324120527 3997 dbSNP
rs1224241241 4001 dbSNP
rs371027055 4005 dbSNP
rs1482408426 4009 dbSNP
rs868342507 4011 dbSNP
rs1207110065 4014 dbSNP
rs1262953472 4021 dbSNP
rs1488150502 4022 dbSNP
rs567405385 4023 dbSNP
rs1306191905 4026 dbSNP
rs770952249 4026 dbSNP
rs1481010923 4027 dbSNP
rs34880734 4029 dbSNP
rs1381176047 4034 dbSNP
rs1174758475 4038 dbSNP
rs1437158462 4038 dbSNP
rs142108026 4042 dbSNP
rs1173539935 4047 dbSNP
rs1464894810 4048 dbSNP
rs1359715650 4051 dbSNP
rs1304691521 4054 dbSNP
rs1397935780 4054 dbSNP
rs1346077558 4055 dbSNP
rs142623171 4058 dbSNP
rs1300750473 4060 dbSNP
rs769283302 4060 dbSNP
rs1182096038 4061 dbSNP
rs76236252 4065 dbSNP
rs917584263 4066 dbSNP
rs1247841750 4076 dbSNP
rs996042194 4100 dbSNP
rs1189384116 4102 dbSNP
rs1490672990 4107 dbSNP
rs1485697877 4119 dbSNP
rs1191117502 4120 dbSNP
rs1487710070 4136 dbSNP
rs1181838257 4138 dbSNP
rs1379331526 4141 dbSNP
rs1417411066 4143 dbSNP
rs900308058 4148 dbSNP
rs1279569038 4151 dbSNP
rs1365953622 4153 dbSNP
rs1457407952 4153 dbSNP
rs1291682402 4155 dbSNP
rs1365644012 4155 dbSNP
rs560792132 4156 dbSNP
rs1208631413 4165 dbSNP
rs992012105 4165 dbSNP
rs918400577 4169 dbSNP
rs1322664022 4170 dbSNP
rs1221537592 4171 dbSNP
rs1040318058 4172 dbSNP
rs776723225 4173 dbSNP
rs1481881692 4177 dbSNP
rs1177283291 4181 dbSNP
rs1236973090 4183 dbSNP
rs907786555 4189 dbSNP
rs1246428684 4193 dbSNP
rs1047752998 4197 dbSNP
rs1385678424 4198 dbSNP
rs1423005593 4199 dbSNP
rs773926528 4204 dbSNP
rs1352649403 4218 dbSNP
rs930622308 4229 dbSNP
rs1018407473 4236 dbSNP
rs150710977 4248 dbSNP
rs920710276 4249 dbSNP
rs551412388 4253 dbSNP
rs959542408 4254 dbSNP
rs1317394878 4262 dbSNP
rs187487585 4264 dbSNP
rs1228139668 4266 dbSNP
rs1310940211 4278 dbSNP
rs141137508 4282 dbSNP
rs1356137969 4296 dbSNP
rs148202082 4304 dbSNP
rs143075984 4308 dbSNP
rs1394739557 4313 dbSNP
rs1387600726 4317 dbSNP
rs966965362 4327 dbSNP
rs748171167 4331 dbSNP
rs1237718052 4339 dbSNP
rs1159468610 4346 dbSNP
rs1482703077 4350 dbSNP
rs562243895 4355 dbSNP
rs1421369871 4357 dbSNP
rs1409367824 4366 dbSNP
rs556977481 4368 dbSNP
rs1429115812 4369 dbSNP
rs1169834482 4373 dbSNP
rs988517523 4374 dbSNP
rs957237757 4380 dbSNP
rs1032774734 4384 dbSNP
rs1338732155 4390 dbSNP
rs1475285841 4394 dbSNP
rs1359967420 4398 dbSNP
rs1447503243 4405 dbSNP
rs1256181986 4409 dbSNP
rs1000403378 4416 dbSNP
rs867090327 4417 dbSNP
rs1364524249 4418 dbSNP
rs996295097 4425 dbSNP
rs544126437 4428 dbSNP
rs572601844 4433 dbSNP
rs1018824425 4446 dbSNP
rs1008724032 4450 dbSNP
rs375643926 4465 dbSNP
rs1262211765 4472 dbSNP
rs886380834 4481 dbSNP
rs896125243 4483 dbSNP
rs1207579069 4486 dbSNP
rs1243672957 4488 dbSNP
rs1488481203 4493 dbSNP
rs1056161042 4505 dbSNP
rs1048084739 4507 dbSNP
rs370605223 4511 dbSNP
rs1260976340 4514 dbSNP
rs1481337546 4515 dbSNP
rs1178691825 4527 dbSNP
rs1266518292 4539 dbSNP
rs1235365531 4543 dbSNP
rs930676556 4544 dbSNP
rs929861745 4548 dbSNP
rs1335561583 4550 dbSNP
rs899129454 4551 dbSNP
rs1038606685 4555 dbSNP
rs941141366 4556 dbSNP
rs774547830 4561 dbSNP
rs1055216170 4568 dbSNP
rs1237357765 4608 dbSNP
rs1243293103 4613 dbSNP
rs938135102 4614 dbSNP
rs928043409 4621 dbSNP
rs1328658806 4622 dbSNP
rs982273467 4631 dbSNP
rs945528401 4643 dbSNP
rs768737103 4645 dbSNP
rs780354189 4654 dbSNP
rs990110015 4664 dbSNP
rs955455520 4666 dbSNP
rs957068897 4667 dbSNP
rs1033130117 4683 dbSNP
rs564102574 4696 dbSNP
rs1283541152 4705 dbSNP
rs756489030 4707 dbSNP
rs1490835958 4709 dbSNP
rs184091769 4712 dbSNP
rs974398480 4718 dbSNP
rs572158955 4720 dbSNP
rs964485927 4721 dbSNP
rs1359019300 4722 dbSNP
rs7041281 4725 dbSNP
rs539320862 4727 dbSNP
rs1433709469 4728 dbSNP
rs547531889 4728 dbSNP
rs1476364929 4738 dbSNP
rs36110889 4745 dbSNP
rs535456701 4750 dbSNP
rs1377198316 4751 dbSNP
rs192323485 4755 dbSNP
rs1306896080 4763 dbSNP
rs774199040 4774 dbSNP
rs1011936602 4783 dbSNP
rs1254583938 4784 dbSNP
rs1026237330 4787 dbSNP
rs777874780 4788 dbSNP
rs1449757067 4801 dbSNP
rs756311125 4805 dbSNP
rs896261101 4806 dbSNP
rs1469043203 4816 dbSNP
rs995120558 4819 dbSNP
rs1378905391 4820 dbSNP
rs1056528472 4841 dbSNP
rs1208183338 4843 dbSNP
rs1164157869 4845 dbSNP
rs573825451 4848 dbSNP
rs1390646796 4853 dbSNP
rs1404033453 4866 dbSNP
rs899081185 4875 dbSNP
rs1400383053 4879 dbSNP
rs1271349996 4885 dbSNP
rs1445637872 4893 dbSNP
rs1306606697 4899 dbSNP
rs1055571357 4901 dbSNP
rs938002516 4904 dbSNP
rs1384484304 4923 dbSNP
rs993885115 4923 dbSNP
rs906651388 4924 dbSNP
rs552993564 4931 dbSNP
rs1227321871 4933 dbSNP
rs1046442760 4934 dbSNP
rs1354182692 4947 dbSNP
rs896823512 4956 dbSNP
rs945562603 4968 dbSNP
rs111885439 4971 dbSNP
rs1198033449 4975 dbSNP
rs1236614990 4976 dbSNP
rs1444269452 4977 dbSNP
rs1188691936 4979 dbSNP
rs1306001170 4983 dbSNP
rs1472132722 4989 dbSNP
rs989750721 5000 dbSNP
rs1393219445 5010 dbSNP
rs1321152854 5015 dbSNP
rs1411194582 5022 dbSNP
rs1328643905 5024 dbSNP
rs1403911558 5025 dbSNP
rs1396194070 5030 dbSNP
rs1396588659 5036 dbSNP
rs1338483828 5041 dbSNP
rs1167323767 5043 dbSNP
rs1432865470 5047 dbSNP
rs143577884 5069 dbSNP
rs921513278 5079 dbSNP
rs576426508 5083 dbSNP
rs1347469616 5087 dbSNP
rs748381515 5093 dbSNP
rs1201240269 5096 dbSNP
rs1396693566 5097 dbSNP
rs1049619817 5102 dbSNP
rs1441029678 5108 dbSNP
rs964349997 5117 dbSNP
rs1193975057 5120 dbSNP
rs1196241712 5124 dbSNP
rs1264574744 5125 dbSNP
rs911655648 5126 dbSNP
rs1453550244 5131 dbSNP
rs1167934949 5137 dbSNP
rs987183598 5139 dbSNP
rs1466295198 5155 dbSNP
rs557740405 5161 dbSNP
rs1246382707 5166 dbSNP
rs1171614627 5167 dbSNP
rs1399549593 5167 dbSNP
rs751016091 5168 dbSNP
rs1401648611 5174 dbSNP
rs1197016093 5175 dbSNP
rs950580310 5177 dbSNP
rs1298512375 5179 dbSNP
rs781550835 5182 dbSNP
rs1026607720 5186 dbSNP
rs994674283 5191 dbSNP
rs1273727803 5192 dbSNP
rs963656035 5203 dbSNP
rs1033540563 5215 dbSNP
rs201657663 5220 dbSNP
rs16401 5224 dbSNP
rs3834892 5224 dbSNP
rs748315491 5224 dbSNP
rs1255656277 5228 dbSNP
rs922750936 5230 dbSNP
rs539451290 5234 dbSNP
rs1340612213 5237 dbSNP
rs1287124641 5239 dbSNP
rs867918735 5244 dbSNP
rs1488285536 5254 dbSNP
rs1268897709 5258 dbSNP
rs1282945302 5258 dbSNP
rs1433287047 5261 dbSNP
rs1197497753 5263 dbSNP
rs1375573580 5264 dbSNP
rs1421075577 5266 dbSNP
rs28361094 5277 dbSNP
rs370239255 5277 dbSNP
rs371846931 5277 dbSNP
rs199856655 5279 dbSNP
rs1365036125 5284 dbSNP
rs1359657394 5297 dbSNP
rs1370677292 5302 dbSNP
rs138442320 5308 dbSNP
rs1443908200 5311 dbSNP
rs545584907 5313 dbSNP
rs906515549 5318 dbSNP
rs187755520 5324 dbSNP
rs1300597430 5326 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000374586.3 | 3UTR | AAGUGAAAUACUUAUUAAGCUGCUAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000374586.3 | 3UTR | AAAUACUUAUUAAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000374586.3 | 3UTR | AAAUACUUAUUAAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000374586.3 | 3UTR | AAAUACUUAUUAAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000374586.3 | 3UTR | AAAUACUUAUUAAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000374586.3 | 3UTR | AAGUGAAAUACUUAUUAAGCUGCUAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000374586.3 | 3UTR | AAAUACUUAUUAAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.438 6.1e-3 -0.385 1.5e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.478 1.7e-2 0.647 1.0e-3 20 Click to see details
GSE21032 Prostate cancer 0.219 2.3e-2 0.178 5.4e-2 83 Click to see details
GSE19536 Breast cancer 0.169 4.6e-2 0.154 6.3e-2 100 Click to see details
GSE14794 Lymphoblastoid cells -0.146 8.5e-2 -0.126 1.2e-1 90 Click to see details
GSE38226 Liver fibrosis 0.286 1.0e-1 0.294 9.8e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.346 1.2e-1 -0.247 2.1e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.336 1.4e-1 0.175 2.9e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.09 2.2e-1 0.082 2.4e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.172 2.2e-1 -0.109 3.1e-1 23 Click to see details
GSE17306 Multiple myeloma -0.113 2.2e-1 -0.226 5.9e-2 49 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.043 3.7e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.108 3.1e-1 -0.196 1.8e-1 24 Click to see details
GSE28544 Breast cancer 0.105 3.1e-1 0.543 3.1e-3 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.061 3.9e-1 -0.082 3.5e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.039 4.3e-1 -0.057 3.9e-1 25 Click to see details
GSE21849 B cell lymphoma -0.018 4.6e-1 0.362 2.7e-2 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.017 4.7e-1 0.192 2.1e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.009 4.9e-1 0.035 4.5e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.009 4.9e-1 0.035 4.5e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.769 0 -0.773 0 32 Click to see details
BLCA -0.601 0 -0.513 0.01 18 Click to see details
KIRP -0.404 0.01 -0.479 0 32 Click to see details
THCA -0.27 0.02 -0.268 0.02 59 Click to see details
CESC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC -0.243 0.06 -0.324 0.02 42 Click to see details
UCEC 0.367 0.06 0.198 0.21 19 Click to see details
COAD -0.549 0.08 -0.619 0.05 8 Click to see details
CHOL -0.467 0.1 -0.517 0.08 9 Click to see details
PCPG -0.919 0.13 -1.000 0.5 3 Click to see details
KIRC -0.137 0.13 -0.093 0.23 68 Click to see details
KICH -0.228 0.14 -0.155 0.23 25 Click to see details
LUAD -0.235 0.23 -0.161 0.31 12 Click to see details
LIHC 0.098 0.25 0.105 0.24 49 Click to see details
LUSC 0.083 0.31 0.116 0.24 38 Click to see details
PRAD -0.061 0.34 -0.044 0.38 50 Click to see details
BRCA 0.043 0.35 0.031 0.39 84 Click to see details
ESCA 0.077 0.41 -0.045 0.45 11 Click to see details
PAAD 0.036 0.48 0.600 0.2 4 Click to see details
PAAD 0.036 0.48 0.600 0.2 4 Click to see details
PAAD 0.036 0.48 0.600 0.2 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1