miRTarBase - #MIRT505116 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol YTHDC1   
Synonyms YT521, YT521-B
Description YTH domain containing 1
Transcript NM_001031732   
Other Transcripts NM_133370   
Expression
Putative miRNA Targets on YTHDC1
3'UTR of YTHDC1
(miRNA target sites are highlighted)
>YTHDC1|NM_001031732|3'UTR
   1 TGGGCTTTTGGAAGCACTGATTGTTTAAAGATACAAAAAATCTTGTATTTTTTTTTTGTGTGTGTTTACAAGTAGTAAAT
  81 TTATTTTCAGCTGTCTGCCTATGAAGTTCATTGTGTAGAAGGATTTATTATGACCCCCTTTGTTCCAAGCATGCAGTATC
 161 ATAAGAACTGGAAAAACTCAAATCCGCCAAAAATCCACAGCTGACAGTTGAATTGACACTTTTATTGGGGCAGAATGGAA
 241 CAGTCCAAGAATGTAGATACTGATTCTTTCTCCATAAATGTTCTTATAGTGTGTTCATCCTAGAGTTATTTTTTTGTTTG
 321 TTTTTTTCCTTTTTGGATCTTGATTGATAACTGCCATGATATTTTGCTTTGATGTGTTTCTACATGTAGTTGCACACGGT
 401 TCAGTAAAAATAATGCTGCTATCGAGTATGCAAATATTGAAGTATGATGGTTTGACTGTATGGCAGTGTTGTAGCAGCCT
 481 CTTGTTTTTTTCCCCATTGCCTCTTTTTTTAAAAAACTTATAAAGTCACTTTTTATTTTTCCTCAGTCTTCAATGACGAG
 561 AGCAATATTAAGAAGACATTGCTATCTAATTTTTAATCTTTTTAAATGAAAAATTCCTATGTTCAGTAGCGTGGTTGATG
 641 CTATTGTTTAGCCTTCCCCTCCAAATTGTATACATTGGCTTGGAATGTTCACAACTTGCGTGCGTGGCAGCGGAAGACGA
 721 TTCCCATATTCTACATTGCTACTGTTTTGTATAAAATAAATTGGTAAAGATTGACGGTTATCTTTTGTATCTTTTTCTTA
 801 TCCAATTGCAGGTTTGTTTTATTATGCAATAATGGACATAAAAGCATGCTTTTTGTTCAGGAATTTTAGGAACCCCATTT
 881 GCTTTTTTTGAGGCACACTTTAGCAGAAATGATTGACCTAGGCCTGTTGCATTAAAAGCTTACTTCTATTTCTAACATAA
 961 GATACACAGAGTTATGTTAATAATTTGGTTAAGTATTTATACACCTGATAACATTTTGAGTCTACTCTGATCACAGAATC
1041 GTTTATTTAGGTTTTCTATTTGTTGTTTTAGTCTTCTGTAAGTGAACGACTTTGTACATGCTTTCTACTTTACTTCATAA
1121 ATGGACTTTTAACCCTCTTGTATTAGTTCTGTATTTTAAGTTAACTGTCCAGTTCTCCCAGTGGTAACCAACTATAACAT
1201 AGAAATAGAGCCGCTCAAGAAAACAGTTTATGAAATAATTTTTTTGAATTTTTTCTTGAGTTACACCTGGAGTTTTGGCC
1281 TTTGGAATTTGGCCTTTATAAACATTAGGAATATTTGAATGTTTGATTTTTTTATAGTATCAACAGTTGTACTGTGTACC
1361 AGATCACATAGTACAGTTTTACATTTAATCTATATTGGCCTGAAAAGAACAACACAGGCACTTTACTCTTAAAGGATATA
1441 ATAAACTATAGTTATACTGCATTCATATTCATACCAGCATGTAGTATCTTTCCCTGCATTCACAGAAGTTTTATTTACAA
1521 TGACAAAACTAAAGCCTGAGGATTTGTTTTAAATCTGCATTGTGGTAGAGAGGAAAAAGTACTTTTAAGGAAACCTGGGT
1601 TCTAGTTTTGTCATTGTCTTTAATTAAACCGGTTAGTGATACATGGTAAGTCACTTCATTGGCATTTTGTGTATTCATCA
1681 GTAAGCTAGACAAGATGATAGCTACAGTTTAAGAATTTCTGTAACCATTATACAAAACTGGTAGGTAATATTAAAGGTAT
1761 TTTCCTGAAATAATAGGAATAAATACTGAGCACTTTGTATGCAATAGAGACTTTGTGCTTTTATATACAGACTCATTTAA
1841 ATGGGCTCAGAGAGGCTAGTAAACTTGCCCAAGATTAGAAAGGTAGTAATTGATGGGCCAAGATTTTACCCATGTTTTTA
1921 TTTGGTGTTTCTAAACCACCTCATCACTTTTGAAAAAACAGTATATAAATTAATAAATGTTTTGGAGATGGAGTCTGTCG
2001 CCCAGGTGGAGGGCAGTGGCATGATCTTGGCTCACTGCAACCTCCTGCCTCAGCCTCCCGAATGGCTGGGACTACAGGCA
2081 CCCACCACCACACCCCGCTAATTTTTGTAATTTTAGTAGAGATGGGGTTCCAACATGTTGGCCAGGCTGGTCTCAAACTC
2161 GACCTCAAGTGACCTCACCTGCCTCAGCCTCCTAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCTGGCCTGAGATT
2241 TTTAAACATTAACATTTCCTTCAGGCTTAAGCAGAGGATTTTTCTAAAGTGCCATCCAATTAGATGTTAAGTTATGCTTT
2321 GTATGTTGAGCTTAGTATTGAGTCGATCTATTTTAAAAAGCCAACATTAAGTTTTTACCAAGTATCTGGCACTATTCTAA
2401 ACAATTCTGTTGGCTCACATAATCATCACTGTTTTCTCCTTTCCTAATTTTTAAAATAAACTTACCGGAACATTGTATAA
2481 AAAATGCAAGATTTTTTTCTGTACAGAAGAGTCAGTATATAAAAATCAGTATGTTTTATTTAATATTCGTACACATGACA
2561 GCTTTTGTCACTGTGAGAAGACATGGTTTCTTTCGTGTACTCCACTGTGCTGTGATTCTAACAATCTACATTAGTATGAT
2641 GTGTTCAGATGAAAAACAGAAAATTCAGTCATTCCGAGTTTAGAAATCCGGTCAGGGATTTTATTGGCTGGAGTAATAGT
2721 TCAAAGGAGTGAAAATTCAAGCATGTAATTTTTGGATTTGATTTCCTCCATAATGATTTCCTCCATAATGGCTTTTTTTC
2801 AAGCATGGTCTAATTTTTCAGAAAATGGCCATTATCTCCAAGCTTCCATTGTCCATGTAGTTTCAGTGGCAGGAGAGAGA
2881 CTATTTTCCTCCCAGTGTCCATGTCAGTTCCCCAAAAGGACTGAATAGCCATGTTGGTTTTGGAGCCAGCCGTAATCCAA
2961 TCTGTATTTCCAAGGAAATGGGGTTCTTTGTCTCCCAGCATTGGGAAGCAAGAGAGGCACATGTTATGGTCACCTCTGTG
3041 AGGATTACATCAGGAAGGACAGTCTCCAAAAGACATGGACAGAGGAAATTTAGCAGATGTCCATTAAATCAGGATCTCAT
3121 ACAAGTTATAACACCTGAATGTTTGACTTTTCAGAGTATTTTGCCATCACAGGTGTGGCATCTTGCCCTTGGATATATCT
3201 ACATTCTGCTGTAGAATGTCGTGGTCTTTCTGAGGGTCACATACATCCTGTCTTGTCATAATGTTAACCATTAAGAGTCC
3281 TCAGGGGCATGGAATTGAAGAAGGAACTGTTGCCAGCAGTTAACTGACCAAGCTAGAGTTCCCTGACCCAACGTAAGGGT
3361 GACTGTGACACACATGGATAATTTTAGCTTCATGTTTAAGATTTTGTTATTTGGGTAGGAAACATTCCAAATGCAGTTTG
3441 AAACACATATTAAAATTGAGGCACACAGGAAAGAACTGGCTCAAGTTTAGTCCCCAAGTTCCTTATAGTAGGAATAGGAA
3521 TCCTTAGAGTATAAGCAATCCATGCATAGTATTCTGTTATCTATCATGTAGATCATTTAATCTCTAATTTTTTGGGGTGG
3601 GGATTCTCTTGTTTCTAAATCTTACACTTTCAGTTTCTTCTGTGTCTTAAATATAGATTATTGACTATTGTCTTAAATAC
3681 TAATAAATACATTAAATGTATCTTAAATACTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|||  | ||  ||||||| 
Target 5' agTAAA--AATA-ATGCTGCTa 3'
403 - 421 147.00 -10.80
2
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            :|:::: | ||| ||:||:| 
Target 5' ttTAGGTTTTCTATTTGTTGTTt 3'
1046 - 1068 124.00 -7.60
3
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||: | |:| :| || |||| 
Target 5' ttCAGTAGCGTGGT-TGATGCTa 3'
622 - 643 119.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30184423 13 COSMIC
COSN25218093 17 COSMIC
COSN30146027 42 COSMIC
COSN2042726 47 COSMIC
COSN2534888 47 COSMIC
COSN18729074 56 COSMIC
COSN9051050 160 COSMIC
COSN28811860 179 COSMIC
COSN9051049 200 COSMIC
COSN21621462 201 COSMIC
COSN31602618 243 COSMIC
COSN8491259 274 COSMIC
COSN31529757 320 COSMIC
COSN26152370 382 COSMIC
COSN5063340 507 COSMIC
COSN30542642 518 COSMIC
COSN6841921 522 COSMIC
COSN31585234 589 COSMIC
COSN31564561 630 COSMIC
COSN31535816 672 COSMIC
COSN31534614 718 COSMIC
COSN31593081 757 COSMIC
COSN15818108 970 COSMIC
COSN20091049 1353 COSMIC
COSN15677428 1447 COSMIC
COSN2042725 1455 COSMIC
COSN31959915 1638 COSMIC
COSN15067830 1643 COSMIC
COSN15309724 2121 COSMIC
COSN20593591 2444 COSMIC
COSN23539094 2792 COSMIC
COSN7503313 2891 COSMIC
COSN5858277 2937 COSMIC
COSN2042724 3044 COSMIC
COSN25067161 3439 COSMIC
COSN9051048 3502 COSMIC
COSN25715903 3593 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1465957847 10 dbSNP
rs763073471 15 dbSNP
rs753031727 17 dbSNP
rs751765385 21 dbSNP
rs759604032 22 dbSNP
rs986103929 26 dbSNP
rs1247186299 32 dbSNP
rs1201181691 33 dbSNP
rs776881032 34 dbSNP
rs767529967 35 dbSNP
rs538932785 36 dbSNP
rs774272944 38 dbSNP
rs768559053 39 dbSNP
rs749039491 40 dbSNP
rs1346373335 41 dbSNP
rs775146566 42 dbSNP
rs769350398 45 dbSNP
rs77120616 48 dbSNP
rs777521762 48 dbSNP
rs1330689184 52 dbSNP
rs189030016 56 dbSNP
rs1327092601 57 dbSNP
rs79205979 57 dbSNP
rs1227885514 58 dbSNP
rs1353161414 58 dbSNP
rs143621035 58 dbSNP
rs1443173424 60 dbSNP
rs964092437 62 dbSNP
rs550156784 64 dbSNP
rs978031353 65 dbSNP
rs1455516323 72 dbSNP
rs1442935126 76 dbSNP
rs1387067023 79 dbSNP
rs1249507209 85 dbSNP
rs1158881068 90 dbSNP
rs1182224600 100 dbSNP
rs967562642 100 dbSNP
rs549305480 101 dbSNP
rs1464181868 125 dbSNP
rs1171192562 130 dbSNP
rs1415390662 134 dbSNP
rs991922786 137 dbSNP
rs955550330 139 dbSNP
rs960421078 158 dbSNP
rs1033318293 160 dbSNP
rs999703283 161 dbSNP
rs567706342 163 dbSNP
rs1255620832 168 dbSNP
rs902875179 168 dbSNP
rs35250360 169 dbSNP
rs758357764 170 dbSNP
rs1186123624 171 dbSNP
rs1463885625 178 dbSNP
rs547560395 182 dbSNP
rs527814805 185 dbSNP
rs1430946735 190 dbSNP
rs1264501649 199 dbSNP
rs1001811240 206 dbSNP
rs559254777 209 dbSNP
rs1344815136 210 dbSNP
rs1027565706 218 dbSNP
rs1011287778 221 dbSNP
rs552366688 225 dbSNP
rs1308716409 231 dbSNP
rs1236856516 241 dbSNP
rs139009800 253 dbSNP
rs1398808173 260 dbSNP
rs897661288 263 dbSNP
rs563243264 264 dbSNP
rs1348876759 267 dbSNP
rs1296896768 270 dbSNP
rs1300901784 276 dbSNP
rs185148719 284 dbSNP
rs1328088430 285 dbSNP
rs567902563 287 dbSNP
rs1295059261 293 dbSNP
rs192775885 297 dbSNP
rs1318939212 316 dbSNP
rs1395215850 320 dbSNP
rs1047034670 328 dbSNP
rs867974338 328 dbSNP
rs1399870549 329 dbSNP
rs1487247592 333 dbSNP
rs1208695298 336 dbSNP
rs1314324704 337 dbSNP
rs1469491833 340 dbSNP
rs889193511 344 dbSNP
rs1388629820 349 dbSNP
rs1434877705 359 dbSNP
rs1171797825 361 dbSNP
rs1270916752 366 dbSNP
rs1375259651 371 dbSNP
rs560971897 372 dbSNP
rs765766028 374 dbSNP
rs1456487992 389 dbSNP
rs1292968233 392 dbSNP
rs1395514037 395 dbSNP
rs1050442083 397 dbSNP
rs1166115514 398 dbSNP
rs1364268189 400 dbSNP
rs1228840676 403 dbSNP
rs540745572 404 dbSNP
rs926230175 405 dbSNP
rs373849163 423 dbSNP
rs974106171 424 dbSNP
rs1041979181 428 dbSNP
rs572125160 437 dbSNP
rs1206504228 439 dbSNP
rs1375268893 447 dbSNP
rs942675678 450 dbSNP
rs946249848 479 dbSNP
rs551183607 481 dbSNP
rs752851554 487 dbSNP
rs1254428415 491 dbSNP
rs1422526374 493 dbSNP
rs911320661 496 dbSNP
rs992928117 501 dbSNP
rs1486094531 505 dbSNP
rs960471886 506 dbSNP
rs1031145178 507 dbSNP
rs926356258 510 dbSNP
rs1226237035 511 dbSNP
rs980439801 511 dbSNP
rs1321802803 516 dbSNP
rs951754814 521 dbSNP
rs1293823804 535 dbSNP
rs1356876252 535 dbSNP
rs765594951 545 dbSNP
rs139588027 546 dbSNP
rs1244059933 555 dbSNP
rs1267140911 556 dbSNP
rs993447841 557 dbSNP
rs1022493938 558 dbSNP
rs1262798989 564 dbSNP
rs562761304 577 dbSNP
rs962243052 578 dbSNP
rs1181852221 592 dbSNP
rs1258803759 595 dbSNP
rs1476251717 598 dbSNP
rs1018810772 611 dbSNP
rs1180056421 613 dbSNP
rs1314419577 614 dbSNP
rs1411534954 616 dbSNP
rs1401444058 617 dbSNP
rs1415189795 617 dbSNP
rs1161025596 618 dbSNP
rs1357280389 619 dbSNP
rs1465345878 626 dbSNP
rs558848765 630 dbSNP
rs537778880 631 dbSNP
rs36215898 633 dbSNP
rs1050490807 641 dbSNP
rs1373618569 643 dbSNP
rs1225184499 649 dbSNP
rs1411146533 656 dbSNP
rs1298726175 657 dbSNP
rs1310862641 659 dbSNP
rs1000245662 661 dbSNP
rs539242024 664 dbSNP
rs1396679172 678 dbSNP
rs1162138122 695 dbSNP
rs1046898453 698 dbSNP
rs1472724831 699 dbSNP
rs1416367743 703 dbSNP
rs1251085298 704 dbSNP
rs929788760 710 dbSNP
rs376494286 711 dbSNP
rs1423297099 712 dbSNP
rs1251331496 718 dbSNP
rs145019135 719 dbSNP
rs942724383 721 dbSNP
rs911197079 724 dbSNP
rs1307338374 725 dbSNP
rs917476934 726 dbSNP
rs934050723 733 dbSNP
rs1291472680 735 dbSNP
rs1366421241 748 dbSNP
rs1234049528 749 dbSNP
rs1057252087 753 dbSNP
rs978263055 762 dbSNP
rs968183915 769 dbSNP
rs915515196 771 dbSNP
rs1206674801 774 dbSNP
rs991016655 775 dbSNP
rs1209328403 776 dbSNP
rs189759054 777 dbSNP
rs1354104872 787 dbSNP
rs184538924 789 dbSNP
rs1003046587 800 dbSNP
rs1233637859 802 dbSNP
rs530679184 805 dbSNP
rs971207264 809 dbSNP
rs754187947 816 dbSNP
rs1162034849 820 dbSNP
rs1348956294 825 dbSNP
rs777245218 827 dbSNP
rs1025397890 829 dbSNP
rs1373719789 835 dbSNP
rs536312166 838 dbSNP
rs1270166741 845 dbSNP
rs1286070514 846 dbSNP
rs768573552 849 dbSNP
rs951862543 850 dbSNP
rs1334255667 851 dbSNP
rs747146538 855 dbSNP
rs1255103098 858 dbSNP
rs2293594 863 dbSNP
rs1192154105 880 dbSNP
rs1038308537 896 dbSNP
rs2293595 897 dbSNP
rs1412528113 904 dbSNP
rs1461494963 909 dbSNP
rs1018871899 917 dbSNP
rs552040382 923 dbSNP
rs1051071077 926 dbSNP
rs191388024 942 dbSNP
rs746143000 948 dbSNP
rs186632787 952 dbSNP
rs946912498 956 dbSNP
rs1028790279 957 dbSNP
rs1282934006 958 dbSNP
rs915379153 963 dbSNP
rs1233945309 965 dbSNP
rs762331048 966 dbSNP
rs1411773145 970 dbSNP
rs1275319527 972 dbSNP
rs184921416 974 dbSNP
rs142736618 975 dbSNP
rs904576759 977 dbSNP
rs1233685998 991 dbSNP
rs1198197248 997 dbSNP
rs928199849 1001 dbSNP
rs1020312454 1002 dbSNP
rs1185402807 1002 dbSNP
rs1256690106 1015 dbSNP
rs1010633828 1016 dbSNP
rs1467225402 1018 dbSNP
rs1475270294 1021 dbSNP
rs896108402 1031 dbSNP
rs529966084 1040 dbSNP
rs551822908 1041 dbSNP
rs541033623 1044 dbSNP
rs1386209428 1050 dbSNP
rs1048515858 1058 dbSNP
rs1225279578 1062 dbSNP
rs115098462 1066 dbSNP
rs138335579 1068 dbSNP
rs1415502463 1070 dbSNP
rs1433648624 1078 dbSNP
rs770894694 1087 dbSNP
rs940343916 1088 dbSNP
rs757081126 1108 dbSNP
rs1198481643 1111 dbSNP
rs559807149 1115 dbSNP
rs545167412 1126 dbSNP
rs1485927734 1138 dbSNP
rs1212416685 1142 dbSNP
rs1248895325 1147 dbSNP
rs1388563502 1149 dbSNP
rs987386659 1151 dbSNP
rs1182142175 1152 dbSNP
rs1365153727 1153 dbSNP
rs1157310724 1160 dbSNP
rs953250468 1162 dbSNP
rs1172111110 1165 dbSNP
rs1028841281 1167 dbSNP
rs1408942280 1169 dbSNP
rs1172259315 1170 dbSNP
rs532521271 1172 dbSNP
rs1329839356 1181 dbSNP
rs1452658671 1186 dbSNP
rs1230816385 1189 dbSNP
rs1302340955 1192 dbSNP
rs1348507928 1193 dbSNP
rs576696673 1202 dbSNP
rs1236483622 1203 dbSNP
rs1272364314 1206 dbSNP
rs556826451 1212 dbSNP
rs746839418 1213 dbSNP
rs1449458963 1216 dbSNP
rs978988331 1220 dbSNP
rs998218943 1225 dbSNP
rs968854678 1229 dbSNP
rs2293596 1233 dbSNP
rs1042461867 1235 dbSNP
rs1176129939 1238 dbSNP
rs1371814727 1239 dbSNP
rs1010271332 1240 dbSNP
rs895824345 1245 dbSNP
rs758649312 1246 dbSNP
rs1398919330 1248 dbSNP
rs1055334839 1255 dbSNP
rs1325467400 1255 dbSNP
rs1371525673 1259 dbSNP
rs574290609 1262 dbSNP
rs1217186568 1276 dbSNP
rs928263168 1281 dbSNP
rs1306803577 1292 dbSNP
rs1001755411 1293 dbSNP
rs116172989 1294 dbSNP
rs1227054562 1298 dbSNP
rs1048569890 1309 dbSNP
rs931472990 1319 dbSNP
rs192426822 1320 dbSNP
rs1287666639 1326 dbSNP
rs1195845120 1332 dbSNP
rs1433292927 1334 dbSNP
rs1346233109 1337 dbSNP
rs1333931415 1339 dbSNP
rs1260283685 1343 dbSNP
rs1433032524 1344 dbSNP
rs972480488 1350 dbSNP
rs1374924582 1353 dbSNP
rs1036530530 1354 dbSNP
rs962419324 1360 dbSNP
rs188429653 1365 dbSNP
rs558222759 1369 dbSNP
rs940411931 1388 dbSNP
rs1017086900 1392 dbSNP
rs1286842873 1393 dbSNP
rs1448982605 1393 dbSNP
rs1361190318 1394 dbSNP
rs755537532 1395 dbSNP
rs1417272440 1405 dbSNP
rs911577229 1411 dbSNP
rs987103575 1415 dbSNP
rs1236614060 1416 dbSNP
rs1208482526 1425 dbSNP
rs1232115265 1429 dbSNP
rs183594025 1436 dbSNP
rs921828260 1438 dbSNP
rs998479783 1439 dbSNP
rs978656385 1443 dbSNP
rs191284559 1448 dbSNP
rs368980830 1455 dbSNP
rs1206297110 1456 dbSNP
rs989321103 1465 dbSNP
rs1216771348 1476 dbSNP
rs1474286446 1483 dbSNP
rs1187255043 1492 dbSNP
rs1418869120 1492 dbSNP
rs960084392 1497 dbSNP
rs1476272245 1506 dbSNP
rs893933371 1517 dbSNP
rs1055602388 1520 dbSNP
rs1035683218 1521 dbSNP
rs938223125 1526 dbSNP
rs1283927597 1529 dbSNP
rs906666856 1532 dbSNP
rs1373506518 1550 dbSNP
rs1046662527 1554 dbSNP
rs188241340 1555 dbSNP
rs918264260 1556 dbSNP
rs1221777843 1560 dbSNP
rs1305831119 1563 dbSNP
rs1216906846 1579 dbSNP
rs1316741892 1579 dbSNP
rs182401470 1581 dbSNP
rs755472116 1585 dbSNP
rs1210261062 1587 dbSNP
rs995740801 1595 dbSNP
rs1175752249 1600 dbSNP
rs1313771078 1602 dbSNP
rs897315872 1612 dbSNP
rs150418797 1615 dbSNP
rs1393210352 1616 dbSNP
rs985598901 1627 dbSNP
rs1172627720 1628 dbSNP
rs752254962 1630 dbSNP
rs547029232 1631 dbSNP
rs1373552187 1639 dbSNP
rs1029884463 1643 dbSNP
rs1051450835 1647 dbSNP
rs931634006 1648 dbSNP
rs140301249 1650 dbSNP
rs754382338 1652 dbSNP
rs1234277046 1669 dbSNP
rs1281641929 1671 dbSNP
rs375568223 1673 dbSNP
rs1350200366 1680 dbSNP
rs1202475822 1683 dbSNP
rs966634725 1683 dbSNP
rs1481048689 1684 dbSNP
rs1476085772 1685 dbSNP
rs766707693 1691 dbSNP
rs947302075 1692 dbSNP
rs1453557972 1699 dbSNP
rs17089253 1700 dbSNP
rs750831994 1701 dbSNP
rs960137874 1708 dbSNP
rs1033783494 1710 dbSNP
rs928723529 1713 dbSNP
rs375347116 1721 dbSNP
rs1354760921 1722 dbSNP
rs980107968 1726 dbSNP
rs1252498411 1730 dbSNP
rs970041466 1731 dbSNP
rs1204638945 1733 dbSNP
rs545106021 1736 dbSNP
rs996176887 1739 dbSNP
rs898118710 1748 dbSNP
rs961618833 1774 dbSNP
rs1304848905 1779 dbSNP
rs1016204555 1783 dbSNP
rs1347694455 1793 dbSNP
rs1212894667 1796 dbSNP
rs1037939198 1804 dbSNP
rs531459725 1806 dbSNP
rs941033150 1810 dbSNP
rs1200816207 1811 dbSNP
rs1271480902 1815 dbSNP
rs1467897513 1816 dbSNP
rs909509174 1817 dbSNP
rs1049510228 1819 dbSNP
rs1357823492 1821 dbSNP
rs1294134199 1822 dbSNP
rs8180367 1826 dbSNP
rs1008380367 1831 dbSNP
rs189737593 1832 dbSNP
rs767196347 1833 dbSNP
rs890247607 1834 dbSNP
rs1051501961 1836 dbSNP
rs995892080 1838 dbSNP
rs900185984 1840 dbSNP
rs932351305 1845 dbSNP
rs1042700554 1848 dbSNP
rs976596700 1855 dbSNP
rs1393228559 1856 dbSNP
rs543253248 1863 dbSNP
rs148259657 1864 dbSNP
rs1333336383 1868 dbSNP
rs1462588709 1868 dbSNP
rs1429322846 1872 dbSNP
rs1349195477 1873 dbSNP
rs966500089 1875 dbSNP
rs947322189 1876 dbSNP
rs1334371841 1877 dbSNP
rs1214105163 1881 dbSNP
rs1291850529 1884 dbSNP
rs913130325 1885 dbSNP
rs1445053739 1889 dbSNP
rs1162761480 1890 dbSNP
rs1473408689 1891 dbSNP
rs1242601028 1893 dbSNP
rs1462805258 1907 dbSNP
rs1185093747 1908 dbSNP
rs989329023 1908 dbSNP
rs1166639431 1909 dbSNP
rs1418387215 1911 dbSNP
rs958084034 1912 dbSNP
rs1052925470 1920 dbSNP
rs1318289085 1921 dbSNP
rs116324797 1922 dbSNP
rs1416891766 1923 dbSNP
rs114086281 1925 dbSNP
rs1311074756 1928 dbSNP
rs971253482 1932 dbSNP
rs577952926 1933 dbSNP
rs1286154681 1947 dbSNP
rs993689145 1950 dbSNP
rs1487901750 1952 dbSNP
rs754675880 1959 dbSNP
rs1212443421 1960 dbSNP
rs1037968964 1962 dbSNP
rs980161818 1963 dbSNP
rs948780603 1965 dbSNP
rs557757529 1975 dbSNP
rs1485705412 1979 dbSNP
rs974086405 1979 dbSNP
rs1315310335 1982 dbSNP
rs537920019 1984 dbSNP
rs575346713 1999 dbSNP
rs555897363 2000 dbSNP
rs922371751 2006 dbSNP
rs1409364273 2010 dbSNP
rs1422137636 2013 dbSNP
rs1370413906 2016 dbSNP
rs1415443493 2024 dbSNP
rs1040759722 2033 dbSNP
rs536447364 2040 dbSNP
rs913715039 2042 dbSNP
rs955533092 2045 dbSNP
rs1213091660 2047 dbSNP
rs989361108 2059 dbSNP
rs1279495856 2060 dbSNP
rs567393128 2060 dbSNP
rs1158098151 2063 dbSNP
rs1248005112 2065 dbSNP
rs767877377 2070 dbSNP
rs1028455514 2073 dbSNP
rs995939734 2075 dbSNP
rs1214292830 2081 dbSNP
rs1441905536 2083 dbSNP
rs981218972 2091 dbSNP
rs970735278 2093 dbSNP
rs900236451 2094 dbSNP
rs1466639478 2095 dbSNP
rs547656100 2096 dbSNP
rs1011239144 2097 dbSNP
rs1329771244 2098 dbSNP
rs1250526344 2118 dbSNP
rs962221196 2122 dbSNP
rs1438401598 2130 dbSNP
rs1302620105 2132 dbSNP
rs891743426 2134 dbSNP
rs1052975191 2136 dbSNP
rs533873314 2144 dbSNP
rs1254211549 2146 dbSNP
rs1338168424 2147 dbSNP
rs938564884 2148 dbSNP
rs1459397636 2150 dbSNP
rs184975695 2154 dbSNP
rs571197224 2156 dbSNP
rs1434191560 2157 dbSNP
rs1201638133 2158 dbSNP
rs889407091 2158 dbSNP
rs1461523055 2160 dbSNP
rs1171707807 2161 dbSNP
rs1402675971 2167 dbSNP
rs1324904959 2171 dbSNP
rs1050683768 2173 dbSNP
rs1388508183 2178 dbSNP
rs1293324300 2180 dbSNP
rs1227474607 2184 dbSNP
rs1279726413 2187 dbSNP
rs1332144728 2196 dbSNP
rs1212218830 2197 dbSNP
rs1240109152 2202 dbSNP
rs1347431169 2204 dbSNP
rs1212198267 2212 dbSNP
rs568794228 2213 dbSNP
rs531394548 2214 dbSNP
rs1040791978 2216 dbSNP
rs1164463382 2220 dbSNP
rs1368886769 2225 dbSNP
rs1459221935 2230 dbSNP
rs1287081659 2238 dbSNP
rs945089868 2239 dbSNP
rs1400097535 2246 dbSNP
rs1299427975 2247 dbSNP
rs1371607765 2248 dbSNP
rs1232358282 2253 dbSNP
rs1293500140 2255 dbSNP
rs1317619493 2259 dbSNP
rs1322736358 2277 dbSNP
rs1380298593 2278 dbSNP
rs974518467 2286 dbSNP
rs1386953244 2297 dbSNP
rs1289237794 2298 dbSNP
rs1259506134 2302 dbSNP
rs892307732 2310 dbSNP
rs562575127 2314 dbSNP
rs549148101 2315 dbSNP
rs908503289 2316 dbSNP
rs1187552205 2320 dbSNP
rs1174927188 2327 dbSNP
rs1454366126 2328 dbSNP
rs774836622 2329 dbSNP
rs987052901 2340 dbSNP
rs955580283 2343 dbSNP
rs564076830 2344 dbSNP
rs926555309 2344 dbSNP
rs181941038 2345 dbSNP
rs1373141942 2351 dbSNP
rs1413594975 2361 dbSNP
rs1303095391 2369 dbSNP
rs980700307 2371 dbSNP
rs543191211 2373 dbSNP
rs949427560 2379 dbSNP
rs1353430632 2382 dbSNP
rs917898963 2396 dbSNP
rs1288746086 2397 dbSNP
rs972142515 2399 dbSNP
rs560556560 2401 dbSNP
rs1485445944 2402 dbSNP
rs796471893 2407 dbSNP
rs10033058 2409 dbSNP
rs1011710055 2416 dbSNP
rs771000723 2419 dbSNP
rs1348763797 2425 dbSNP
rs1269517169 2426 dbSNP
rs1393145734 2429 dbSNP
rs953560969 2430 dbSNP
rs891465506 2431 dbSNP
rs1328145917 2437 dbSNP
rs1031276075 2438 dbSNP
rs1460209562 2444 dbSNP
rs1002756720 2448 dbSNP
rs997757521 2450 dbSNP
rs1295965024 2453 dbSNP
rs1376683740 2456 dbSNP
rs900850684 2458 dbSNP
rs907113085 2465 dbSNP
rs578203344 2466 dbSNP
rs773083817 2467 dbSNP
rs898608220 2469 dbSNP
rs1038460870 2471 dbSNP
rs1314013472 2474 dbSNP
rs1202750692 2483 dbSNP
rs1250938070 2485 dbSNP
rs1053522146 2487 dbSNP
rs564102562 2489 dbSNP
rs940060659 2491 dbSNP
rs6852163 2498 dbSNP
rs575285455 2499 dbSNP
rs550631570 2516 dbSNP
rs1191698192 2525 dbSNP
rs1426729284 2528 dbSNP
rs1169349083 2529 dbSNP
rs904996373 2529 dbSNP
rs1375320440 2534 dbSNP
rs555436092 2538 dbSNP
rs1333712498 2541 dbSNP
rs1392735955 2542 dbSNP
rs1436472212 2542 dbSNP
rs1475115545 2543 dbSNP
rs562760176 2543 dbSNP
rs934255001 2545 dbSNP
rs921514016 2546 dbSNP
rs976021974 2548 dbSNP
rs968254427 2549 dbSNP
rs1200310984 2555 dbSNP
rs915357301 2556 dbSNP
rs201021688 2557 dbSNP
rs375867824 2557 dbSNP
rs989937090 2565 dbSNP
rs1248348982 2572 dbSNP
rs1484619934 2574 dbSNP
rs1185372036 2576 dbSNP
rs1423908342 2578 dbSNP
rs535611324 2594 dbSNP
rs1162335813 2595 dbSNP
rs375102705 2595 dbSNP
rs115242312 2599 dbSNP
rs1324815908 2604 dbSNP
rs1194174831 2605 dbSNP
rs755109115 2611 dbSNP
rs1341206578 2618 dbSNP
rs1022827292 2620 dbSNP
rs1341336478 2622 dbSNP
rs553709649 2623 dbSNP
rs898330339 2624 dbSNP
rs1291955267 2625 dbSNP
rs1029123869 2628 dbSNP
rs1038586954 2630 dbSNP
rs186894964 2633 dbSNP
rs1256314479 2637 dbSNP
rs780470939 2639 dbSNP
rs1294736121 2643 dbSNP
rs1004329400 2648 dbSNP
rs1414943032 2649 dbSNP
rs1399536240 2652 dbSNP
rs773327539 2657 dbSNP
rs1158556775 2661 dbSNP
rs756674403 2666 dbSNP
rs750701639 2667 dbSNP
rs1326237280 2669 dbSNP
rs966301882 2675 dbSNP
rs1448487342 2676 dbSNP
rs17592288 2679 dbSNP
rs571574949 2687 dbSNP
rs892117761 2688 dbSNP
rs143127400 2689 dbSNP
rs752460327 2690 dbSNP
rs1442566877 2695 dbSNP
rs1167572518 2706 dbSNP
rs946937707 2710 dbSNP
rs1292120469 2712 dbSNP
rs1438195788 2713 dbSNP
rs1178609212 2714 dbSNP
rs1000597198 2723 dbSNP
rs1421607491 2738 dbSNP
rs1171771262 2748 dbSNP
rs537837412 2770 dbSNP
rs1415318800 2773 dbSNP
rs1336381334 2776 dbSNP
rs1044869044 2779 dbSNP
rs1013416439 2785 dbSNP
rs896441089 2789 dbSNP
rs1251137978 2791 dbSNP
rs1273799904 2791 dbSNP
rs1345091489 2791 dbSNP
rs1201872000 2793 dbSNP
rs988700172 2796 dbSNP
rs1332588184 2800 dbSNP
rs1274750350 2807 dbSNP
rs940686680 2812 dbSNP
rs1198345236 2820 dbSNP
rs909193958 2824 dbSNP
rs1239325936 2827 dbSNP
rs1442160086 2831 dbSNP
rs955810667 2836 dbSNP
rs924360710 2840 dbSNP
rs1377189749 2841 dbSNP
rs1478381352 2842 dbSNP
rs17089252 2855 dbSNP
rs922003768 2856 dbSNP
rs1277463475 2857 dbSNP
rs142309075 2864 dbSNP
rs6826205 2872 dbSNP
rs1380720915 2874 dbSNP
rs1012853883 2875 dbSNP
rs962917060 2880 dbSNP
rs1324640284 2883 dbSNP
rs913513996 2885 dbSNP
rs988992076 2886 dbSNP
rs1268059891 2888 dbSNP
rs956391105 2895 dbSNP
rs1259176433 2896 dbSNP
rs1031967540 2901 dbSNP
rs1016792394 2903 dbSNP
rs1459354377 2907 dbSNP
rs1004451921 2910 dbSNP
rs969196489 2915 dbSNP
rs1167502984 2919 dbSNP
rs370599509 2927 dbSNP
rs1406356874 2928 dbSNP
rs1023801473 2934 dbSNP
rs1407502341 2937 dbSNP
rs1477655172 2941 dbSNP
rs776315664 2946 dbSNP
rs887225397 2949 dbSNP
rs181865608 2951 dbSNP
rs546894080 2952 dbSNP
rs1471197272 2959 dbSNP
rs896293900 2964 dbSNP
rs1391293125 2966 dbSNP
rs375845079 2974 dbSNP
rs1036301384 2977 dbSNP
rs899853559 2982 dbSNP
rs1339261110 2990 dbSNP
rs145048178 2991 dbSNP
rs1467044148 2993 dbSNP
rs1279666949 3000 dbSNP
rs1254861341 3003 dbSNP
rs1320488009 3008 dbSNP
rs1243011065 3018 dbSNP
rs947020724 3018 dbSNP
rs1715081 3019 dbSNP
rs113931288 3020 dbSNP
rs772852896 3021 dbSNP
rs771969529 3034 dbSNP
rs1487990372 3036 dbSNP
rs1194703411 3038 dbSNP
rs1265557819 3038 dbSNP
rs931973786 3041 dbSNP
rs544549210 3042 dbSNP
rs1350961425 3054 dbSNP
rs1302004744 3057 dbSNP
rs141084331 3067 dbSNP
rs1369386120 3070 dbSNP
rs944888113 3077 dbSNP
rs1359393608 3080 dbSNP
rs913379084 3085 dbSNP
rs561776144 3087 dbSNP
rs989024622 3091 dbSNP
rs542283786 3092 dbSNP
rs1437613499 3097 dbSNP
rs1376442118 3108 dbSNP
rs573274179 3113 dbSNP
rs1394653944 3121 dbSNP
rs1312541525 3128 dbSNP
rs1345037714 3128 dbSNP
rs1341430809 3129 dbSNP
rs557996869 3129 dbSNP
rs1316681967 3130 dbSNP
rs981157648 3131 dbSNP
rs926187485 3133 dbSNP
rs1288434098 3135 dbSNP
rs1482437963 3136 dbSNP
rs979158727 3141 dbSNP
rs755720278 3146 dbSNP
rs879474536 3147 dbSNP
rs761928082 3150 dbSNP
rs1173038248 3153 dbSNP
rs1419796364 3154 dbSNP
rs1159859706 3156 dbSNP
rs915592355 3158 dbSNP
rs1465283337 3165 dbSNP
rs1303040837 3176 dbSNP
rs1396802369 3178 dbSNP
rs189757460 3186 dbSNP
rs1191769424 3188 dbSNP
rs1023399276 3190 dbSNP
rs1240085002 3195 dbSNP
rs1454878385 3201 dbSNP
rs1013319371 3202 dbSNP
rs1376737043 3203 dbSNP
rs1241503381 3206 dbSNP
rs960535251 3209 dbSNP
rs991549092 3212 dbSNP
rs1209733802 3214 dbSNP
rs184920636 3220 dbSNP
rs1484126917 3221 dbSNP
rs145516700 3226 dbSNP
rs887740542 3226 dbSNP
rs1180415057 3232 dbSNP
rs1440308610 3232 dbSNP
rs558076228 3238 dbSNP
rs1017258163 3239 dbSNP
rs1349492777 3244 dbSNP
rs1432057907 3252 dbSNP
rs149679852 3254 dbSNP
rs1360485634 3257 dbSNP
rs951198243 3258 dbSNP
rs541597850 3263 dbSNP
rs1220251696 3265 dbSNP
rs900472802 3271 dbSNP
rs774498285 3275 dbSNP
rs998286325 3289 dbSNP
rs899907338 3292 dbSNP
rs568847700 3293 dbSNP
rs1341325891 3298 dbSNP
rs1053249015 3304 dbSNP
rs1218675047 3307 dbSNP
rs1302267019 3312 dbSNP
rs936162842 3313 dbSNP
rs537226794 3321 dbSNP
rs1432940017 3323 dbSNP
rs926247409 3328 dbSNP
rs980746516 3330 dbSNP
rs947766680 3341 dbSNP
rs1018297793 3347 dbSNP
rs1409255596 3351 dbSNP
rs916213171 3352 dbSNP
rs1426833288 3353 dbSNP
rs991918913 3356 dbSNP
rs1011319776 3366 dbSNP
rs114782562 3368 dbSNP
rs1423406166 3375 dbSNP
rs1466434306 3380 dbSNP
rs566450272 3385 dbSNP
rs1348594213 3398 dbSNP
rs1435858582 3398 dbSNP
rs983307415 3400 dbSNP
rs951959545 3403 dbSNP
rs1398436960 3406 dbSNP
rs935544689 3407 dbSNP
rs1216056582 3409 dbSNP
rs375867876 3409 dbSNP
rs1287659198 3424 dbSNP
rs906728132 3426 dbSNP
rs1486448616 3427 dbSNP
rs1256013593 3432 dbSNP
rs1222200411 3434 dbSNP
rs369817548 3436 dbSNP
rs996471402 3437 dbSNP
rs900503039 3438 dbSNP
rs547121610 3440 dbSNP
rs915643474 3441 dbSNP
rs533343624 3445 dbSNP
rs991205116 3447 dbSNP
rs1307385063 3448 dbSNP
rs1405349941 3448 dbSNP
rs1412077956 3448 dbSNP
rs1166072944 3449 dbSNP
rs1008842821 3450 dbSNP
rs200841029 3451 dbSNP
rs1220838579 3458 dbSNP
rs1432643385 3462 dbSNP
rs1282279893 3467 dbSNP
rs1341598067 3469 dbSNP
rs941032188 3478 dbSNP
rs1413101063 3479 dbSNP
rs1293807429 3480 dbSNP
rs371159716 3485 dbSNP
rs1053112787 3490 dbSNP
rs936211150 3491 dbSNP
rs1236134302 3492 dbSNP
rs1472654495 3493 dbSNP
rs1182982756 3498 dbSNP
rs909511776 3501 dbSNP
rs1357631881 3506 dbSNP
rs1158053133 3507 dbSNP
rs1361240302 3513 dbSNP
rs1402709832 3520 dbSNP
rs1332400488 3522 dbSNP
rs745621547 3524 dbSNP
rs1358395798 3527 dbSNP
rs1448423690 3529 dbSNP
rs768869184 3536 dbSNP
rs770582702 3540 dbSNP
rs34165263 3542 dbSNP
rs749138047 3546 dbSNP
rs1441622574 3549 dbSNP
rs976566367 3552 dbSNP
rs570750506 3559 dbSNP
rs1277425577 3560 dbSNP
rs1352669828 3561 dbSNP
rs1204643019 3565 dbSNP
rs964197292 3567 dbSNP
rs1456874717 3568 dbSNP
rs139513741 3572 dbSNP
rs1416807949 3575 dbSNP
rs1010954897 3579 dbSNP
rs1475955743 3582 dbSNP
rs1414827694 3586 dbSNP
rs1424650922 3586 dbSNP
rs991863590 3586 dbSNP
rs1338531824 3592 dbSNP
rs1397828224 3593 dbSNP
rs938981437 3600 dbSNP
rs907654251 3601 dbSNP
rs983579132 3616 dbSNP
rs893799717 3624 dbSNP
rs951930615 3625 dbSNP
rs1479399232 3627 dbSNP
rs1231669389 3630 dbSNP
rs1201001684 3636 dbSNP
rs531133700 3641 dbSNP
rs1198603968 3643 dbSNP
rs1251809326 3644 dbSNP
rs1272896578 3649 dbSNP
rs1030936357 3654 dbSNP
rs1196762331 3654 dbSNP
rs1231882415 3656 dbSNP
rs1323702144 3663 dbSNP
rs1715080 3667 dbSNP
rs965021449 3669 dbSNP
rs1464876802 3675 dbSNP
rs1018813146 3679 dbSNP
rs1398474919 3680 dbSNP
rs1384575619 3683 dbSNP
rs1371361417 3684 dbSNP
rs1331166627 3685 dbSNP
rs1406443952 3687 dbSNP
rs373443297 3690 dbSNP
rs777082671 3690 dbSNP
rs147377568 3708 dbSNP
rs778752101 3710 dbSNP
rs1252408641 3712 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000344157.4 | 3UTR | UAAAAAUAAUGCUGCUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.739 9.9e-5 0.798 1.2e-5 20 Click to see details
GSE38226 Liver fibrosis -0.576 3.1e-3 -0.542 5.6e-3 21 Click to see details
GSE21032 Prostate cancer 0.19 4.3e-2 0.138 1.1e-1 83 Click to see details
GSE21849 B cell lymphoma 0.319 4.6e-2 0.351 3.1e-2 29 Click to see details
GSE32688 Pancreatic cancer -0.247 8.6e-2 -0.163 1.9e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.376 1.0e-1 -0.258 2.0e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.325 1.1e-1 -0.356 8.8e-2 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.239 1.6e-1 -0.162 2.5e-1 20 Click to see details
GSE17498 Multiple myeloma 0.152 1.7e-1 0.080 3.1e-1 40 Click to see details
GSE17306 Multiple myeloma -0.135 1.8e-1 -0.109 2.3e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.19 1.8e-1 -0.242 1.2e-1 25 Click to see details
GSE28544 Breast cancer -0.187 1.9e-1 -0.540 3.2e-3 24 Click to see details
GSE19536 Breast cancer 0.084 2.0e-1 0.049 3.1e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.173 2.1e-1 -0.067 3.8e-1 23 Click to see details
GSE21687 Ependynoma primary tumors 0.094 2.3e-1 0.087 2.5e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.213 2.5e-1 0.007 4.9e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.06 2.9e-1 -0.080 2.3e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.119 2.9e-1 -0.144 2.5e-1 24 Click to see details
GSE19783 ER- ER- breast cancer 0.01 4.7e-1 0.011 4.6e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.004 4.9e-1 -0.113 3.0e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.004 4.9e-1 -0.113 3.0e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.286 0 -0.276 0.01 84 Click to see details
KIRP -0.374 0.02 -0.304 0.05 32 Click to see details
PAAD 0.951 0.02 0.800 0.1 4 Click to see details
UCEC 0.456 0.02 0.600 0 19 Click to see details
PRAD 0.263 0.03 0.291 0.02 50 Click to see details
STAD -0.256 0.08 -0.255 0.08 32 Click to see details
CHOL 0.512 0.08 0.500 0.09 9 Click to see details
LIHC -0.141 0.17 -0.171 0.12 49 Click to see details
HNSC 0.126 0.21 0.181 0.13 42 Click to see details
LUAD 0.251 0.22 0.238 0.23 12 Click to see details
PCPG -0.727 0.24 -1.000 0.5 3 Click to see details
THCA -0.07 0.3 -0.113 0.2 59 Click to see details
LUSC 0.088 0.3 0.182 0.14 38 Click to see details
KICH 0.097 0.32 0.163 0.22 25 Click to see details
KIRC -0.055 0.33 -0.065 0.3 68 Click to see details
ESCA -0.103 0.38 0.082 0.41 11 Click to see details
CESC 0.186 0.44 0.500 0.33 3 Click to see details
COAD 0.039 0.46 -0.310 0.23 8 Click to see details
BLCA 0.019 0.47 0.020 0.47 18 Click to see details
BLCA 0.019 0.47 0.020 0.47 18 Click to see details
BLCA 0.019 0.47 0.020 0.47 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69