miRTarBase - #MIRT504855 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HAUS3   
Synonyms C4orf15, IT1, dgt3
Description HAUS augmin like complex subunit 3
Transcript NM_024511   
Expression
Putative miRNA Targets on HAUS3
3'UTR of HAUS3
(miRNA target sites are highlighted)
>HAUS3|NM_024511|3'UTR
   1 AAATTACTGAAAACTGAATCTTTATTACGTGTCCTCTTTTATTTATTAGAAGACTGTGTATAATAAACACTACTAAATTT
  81 TTAAAATTTGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaauacacGACGAu 5'
                          || || 
Target 5' ctgtgtataataaacaCTACTa 3'
54 - 75 68.00 -5.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30508424 28 COSMIC
COSN20057459 29 COSMIC
COSN31599568 36 COSMIC
COSN31600442 87 COSMIC
COSN30534104 158 COSMIC
COSN17280871 207 COSMIC
COSN26807699 403 COSMIC
COSN2018829 786 COSMIC
COSN2018825 870 COSMIC
COSN24569574 890 COSMIC
COSN21536915 1016 COSMIC
COSN29688827 1444 COSMIC
COSN2018823 1553 COSMIC
COSN24489693 2064 COSMIC
COSN7481185 2458 COSMIC
COSN30160684 2581 COSMIC
COSN31557832 2606 COSMIC
COSN31529480 2637 COSMIC
COSN30182793 2645 COSMIC
COSN5058480 2649 COSMIC
COSN31526587 2675 COSMIC
COSM1173050 2715 COSMIC
COSM4124095 2742 COSMIC
COSM1054528 2743 COSMIC
COSM5717172 2749 COSMIC
COSM7384932 2767 COSMIC
COSM4880671 2804 COSMIC
COSN31583685 2852 COSMIC
COSN31547020 2856 COSMIC
COSN30135960 2865 COSMIC
COSN30120614 2874 COSMIC
COSN30193167 2892 COSMIC
COSN31515263 2894 COSMIC
COSN31577854 2911 COSMIC
COSN30185821 2928 COSMIC
COSN30479633 2937 COSMIC
COSN28871358 2938 COSMIC
COSN9786184 3153 COSMIC
COSN9786183 3445 COSMIC
COSN23701937 3482 COSMIC
COSN9033732 3558 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767894998 3 dbSNP
rs1294971231 7 dbSNP
rs1307498114 9 dbSNP
rs149512553 14 dbSNP
rs1227434312 17 dbSNP
rs1372306338 18 dbSNP
rs752010548 21 dbSNP
rs758388166 24 dbSNP
rs373634207 25 dbSNP
rs1388136542 27 dbSNP
rs555496567 28 dbSNP
rs371093295 29 dbSNP
rs768466557 31 dbSNP
rs1176503448 32 dbSNP
rs1455550793 33 dbSNP
rs886606702 35 dbSNP
rs1209751206 37 dbSNP
rs750317958 38 dbSNP
rs957506079 39 dbSNP
rs1286412269 41 dbSNP
rs1205994113 43 dbSNP
rs1350182752 45 dbSNP
rs1033162354 48 dbSNP
rs1284361519 48 dbSNP
rs1421531677 58 dbSNP
rs1047890246 60 dbSNP
rs1457155260 68 dbSNP
rs999459668 69 dbSNP
rs1229984891 71 dbSNP
rs562254287 88 dbSNP
rs1314463322 90 dbSNP
rs1338432647 91 dbSNP
rs1039267940 93 dbSNP
rs1279699979 97 dbSNP
rs942388348 106 dbSNP
rs1283497629 110 dbSNP
rs1237306100 111 dbSNP
rs768502633 113 dbSNP
rs1156293843 115 dbSNP
rs1284739366 117 dbSNP
rs1353593776 123 dbSNP
rs1243207240 124 dbSNP
rs1258919991 129 dbSNP
rs1019488051 133 dbSNP
rs1187301563 135 dbSNP
rs1233654373 139 dbSNP
rs910860486 140 dbSNP
rs1156895104 141 dbSNP
rs1008858823 144 dbSNP
rs1379814962 150 dbSNP
rs889122360 151 dbSNP
rs1400045422 156 dbSNP
rs1327222017 163 dbSNP
rs1049602951 170 dbSNP
rs1395176904 171 dbSNP
rs187280449 183 dbSNP
rs755052572 193 dbSNP
rs1392141738 196 dbSNP
rs932589435 202 dbSNP
rs1444191019 205 dbSNP
rs1308112001 215 dbSNP
rs78253267 234 dbSNP
rs1442925511 238 dbSNP
rs988645434 239 dbSNP
rs938500208 242 dbSNP
rs1038191562 253 dbSNP
rs1200240194 257 dbSNP
rs1274194425 259 dbSNP
rs939880940 265 dbSNP
rs1176949810 271 dbSNP
rs970484482 272 dbSNP
rs908282042 280 dbSNP
rs1375843321 283 dbSNP
rs1382174631 287 dbSNP
rs3762940 288 dbSNP
rs949674156 301 dbSNP
rs915599913 314 dbSNP
rs991179247 315 dbSNP
rs957595952 322 dbSNP
rs532732466 330 dbSNP
rs997707053 330 dbSNP
rs1233220359 331 dbSNP
rs1033296125 335 dbSNP
rs1320400024 336 dbSNP
rs901997720 337 dbSNP
rs1223550205 338 dbSNP
rs977615242 342 dbSNP
rs1257596502 343 dbSNP
rs1018286170 348 dbSNP
rs1211708667 350 dbSNP
rs1265421250 366 dbSNP
rs967953757 368 dbSNP
rs570538464 374 dbSNP
rs1425700713 379 dbSNP
rs1018994814 402 dbSNP
rs1476684751 403 dbSNP
rs183516458 404 dbSNP
rs1394758785 410 dbSNP
rs1220155407 433 dbSNP
rs1355236048 437 dbSNP
rs1459160969 449 dbSNP
rs1389324505 451 dbSNP
rs1286036818 455 dbSNP
rs866158204 456 dbSNP
rs889457676 457 dbSNP
rs1278037560 461 dbSNP
rs550422289 462 dbSNP
rs1276227222 463 dbSNP
rs1488162410 465 dbSNP
rs527410261 470 dbSNP
rs1439119331 474 dbSNP
rs78201080 476 dbSNP
rs74655336 478 dbSNP
rs994824600 487 dbSNP
rs764936716 493 dbSNP
rs1332035254 496 dbSNP
rs1323478810 497 dbSNP
rs898407918 501 dbSNP
rs947052999 504 dbSNP
rs1461931294 512 dbSNP
rs1038729950 514 dbSNP
rs1367530309 519 dbSNP
rs1423223642 522 dbSNP
rs939829632 536 dbSNP
rs886956887 537 dbSNP
rs1159993079 540 dbSNP
rs1363000284 543 dbSNP
rs1398737733 545 dbSNP
rs1298147043 547 dbSNP
rs1052792558 554 dbSNP
rs1045463051 560 dbSNP
rs1398163004 561 dbSNP
rs568007610 561 dbSNP
rs767801032 563 dbSNP
rs1240963648 564 dbSNP
rs1406127045 567 dbSNP
rs1351391603 572 dbSNP
rs928467219 572 dbSNP
rs980430882 574 dbSNP
rs3762941 576 dbSNP
rs192232249 577 dbSNP
rs150797006 578 dbSNP
rs1489202920 580 dbSNP
rs984847368 583 dbSNP
rs1159897992 584 dbSNP
rs926188285 585 dbSNP
rs1418599055 589 dbSNP
rs1314598927 593 dbSNP
rs1280377837 600 dbSNP
rs1219379237 601 dbSNP
rs1301530613 602 dbSNP
rs1026428641 604 dbSNP
rs1447862959 617 dbSNP
rs549947862 624 dbSNP
rs533377624 631 dbSNP
rs1374706075 641 dbSNP
rs966219113 643 dbSNP
rs3762942 645 dbSNP
rs1313936024 654 dbSNP
rs1207749971 667 dbSNP
rs1255233555 672 dbSNP
rs1457915742 680 dbSNP
rs1019548746 692 dbSNP
rs1180082833 695 dbSNP
rs904145505 696 dbSNP
rs1193783355 703 dbSNP
rs1022952398 704 dbSNP
rs1435469990 721 dbSNP
rs1174374996 732 dbSNP
rs866732602 740 dbSNP
rs541484507 743 dbSNP
rs1333531212 749 dbSNP
rs1398389287 750 dbSNP
rs1029066083 756 dbSNP
rs560940428 759 dbSNP
rs1415199205 765 dbSNP
rs1424232289 775 dbSNP
rs1369602613 782 dbSNP
rs572460796 785 dbSNP
rs1217453545 786 dbSNP
rs562070652 788 dbSNP
rs116105299 793 dbSNP
rs1318251650 797 dbSNP
rs1263888610 801 dbSNP
rs1349992099 808 dbSNP
rs907036347 812 dbSNP
rs1192848197 813 dbSNP
rs542364038 814 dbSNP
rs1484608974 815 dbSNP
rs948556204 818 dbSNP
rs141380591 821 dbSNP
rs1048994259 822 dbSNP
rs929304002 823 dbSNP
rs919236087 824 dbSNP
rs1173344297 827 dbSNP
rs1465337235 835 dbSNP
rs976167687 839 dbSNP
rs1351639253 855 dbSNP
rs148077850 860 dbSNP
rs539764036 861 dbSNP
rs1260834527 865 dbSNP
rs887056773 867 dbSNP
rs145650052 868 dbSNP
rs1222122526 869 dbSNP
rs1320435963 873 dbSNP
rs1279461200 875 dbSNP
rs368237542 876 dbSNP
rs1341121355 883 dbSNP
rs1045964300 888 dbSNP
rs1220233682 891 dbSNP
rs1214428534 895 dbSNP
rs553693511 902 dbSNP
rs910625666 903 dbSNP
rs1449305010 907 dbSNP
rs1359973558 910 dbSNP
rs1220199836 916 dbSNP
rs1268779044 919 dbSNP
rs1014131300 928 dbSNP
rs986340416 934 dbSNP
rs1196259648 935 dbSNP
rs968610536 935 dbSNP
rs1475303799 942 dbSNP
rs894226782 949 dbSNP
rs1164008078 952 dbSNP
rs1416251363 953 dbSNP
rs1304611975 954 dbSNP
rs188900482 958 dbSNP
rs1361055021 961 dbSNP
rs935620588 977 dbSNP
rs925621205 981 dbSNP
rs1296293810 983 dbSNP
rs955711797 985 dbSNP
rs1448491681 996 dbSNP
rs1285528052 1000 dbSNP
rs1031266169 1013 dbSNP
rs1227236015 1015 dbSNP
rs1002483666 1018 dbSNP
rs1041949479 1029 dbSNP
rs946272298 1033 dbSNP
rs568109583 1034 dbSNP
rs987589436 1043 dbSNP
rs1423985864 1050 dbSNP
rs13434944 1054 dbSNP
rs1044518490 1062 dbSNP
rs921978638 1073 dbSNP
rs1415366023 1076 dbSNP
rs537484906 1089 dbSNP
rs973465750 1090 dbSNP
rs1471956740 1094 dbSNP
rs963389277 1098 dbSNP
rs1015322675 1100 dbSNP
rs887576863 1115 dbSNP
rs1004916565 1116 dbSNP
rs951369650 1118 dbSNP
rs1421629499 1123 dbSNP
rs182850783 1125 dbSNP
rs1384175077 1126 dbSNP
rs550033408 1135 dbSNP
rs1200140277 1143 dbSNP
rs1336004271 1148 dbSNP
rs1049024630 1150 dbSNP
rs1024267950 1151 dbSNP
rs929168168 1152 dbSNP
rs1309561722 1153 dbSNP
rs919267187 1155 dbSNP
rs141997449 1158 dbSNP
rs1259045489 1161 dbSNP
rs564665081 1169 dbSNP
rs138874621 1175 dbSNP
rs894323001 1181 dbSNP
rs1441074145 1189 dbSNP
rs1203230747 1190 dbSNP
rs1055522066 1197 dbSNP
rs527783976 1198 dbSNP
rs999963792 1202 dbSNP
rs562073310 1204 dbSNP
rs542221395 1211 dbSNP
rs904294657 1214 dbSNP
rs1041762785 1215 dbSNP
rs986593497 1216 dbSNP
rs1478336259 1218 dbSNP
rs35095875 1223 dbSNP
rs915372689 1224 dbSNP
rs988362239 1225 dbSNP
rs545286861 1226 dbSNP
rs1402096286 1227 dbSNP
rs1035229826 1228 dbSNP
rs1400786524 1229 dbSNP
rs1022725395 1234 dbSNP
rs746008091 1234 dbSNP
rs912125047 1236 dbSNP
rs1051967631 1245 dbSNP
rs932116407 1246 dbSNP
rs1343234995 1247 dbSNP
rs922124291 1251 dbSNP
rs887619752 1255 dbSNP
rs1258934216 1258 dbSNP
rs1459310040 1259 dbSNP
rs867399461 1265 dbSNP
rs1165385001 1266 dbSNP
rs1249965510 1267 dbSNP
rs973567267 1280 dbSNP
rs963782324 1293 dbSNP
rs878907704 1297 dbSNP
rs1375862553 1301 dbSNP
rs1443555782 1303 dbSNP
rs907988392 1306 dbSNP
rs1180139596 1308 dbSNP
rs897770443 1318 dbSNP
rs1425291259 1320 dbSNP
rs1439875178 1322 dbSNP
rs73796987 1329 dbSNP
rs1297274695 1332 dbSNP
rs1390780733 1337 dbSNP
rs546078623 1339 dbSNP
rs1388018747 1340 dbSNP
rs944738536 1343 dbSNP
rs1177030983 1350 dbSNP
rs1223274214 1356 dbSNP
rs1279274874 1363 dbSNP
rs1479854862 1366 dbSNP
rs1320238297 1367 dbSNP
rs1216973146 1378 dbSNP
rs889093015 1381 dbSNP
rs1050537813 1387 dbSNP
rs774151409 1395 dbSNP
rs1265166150 1398 dbSNP
rs915321910 1400 dbSNP
rs577066119 1407 dbSNP
rs1194088461 1409 dbSNP
rs1476738411 1409 dbSNP
rs762701458 1409 dbSNP
rs1169233155 1420 dbSNP
rs553928856 1425 dbSNP
rs770760298 1431 dbSNP
rs928246401 1432 dbSNP
rs1364217965 1436 dbSNP
rs1242622613 1439 dbSNP
rs1299361705 1441 dbSNP
rs1377973927 1448 dbSNP
rs533786860 1449 dbSNP
rs1380890193 1452 dbSNP
rs748337842 1453 dbSNP
rs1247045948 1454 dbSNP
rs375486796 1454 dbSNP
rs576456125 1454 dbSNP
rs971104242 1454 dbSNP
rs762701995 1459 dbSNP
rs190934118 1461 dbSNP
rs1217200131 1464 dbSNP
rs958503386 1470 dbSNP
rs376449515 1471 dbSNP
rs577544602 1471 dbSNP
rs781459439 1471 dbSNP
rs991262133 1471 dbSNP
rs554273947 1482 dbSNP
rs796696731 1483 dbSNP
rs897634639 1485 dbSNP
rs1018892993 1490 dbSNP
rs755072014 1491 dbSNP
rs1159710607 1502 dbSNP
rs1363017810 1505 dbSNP
rs889131890 1505 dbSNP
rs35866750 1524 dbSNP
rs1288721847 1525 dbSNP
rs1419741223 1527 dbSNP
rs904262848 1535 dbSNP
rs1020070072 1543 dbSNP
rs1010276953 1551 dbSNP
rs1311358632 1553 dbSNP
rs1315130686 1555 dbSNP
rs1214765124 1556 dbSNP
rs893913751 1562 dbSNP
rs1484123883 1563 dbSNP
rs1198328838 1572 dbSNP
rs1179218020 1574 dbSNP
rs1242149190 1598 dbSNP
rs1439711591 1604 dbSNP
rs764857975 1609 dbSNP
rs890134555 1610 dbSNP
rs1051934941 1619 dbSNP
rs1417709606 1620 dbSNP
rs759328512 1620 dbSNP
rs537571909 1622 dbSNP
rs776745479 1623 dbSNP
rs928112115 1637 dbSNP
rs1405704213 1642 dbSNP
rs1447609999 1648 dbSNP
rs568480072 1649 dbSNP
rs77597936 1650 dbSNP
rs1223092106 1652 dbSNP
rs942252861 1655 dbSNP
rs1267340036 1657 dbSNP
rs1218945991 1661 dbSNP
rs948270225 1666 dbSNP
rs1221475300 1670 dbSNP
rs1262105571 1671 dbSNP
rs1457987525 1677 dbSNP
rs1354491798 1683 dbSNP
rs1230628432 1684 dbSNP
rs907914313 1689 dbSNP
rs983565001 1698 dbSNP
rs539699920 1700 dbSNP
rs866827172 1701 dbSNP
rs1313756266 1703 dbSNP
rs1301661524 1707 dbSNP
rs1404292889 1709 dbSNP
rs1343607994 1713 dbSNP
rs1174815102 1714 dbSNP
rs747063363 1716 dbSNP
rs1466378529 1717 dbSNP
rs1333639489 1726 dbSNP
rs1400148808 1731 dbSNP
rs917940202 1737 dbSNP
rs1352793969 1744 dbSNP
rs990840765 1747 dbSNP
rs951680009 1757 dbSNP
rs1383529994 1759 dbSNP
rs1027419609 1760 dbSNP
rs571106123 1763 dbSNP
rs958596314 1764 dbSNP
rs1156456718 1771 dbSNP
rs1282441717 1773 dbSNP
rs1467216424 1777 dbSNP
rs1318362336 1781 dbSNP
rs971784237 1794 dbSNP
rs1270453733 1802 dbSNP
rs185337344 1803 dbSNP
rs1177649025 1804 dbSNP
rs1490996454 1805 dbSNP
rs780570575 1806 dbSNP
rs1480299095 1808 dbSNP
rs1427881237 1811 dbSNP
rs961876882 1817 dbSNP
rs1478368751 1821 dbSNP
rs1447664474 1829 dbSNP
rs879637881 1829 dbSNP
rs1417651358 1838 dbSNP
rs1409437492 1841 dbSNP
rs1019161074 1853 dbSNP
rs547963218 1859 dbSNP
rs968583554 1860 dbSNP
rs758852460 1861 dbSNP
rs1010000229 1862 dbSNP
rs890228547 1870 dbSNP
rs1484337624 1884 dbSNP
rs866387529 1886 dbSNP
rs7693490 1893 dbSNP
rs1228367168 1902 dbSNP
rs1222722311 1905 dbSNP
rs1291470357 1906 dbSNP
rs995833564 1907 dbSNP
rs900760714 1910 dbSNP
rs1339636715 1911 dbSNP
rs140614183 1915 dbSNP
rs1291693232 1938 dbSNP
rs942161394 1952 dbSNP
rs886624307 1954 dbSNP
rs1240569718 1963 dbSNP
rs1219104249 1966 dbSNP
rs375768505 1970 dbSNP
rs1048254349 1974 dbSNP
rs1384991162 1975 dbSNP
rs1325368686 1976 dbSNP
rs867055621 1983 dbSNP
rs949477490 1990 dbSNP
rs1182496608 1991 dbSNP
rs1315559147 1993 dbSNP
rs1397233488 1994 dbSNP
rs1162790409 1998 dbSNP
rs1361156287 2002 dbSNP
rs918033882 2011 dbSNP
rs990809441 2015 dbSNP
rs568657817 2016 dbSNP
rs1344218636 2018 dbSNP
rs927155208 2021 dbSNP
rs368064445 2029 dbSNP
rs1448243882 2031 dbSNP
rs1335653821 2037 dbSNP
rs757766432 2041 dbSNP
rs571906183 2046 dbSNP
rs371229300 2048 dbSNP
rs999525059 2051 dbSNP
rs1314946433 2053 dbSNP
rs6851446 2054 dbSNP
rs1207228845 2057 dbSNP
rs968927403 2058 dbSNP
rs796324164 2066 dbSNP
rs1282657224 2068 dbSNP
rs1173475671 2069 dbSNP
rs1211005483 2070 dbSNP
rs1476000972 2072 dbSNP
rs370405950 2073 dbSNP
rs1183140408 2077 dbSNP
rs989081041 2079 dbSNP
rs763671589 2084 dbSNP
rs1425608268 2087 dbSNP
rs1244038491 2090 dbSNP
rs111250328 2092 dbSNP
rs1406920958 2094 dbSNP
rs1471149658 2094 dbSNP
rs34171758 2094 dbSNP
rs916846080 2094 dbSNP
rs948243869 2094 dbSNP
rs954454358 2096 dbSNP
rs1451271033 2098 dbSNP
rs1203196700 2104 dbSNP
rs1030077300 2108 dbSNP
rs147763407 2109 dbSNP
rs112271834 2116 dbSNP
rs1338709149 2117 dbSNP
rs546266176 2118 dbSNP
rs1016902332 2120 dbSNP
rs1350339711 2122 dbSNP
rs1006494123 2123 dbSNP
rs1265229675 2130 dbSNP
rs886716380 2135 dbSNP
rs1460184159 2143 dbSNP
rs1203092975 2148 dbSNP
rs1246417912 2150 dbSNP
rs1238819301 2152 dbSNP
rs1179483141 2153 dbSNP
rs1340542776 2161 dbSNP
rs144204897 2165 dbSNP
rs1449945709 2166 dbSNP
rs560223503 2167 dbSNP
rs35874601 2177 dbSNP
rs896567039 2186 dbSNP
rs1055218618 2187 dbSNP
rs937960555 2188 dbSNP
rs953223588 2196 dbSNP
rs878968209 2212 dbSNP
rs1396478711 2213 dbSNP
rs1335758099 2214 dbSNP
rs1437594556 2216 dbSNP
rs1285642231 2226 dbSNP
rs1321886248 2231 dbSNP
rs34062934 2232 dbSNP
rs1258950076 2236 dbSNP
rs947313420 2241 dbSNP
rs1341485563 2242 dbSNP
rs181080815 2246 dbSNP
rs988659744 2249 dbSNP
rs954547290 2260 dbSNP
rs759445482 2269 dbSNP
rs922992418 2271 dbSNP
rs1201286344 2273 dbSNP
rs1442964184 2274 dbSNP
rs1480005433 2278 dbSNP
rs1193859016 2285 dbSNP
rs999475750 2290 dbSNP
rs1460022539 2295 dbSNP
rs1166853070 2298 dbSNP
rs974479702 2299 dbSNP
rs79375295 2300 dbSNP
rs964325065 2304 dbSNP
rs142587671 2305 dbSNP
rs1305525593 2306 dbSNP
rs1343958631 2312 dbSNP
rs1015914263 2323 dbSNP
rs1296540458 2324 dbSNP
rs1182313392 2325 dbSNP
rs1436998456 2331 dbSNP
rs543865926 2332 dbSNP
rs950987577 2338 dbSNP
rs1357167862 2343 dbSNP
rs1027020198 2344 dbSNP
rs1013719275 2347 dbSNP
rs1289509181 2350 dbSNP
rs896663576 2351 dbSNP
rs1049122780 2355 dbSNP
rs1055184918 2365 dbSNP
rs1002307537 2374 dbSNP
rs903958722 2375 dbSNP
rs1378708277 2376 dbSNP
rs1368502176 2378 dbSNP
rs1165953450 2379 dbSNP
rs536355396 2384 dbSNP
rs1043727040 2389 dbSNP
rs1036066936 2402 dbSNP
rs575000905 2403 dbSNP
rs1387383245 2405 dbSNP
rs569652964 2405 dbSNP
rs1327450323 2410 dbSNP
rs987211211 2412 dbSNP
rs1388980241 2422 dbSNP
rs1383532359 2425 dbSNP
rs1248337518 2429 dbSNP
rs953354493 2431 dbSNP
rs1358690278 2437 dbSNP
rs945409682 2439 dbSNP
rs558128143 2441 dbSNP
rs566054209 2443 dbSNP
rs190322284 2447 dbSNP
rs1484787333 2450 dbSNP
rs1204113497 2457 dbSNP
rs1382455917 2462 dbSNP
rs1159359664 2470 dbSNP
rs1462263713 2475 dbSNP
rs989366024 2477 dbSNP
rs571102151 2480 dbSNP
rs1030874347 2500 dbSNP
rs749138515 2503 dbSNP
rs1230909299 2504 dbSNP
rs1288450945 2511 dbSNP
rs1407199752 2519 dbSNP
rs1334850047 2525 dbSNP
rs34514922 2525 dbSNP
rs367545679 2525 dbSNP
rs970724059 2527 dbSNP
rs1309059821 2529 dbSNP
rs553923392 2529 dbSNP
rs1012292371 2533 dbSNP
rs1314847836 2533 dbSNP
rs1263371967 2539 dbSNP
rs1325296168 2541 dbSNP
rs1201209837 2543 dbSNP
rs1268062310 2548 dbSNP
rs1219681454 2560 dbSNP
rs554140604 2565 dbSNP
rs1284603117 2566 dbSNP
rs1178216529 2569 dbSNP
rs34512270 2570 dbSNP
rs908988020 2571 dbSNP
rs1253303733 2578 dbSNP
rs1417700592 2582 dbSNP
rs1158886788 2591 dbSNP
rs1222785185 2596 dbSNP
rs1430216825 2597 dbSNP
rs1471049504 2600 dbSNP
rs756220416 2603 dbSNP
rs1405354108 2608 dbSNP
rs1278106334 2611 dbSNP
rs950434931 2612 dbSNP
rs1407114868 2617 dbSNP
rs1390577649 2618 dbSNP
rs1283747362 2623 dbSNP
rs185955462 2628 dbSNP
rs1221265597 2629 dbSNP
rs1037271134 2630 dbSNP
rs1303058240 2631 dbSNP
rs940366506 2632 dbSNP
rs992423723 2635 dbSNP
rs760525724 2650 dbSNP
rs1349251192 2651 dbSNP
rs768792471 2653 dbSNP
rs568518085 2655 dbSNP
rs747062870 2659 dbSNP
rs1489099584 2660 dbSNP
rs1328900998 2670 dbSNP
rs921670193 2671 dbSNP
rs370635645 2672 dbSNP
rs1267532712 2673 dbSNP
rs774177140 2675 dbSNP
rs903934734 2676 dbSNP
rs771000555 2683 dbSNP
rs1436284873 2684 dbSNP
rs1303723186 2685 dbSNP
rs1395454885 2690 dbSNP
rs1171989217 2691 dbSNP
rs1476985802 2700 dbSNP
rs1022805134 2703 dbSNP
rs1193937428 2707 dbSNP
rs368054532 2710 dbSNP
rs1261227484 2724 dbSNP
rs777948944 2725 dbSNP
rs756382662 2726 dbSNP
rs1280046501 2729 dbSNP
rs1292758776 2732 dbSNP
rs150022553 2734 dbSNP
rs1204987690 2736 dbSNP
rs1293152640 2740 dbSNP
rs373878149 2741 dbSNP
rs779977250 2742 dbSNP
rs548803141 2743 dbSNP
rs766829456 2746 dbSNP
rs1339456011 2750 dbSNP
rs1296039956 2756 dbSNP
rs756800343 2759 dbSNP
rs1448945098 2760 dbSNP
rs753451192 2761 dbSNP
rs1052945394 2764 dbSNP
rs959522102 2765 dbSNP
rs1368137211 2767 dbSNP
rs1027051677 2772 dbSNP
rs370285116 2774 dbSNP
rs995701927 2777 dbSNP
rs1421505733 2778 dbSNP
rs201278233 2784 dbSNP
rs139302710 2787 dbSNP
rs775012146 2790 dbSNP
rs746333099 2795 dbSNP
rs112868163 2796 dbSNP
rs144804114 2804 dbSNP
rs1208398756 2811 dbSNP
rs770903378 2812 dbSNP
rs749352621 2813 dbSNP
rs1310019291 2818 dbSNP
rs552589500 2818 dbSNP
rs769865959 2820 dbSNP
rs890126905 2823 dbSNP
rs1275736707 2833 dbSNP
rs771577375 2837 dbSNP
rs369451459 2847 dbSNP
rs755331858 2852 dbSNP
rs1218134063 2856 dbSNP
rs1240594641 2858 dbSNP
rs780592787 2858 dbSNP
rs908921073 2859 dbSNP
rs1445463464 2862 dbSNP
rs1356212451 2868 dbSNP
rs759032524 2870 dbSNP
rs1465024282 2875 dbSNP
rs1184362308 2879 dbSNP
rs1386989009 2892 dbSNP
rs984953241 2892 dbSNP
rs1162619692 2895 dbSNP
rs928958099 2896 dbSNP
rs918943718 2897 dbSNP
rs991847125 2927 dbSNP
rs1283206576 2932 dbSNP
rs532430680 2933 dbSNP
rs560558272 2934 dbSNP
rs1452686055 2935 dbSNP
rs1033971441 2936 dbSNP
rs553992396 2937 dbSNP
rs1379975252 2938 dbSNP
rs923737065 2939 dbSNP
rs978421010 2943 dbSNP
rs1351779246 2945 dbSNP
rs1430070526 2953 dbSNP
rs1343707743 2954 dbSNP
rs1328797990 2957 dbSNP
rs1204571551 2958 dbSNP
rs968630143 2960 dbSNP
rs1245000973 2963 dbSNP
rs1022350722 2966 dbSNP
rs76592500 2972 dbSNP
rs1233441623 2987 dbSNP
rs1471036007 2988 dbSNP
rs35029558 2988 dbSNP
rs1470186352 3001 dbSNP
rs1410736730 3020 dbSNP
rs1404999709 3023 dbSNP
rs1469955629 3024 dbSNP
rs1174204773 3037 dbSNP
rs1178185774 3040 dbSNP
rs892577813 3044 dbSNP
rs1394961988 3046 dbSNP
rs1334072375 3059 dbSNP
rs1336940694 3060 dbSNP
rs959621135 3072 dbSNP
rs1029606742 3082 dbSNP
rs1278097637 3083 dbSNP
rs998176188 3091 dbSNP
rs1224283010 3107 dbSNP
rs1420102295 3118 dbSNP
rs181855947 3122 dbSNP
rs1321485734 3125 dbSNP
rs1474133007 3131 dbSNP
rs560705806 3133 dbSNP
rs1273588531 3142 dbSNP
rs1439538748 3143 dbSNP
rs757641909 3145 dbSNP
rs1462054016 3148 dbSNP
rs1250752949 3151 dbSNP
rs1480644809 3159 dbSNP
rs544051525 3163 dbSNP
rs574987740 3164 dbSNP
rs1426840585 3178 dbSNP
rs1262854375 3189 dbSNP
rs1202365199 3194 dbSNP
rs1309828145 3195 dbSNP
rs961542272 3196 dbSNP
rs1296899491 3203 dbSNP
rs1015738456 3208 dbSNP
rs1285422827 3214 dbSNP
rs558267095 3220 dbSNP
rs919036711 3225 dbSNP
rs1232589141 3227 dbSNP
rs1056140464 3237 dbSNP
rs939002697 3241 dbSNP
rs995884968 3243 dbSNP
rs926827774 3248 dbSNP
rs879042710 3249 dbSNP
rs1000535985 3251 dbSNP
rs902262620 3262 dbSNP
rs1042261079 3263 dbSNP
rs1193493750 3279 dbSNP
rs981444480 3284 dbSNP
rs78282503 3287 dbSNP
rs917867665 3290 dbSNP
rs757806793 3295 dbSNP
rs190547060 3296 dbSNP
rs1169647727 3299 dbSNP
rs1407714632 3301 dbSNP
rs1005700592 3302 dbSNP
rs1290829234 3307 dbSNP
rs1029739400 3308 dbSNP
rs998101552 3311 dbSNP
rs1540287 3316 dbSNP
rs1296777919 3320 dbSNP
rs534178009 3321 dbSNP
rs1443593112 3323 dbSNP
rs367944896 3324 dbSNP
rs1182188596 3325 dbSNP
rs1247871219 3325 dbSNP
rs1289264160 3342 dbSNP
rs755741429 3345 dbSNP
rs868449641 3346 dbSNP
rs1263479353 3365 dbSNP
rs1252477997 3367 dbSNP
rs555191835 3368 dbSNP
rs1187429017 3369 dbSNP
rs1390074920 3371 dbSNP
rs1445711060 3377 dbSNP
rs752440856 3380 dbSNP
rs1049354272 3387 dbSNP
rs61792605 3388 dbSNP
rs897539963 3389 dbSNP
rs1432951108 3400 dbSNP
rs1246761896 3404 dbSNP
rs1056235145 3408 dbSNP
rs1320032802 3409 dbSNP
rs139974254 3410 dbSNP
rs187407586 3413 dbSNP
rs1392988680 3415 dbSNP
rs564784470 3417 dbSNP
rs3762944 3422 dbSNP
rs1262087749 3423 dbSNP
rs1326692578 3426 dbSNP
rs1167144796 3427 dbSNP
rs1243173312 3429 dbSNP
rs1462273687 3431 dbSNP
rs1185906907 3433 dbSNP
rs1254765120 3437 dbSNP
rs1475672174 3441 dbSNP
rs1413270499 3442 dbSNP
rs1180485017 3444 dbSNP
rs566712439 3445 dbSNP
rs915531622 3449 dbSNP
rs1233807787 3451 dbSNP
rs1178621868 3452 dbSNP
rs543977239 3453 dbSNP
rs964354474 3455 dbSNP
rs1456802621 3456 dbSNP
rs988714840 3458 dbSNP
rs1255638596 3460 dbSNP
rs1214956415 3463 dbSNP
rs546979249 3469 dbSNP
rs529945357 3476 dbSNP
rs976815969 3477 dbSNP
rs543279920 3478 dbSNP
rs560890530 3488 dbSNP
rs1301008113 3494 dbSNP
rs1375328011 3502 dbSNP
rs1309683106 3503 dbSNP
rs1391734257 3509 dbSNP
rs1308809836 3510 dbSNP
rs1227322098 3511 dbSNP
rs1348431363 3511 dbSNP
rs1263390449 3513 dbSNP
rs1488167220 3519 dbSNP
rs1445993680 3527 dbSNP
rs1325058937 3529 dbSNP
rs1207498813 3530 dbSNP
rs75901908 3531 dbSNP
rs576608318 3532 dbSNP
rs1308728701 3533 dbSNP
rs1349369714 3537 dbSNP
rs1163025185 3538 dbSNP
rs1402646599 3541 dbSNP
rs1430326433 3551 dbSNP
rs1233370346 3552 dbSNP
rs1174102061 3553 dbSNP
rs1313491994 3554 dbSNP
rs1293314164 3556 dbSNP
rs1409230111 3557 dbSNP
rs1411816513 3558 dbSNP
rs1438405587 3559 dbSNP
rs1283527988 3579 dbSNP
rs1299484497 3579 dbSNP
rs1299816515 3579 dbSNP
rs1299931580 3579 dbSNP
rs1347055207 3579 dbSNP
rs1409051334 3579 dbSNP
rs531222767 3579 dbSNP
rs902293838 3579 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||: |   | ||||||| 
Target 5' -uCAAAUAAAAUUCUGCUGCUc 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCAAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCAAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCAAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000243706.4 | 3UTR | UCAAAUAAAAUUCUGCUGCUCAAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.607 2.3e-3 0.734 1.1e-4 20 Click to see details
GSE19783 ER- ER- breast cancer 0.301 3.5e-3 0.350 7.8e-4 79 Click to see details
GSE19536 Breast cancer 0.23 1.1e-2 0.252 5.7e-3 100 Click to see details
GSE28260 Renal cortex and medulla -0.598 1.5e-2 -0.555 2.4e-2 13 Click to see details
GSE21849 B cell lymphoma 0.349 3.2e-2 0.244 1.0e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.465 3.5e-2 0.238 1.9e-1 16 Click to see details
GSE17498 Multiple myeloma -0.176 1.4e-1 -0.061 3.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.227 1.4e-1 0.250 1.2e-1 24 Click to see details
GSE14794 Lymphoblastoid cells -0.097 1.8e-1 -0.100 1.7e-1 90 Click to see details
GSE38226 Liver fibrosis 0.107 3.2e-1 0.041 4.3e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.137 3.4e-1 -0.308 1.7e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.086 3.6e-1 -0.256 1.4e-1 20 Click to see details
GSE17306 Multiple myeloma -0.028 4.2e-1 -0.067 3.2e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.033 4.4e-1 0.072 3.7e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.028 4.5e-1 0.009 4.8e-1 25 Click to see details
GSE28544 Breast cancer 0.028 4.5e-1 0.357 4.3e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.015 4.5e-1 -0.064 3.1e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.015 4.7e-1 -0.078 3.6e-1 25 Click to see details
GSE21032 Prostate cancer -0.006 4.8e-1 -0.036 3.7e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.001 5.0e-1 -0.015 4.7e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.001 5.0e-1 -0.015 4.7e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.54 0.01 0.393 0.05 19 Click to see details
PCPG -0.994 0.03 -1.000 0.5 3 Click to see details
PRAD 0.246 0.04 0.251 0.04 50 Click to see details
KIRC 0.199 0.05 0.288 0.01 68 Click to see details
PAAD 0.893 0.05 0.400 0.3 4 Click to see details
LUSC -0.213 0.1 -0.210 0.1 38 Click to see details
KIRP 0.227 0.11 0.272 0.07 32 Click to see details
LIHC 0.138 0.17 0.162 0.13 49 Click to see details
CESC 0.84 0.18 0.500 0.33 3 Click to see details
KICH 0.166 0.21 0.180 0.19 25 Click to see details
BLCA 0.185 0.23 0.216 0.19 18 Click to see details
ESCA -0.235 0.24 -0.091 0.4 11 Click to see details
LUAD 0.193 0.27 0.070 0.41 12 Click to see details
COAD -0.209 0.31 -0.810 0.01 8 Click to see details
HNSC 0.046 0.39 0.016 0.46 42 Click to see details
BRCA -0.022 0.42 -0.100 0.18 84 Click to see details
THCA 0.022 0.43 -0.006 0.48 59 Click to see details
STAD -0.022 0.45 0.003 0.49 32 Click to see details
CHOL -0.007 0.49 -0.033 0.47 9 Click to see details
CHOL -0.007 0.49 -0.033 0.47 9 Click to see details
CHOL -0.007 0.49 -0.033 0.47 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1