miRTarBase - #MIRT502570 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol E2F7   
Synonyms -
Description E2F transcription factor 7
Transcript NM_203394   
Expression
Putative miRNA Targets on E2F7
3'UTR of E2F7
(miRNA target sites are highlighted)
>E2F7|NM_203394|3'UTR
   1 CCTGCCGCTTTGCCAGGTGGGGGTGGGATCAAACGCCCTGAGAGTCCCGGATGTCCGAGGCGGGATGCAAACCATCCCGT
  81 CCTGAGCACGGGTCCTTCCTCTCTCTTTCATCCACACTTCTGTTAACTTCCCACCACCATCAATCATCTGATTTCCTGAA
 161 AGTAATTAATTGTGCATTTAATACCAGTTAGAGTTCCGACTCTGCATGGTGTCACAGTGAAAGCGCCGACTGACTTATGG
 241 TTTTGATTCAAGAATCGTCTTATTCTGGAAGTAGATCTGAATAGGCTACCGGAGCCTTGTTTTTCTAAAGGGGGGCGCTG
 321 TCTAGCACTTAACTAGGGTAAGCATTCTTAACATGTATTTCCACTTGCCCTGAGTAAATCTGTGGTGAGAGAAGCTTCCT
 401 TTCTGCAGTTTAAAAAAGCTACTGCTTCCTTAGGCTTCATCAGGAAGCCACCTTCAGTTGTGAATCCTATGGTGTTATTT
 481 ATTTTGTTCCTGAAATGGGATTTAGTGCAAAAAGTTTACAACTACAGTCTTTAACACATTTTTTTCAGGGTATGACGACT
 561 TGAATGTTTATACTTTTATTCTATAATTTGCCCTGCACTTATTTTACAACCTAGTAATAATGTGGATAAATGTATCTACA
 641 TGACACATGTCAAGACCAAAATAACTGTGAATGACACACCTTGCTGTAAATGAACTGTGCTAACCCTGACTGTGGGCTTG
 721 AGAACAAAGATGAACTCTAGAACTCTAGCAGCCTAACTGCTGCTTCTCAAATAACTGTGTGAACAGTGAGATATTACTGT
 801 TTGTTTCTAAAAATCCTACTGTGCCCAGTTTCCTTCACTACATGCCCTGCATTTTTTATTTAAATATTTAGCTGTAGCGC
 881 CATCAGATATGGATGCCTTCTAACAATTGCTGTTTGTAAAATAAATCAGGATGGTAGAAAGTGATTATATGGAAAATTGG
 961 AACCTGGATGAGACCTTTTCGTTGAATTCTGAAGAGTAATGATGTGAAAATTGATACAGGGCAAGAGATGATTCTTTTGT
1041 TTTTCTTCTACTTCATGTCCAGAAGAGTAAGAGGGAAAATGGACATATGTTTCATATCCAAGGGTATTCAAACTGTAGTT
1121 AGTTGGTACCTCTGAAAAATGAGAATGGTGAGCGCACGGGTTGGTTGTTCTAGCATGAATACAATTCTGGAAACTGTTAT
1201 GCAATTTCCCTTTTTTAACCCACATTACTTTAGGGGTGCATTAAGTCGCCAAACTATACTAGTTCTTTGTATTCCTAGAC
1281 TTGCTGATATTTACCTCTCTCTTGTCTCTTCAGAGTAAATGGTTCCCTTCTTTCCTTCCTACTTTCCTTCATTCTCTCTT
1361 CCTTCCCTCCTTCCTACTTCTTTTCTTCCTTCCTCTTCCTCTCTTAAAACTATCTTAGATGTAGAATCCTGGTGTAGGGT
1441 TTTATTTTATTTTTATTTTTTGACCCAATAAAATGTTATATGAAAGAATGAAAATATTAATTTAAGAGACTCTGGGAGTC
1521 TGAATAAAGTAGCTTTATATTAACTACAGGATAATATTAGCCTTATTACCCCCACAAGATTTTTTAAAACTTGAGGTAGG
1601 TAGCTACATTAAATAAATTTGCTACTTATATAAAAATTTTTATCAACACTAAACTTTTAAAGTTTACAAGTTTTTTTTTT
1681 CTTTTTTACAGTCTTCTATAGAGTTAGGTTAAAAATGTGGTTCTAACCATCAACAATTGCATGGTTAAATGACCCTGAAC
1761 TAAAACTGATGGGTTCCCTATCAAAACAAATAAAAATATACCTTTTTCAGGTTTCAATCTGTGCAGGGTATATGCATGTT
1841 AATTCTACCATGCTTAAGAACTTCCACAAAATATTTCATGGAGAGGTCTGCATTTAGACGGAAACAGAAATTGCTTTTCC
1921 CCTCACTGTTCCTGAATGCTCTATACTTGTTTTAACATTTTTGCTATCTTTTTTTATTATTCTGATCATGATATGACCAT
2001 TTAACCTCAGAATTCATAATTCCTGAGGGGTGTTAAGAAGCAGTCCCATTGGTGAGGATATTATGACTTGGTGACCATTC
2081 TTAGGAGTAGAAAACCAAGGACAATTGCTTCTGTATTCAGTATCCACTTCTTAATGTGGCTTTATATGTAAAAATAATAA
2161 TGCAGTGGTTGTTTCTGTCAGGAAAATAAATCTTACAGAACAACTGGTGGAATTGAAGCTGCTGCGCTAGACTTGGATAT
2241 TTTGGGTAGTGAAGAAGCAATGGCAATCTTGAGTCTATTATTGTATAATTTAGTAAAAGAAAAAAATAATCGTTGGTGGT
2321 CCTACTAAGAGAATGCAGCTTTTTTGAGTTGTCACAGAGGCTGTGTGTGCCCTACACTGACCAGGGTTTGTAAAACCCTT
2401 TCATTCTGGTACAAGAGTCGGGGGTATAACTTTTATACTTGAATCTACCTACCAAGTTTACATTTCTCAATTCCTTTTTG
2481 TAAGGTGCTATTTCTGTATTTAAATAACTTTCTTTTAACGTAAAGCTGCTTTCTGCTTATCTTATTGCACTGCTAGTTGT
2561 ATGTAGGTATTAATTTTATTGCTGCTTACTGCTTTTGTTTTCTTATTATTTAGCTCTGCTCTTTTTCCTAATGGCTATAT
2641 TATCTATAGCTATTTACTTGTAACTGTACTACATGTAAACTGATTTTTTGTTCTGATTTTTTTTCTAATATTTTTAGGAA
2721 AATATTAAGCTTTATAAAATAGCAATAAAAAATAATTCATTTAAGAAGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||:: |||| ||||||| 
Target 5' tattAATT-TTAT-TGCTGCTt 3'
2568 - 2587 156.00 -9.50
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |:||  ||  ||||||| 
Target 5' tagcAGCC--TAACTGCTGCTt 3'
746 - 765 150.00 -11.50
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | ||| ||    |||||:| 
Target 5' ttCTAACAAT----TGCTGTTt 3'
898 - 915 134.00 -7.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26974421 7 COSMIC
COSN30184862 26 COSMIC
COSN26974422 31 COSMIC
COSN31532850 34 COSMIC
COSN30486919 46 COSMIC
COSN31551859 48 COSMIC
COSN20077770 56 COSMIC
COSN30190079 59 COSMIC
COSN5953505 61 COSMIC
COSN30529103 71 COSMIC
COSN31588417 72 COSMIC
COSN30180821 99 COSMIC
COSN30484011 101 COSMIC
COSN31481674 158 COSMIC
COSN31610898 173 COSMIC
COSN20109890 248 COSMIC
COSN20109884 264 COSMIC
COSN31564192 274 COSMIC
COSN31541842 290 COSMIC
COSN8586721 313 COSMIC
COSN26100051 316 COSMIC
COSN31593771 343 COSMIC
COSN28793343 451 COSMIC
COSN31535931 534 COSMIC
COSN9755854 541 COSMIC
COSN31538890 556 COSMIC
COSN31479863 581 COSMIC
COSN31517180 703 COSMIC
COSN9755853 710 COSMIC
COSN7381651 871 COSMIC
COSN19451344 879 COSMIC
COSN5719331 1016 COSMIC
COSN1585657 1088 COSMIC
COSN21941650 1258 COSMIC
COSN31545416 1515 COSMIC
COSN7381650 1546 COSMIC
COSN27455457 1670 COSMIC
COSN32058780 1700 COSMIC
COSN9755852 1799 COSMIC
COSN23277490 2278 COSMIC
COSN30541390 2394 COSMIC
COSN24304245 2411 COSMIC
COSN24304244 2423 COSMIC
COSN24304576 2424 COSMIC
COSN26557632 2445 COSMIC
COSN28688337 2490 COSMIC
COSN31567752 2512 COSMIC
COSN31570430 2533 COSMIC
COSN19663318 2542 COSMIC
COSN31551790 2637 COSMIC
COSN9477236 2652 COSMIC
COSN31529947 2757 COSMIC
COSN31517182 2758 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1381164246 2 dbSNP
rs1160608593 3 dbSNP
rs1437977815 5 dbSNP
rs202120365 6 dbSNP
rs940434621 8 dbSNP
rs777383974 15 dbSNP
rs769424666 16 dbSNP
rs748155041 17 dbSNP
rs137993973 19 dbSNP
rs183049485 19 dbSNP
rs1354082547 21 dbSNP
rs1449297554 23 dbSNP
rs1287723438 25 dbSNP
rs751332854 27 dbSNP
rs1315876089 28 dbSNP
rs779029013 31 dbSNP
rs376806331 34 dbSNP
rs1370386284 35 dbSNP
rs199582222 37 dbSNP
rs752138313 38 dbSNP
rs376382508 43 dbSNP
rs1300344507 48 dbSNP
rs1451864204 49 dbSNP
rs932166648 51 dbSNP
rs975936525 53 dbSNP
rs965861655 58 dbSNP
rs922156115 59 dbSNP
rs976364952 61 dbSNP
rs1295136322 63 dbSNP
rs966408148 66 dbSNP
rs867554087 69 dbSNP
rs1289380237 72 dbSNP
rs368985158 73 dbSNP
rs1346029122 74 dbSNP
rs1269393084 77 dbSNP
rs1275199568 78 dbSNP
rs986026291 85 dbSNP
rs79236710 89 dbSNP
rs11116718 90 dbSNP
rs1160738247 93 dbSNP
rs779791147 97 dbSNP
rs1388644024 99 dbSNP
rs1280026417 101 dbSNP
rs559730844 105 dbSNP
rs201129112 107 dbSNP
rs956812906 109 dbSNP
rs1448444860 114 dbSNP
rs1283877971 116 dbSNP
rs1377235735 119 dbSNP
rs757372534 120 dbSNP
rs549087700 121 dbSNP
rs905042373 127 dbSNP
rs1328511394 128 dbSNP
rs1331671451 130 dbSNP
rs1023932376 136 dbSNP
rs1265507487 142 dbSNP
rs905356342 143 dbSNP
rs1182859413 148 dbSNP
rs530025477 155 dbSNP
rs1024308226 158 dbSNP
rs1013510222 161 dbSNP
rs1183825142 162 dbSNP
rs1471608463 162 dbSNP
rs1412098409 165 dbSNP
rs896425127 166 dbSNP
rs1402489689 172 dbSNP
rs1167637142 177 dbSNP
rs759482318 181 dbSNP
rs1156909327 198 dbSNP
rs139118427 200 dbSNP
rs1005768129 202 dbSNP
rs1414889430 204 dbSNP
rs1036023980 205 dbSNP
rs887452790 208 dbSNP
rs940392069 209 dbSNP
rs887501905 211 dbSNP
rs1411921505 219 dbSNP
rs1048734293 220 dbSNP
rs1226624336 225 dbSNP
rs544011974 228 dbSNP
rs756338574 230 dbSNP
rs1277176891 235 dbSNP
rs1048817080 238 dbSNP
rs1195095944 239 dbSNP
rs928937522 241 dbSNP
rs1484214797 245 dbSNP
rs1206893273 246 dbSNP
rs750565771 252 dbSNP
rs932114660 256 dbSNP
rs1482472406 259 dbSNP
rs1040144672 263 dbSNP
rs201338553 264 dbSNP
rs66480435 264 dbSNP
rs201273248 265 dbSNP
rs35868972 265 dbSNP
rs200989262 266 dbSNP
rs910352414 266 dbSNP
rs199705716 267 dbSNP
rs575050460 270 dbSNP
rs1443157352 274 dbSNP
rs1169515829 280 dbSNP
rs546730771 281 dbSNP
rs2279576 286 dbSNP
rs1315895141 290 dbSNP
rs1325614103 291 dbSNP
rs1331694609 291 dbSNP
rs946632583 300 dbSNP
rs1273544544 302 dbSNP
rs572580331 305 dbSNP
rs915126676 309 dbSNP
rs988132676 311 dbSNP
rs988797005 313 dbSNP
rs1035104262 315 dbSNP
rs957371557 316 dbSNP
rs982120483 316 dbSNP
rs1281867484 317 dbSNP
rs926002947 333 dbSNP
rs980183023 335 dbSNP
rs1449592543 338 dbSNP
rs1340696577 341 dbSNP
rs1327838978 348 dbSNP
rs147372440 361 dbSNP
rs1428080841 370 dbSNP
rs555919660 385 dbSNP
rs1165170010 394 dbSNP
rs1402958536 399 dbSNP
rs1006234784 401 dbSNP
rs1367963349 404 dbSNP
rs1461333975 406 dbSNP
rs1297333641 421 dbSNP
rs74103229 422 dbSNP
rs1025888518 434 dbSNP
rs2279575 451 dbSNP
rs1356493154 485 dbSNP
rs1473203471 485 dbSNP
rs897456747 495 dbSNP
rs1040156098 500 dbSNP
rs1232502790 513 dbSNP
rs1177052895 524 dbSNP
rs764578512 529 dbSNP
rs960645071 536 dbSNP
rs1209215556 539 dbSNP
rs557323795 539 dbSNP
rs1247209439 550 dbSNP
rs1426477415 551 dbSNP
rs369653168 556 dbSNP
rs1189930055 557 dbSNP
rs1369250589 566 dbSNP
rs1456250553 572 dbSNP
rs1260630020 573 dbSNP
rs1472544600 574 dbSNP
rs1161534093 581 dbSNP
rs1014809667 583 dbSNP
rs1390847732 586 dbSNP
rs1004482951 591 dbSNP
rs1239725117 602 dbSNP
rs888966956 621 dbSNP
rs573659717 631 dbSNP
rs140519719 635 dbSNP
rs1314500565 639 dbSNP
rs752952855 640 dbSNP
rs571908326 645 dbSNP
rs1330547033 648 dbSNP
rs1356498433 650 dbSNP
rs946531799 669 dbSNP
rs1278560751 670 dbSNP
rs1484800397 673 dbSNP
rs1201951811 684 dbSNP
rs1257212504 689 dbSNP
rs765762280 712 dbSNP
rs1442070047 715 dbSNP
rs988013278 720 dbSNP
rs1414315052 724 dbSNP
rs1472938944 725 dbSNP
rs191709350 746 dbSNP
rs1362550978 750 dbSNP
rs1467959370 752 dbSNP
rs1303794943 762 dbSNP
rs1401868772 768 dbSNP
rs1378685516 780 dbSNP
rs1310656814 782 dbSNP
rs1351841450 789 dbSNP
rs1228451062 792 dbSNP
rs1287716232 793 dbSNP
rs995933672 797 dbSNP
rs900289129 799 dbSNP
rs1040529177 801 dbSNP
rs377131072 813 dbSNP
rs944898262 818 dbSNP
rs1343977008 819 dbSNP
rs185960831 821 dbSNP
rs927933729 823 dbSNP
rs566013696 825 dbSNP
rs1209041692 869 dbSNP
rs1254215173 872 dbSNP
rs982173857 873 dbSNP
rs1181543593 877 dbSNP
rs549374465 879 dbSNP
rs373819180 889 dbSNP
rs1053383091 892 dbSNP
rs1177363369 903 dbSNP
rs867901692 906 dbSNP
rs925950528 907 dbSNP
rs115820700 909 dbSNP
rs1171418569 910 dbSNP
rs952991202 918 dbSNP
rs1407396827 922 dbSNP
rs561241653 925 dbSNP
rs1156958611 929 dbSNP
rs1370471769 934 dbSNP
rs1441718617 950 dbSNP
rs147184604 957 dbSNP
rs917342604 962 dbSNP
rs1311436372 963 dbSNP
rs1231784093 974 dbSNP
rs1179020710 975 dbSNP
rs182985144 981 dbSNP
rs1018600196 984 dbSNP
rs960844025 996 dbSNP
rs1014757149 1004 dbSNP
rs759971033 1005 dbSNP
rs888902657 1007 dbSNP
rs1284623634 1008 dbSNP
rs1192326831 1010 dbSNP
rs1267248306 1011 dbSNP
rs1050593483 1022 dbSNP
rs564774146 1034 dbSNP
rs754380581 1038 dbSNP
rs34974675 1045 dbSNP
rs1052310779 1050 dbSNP
rs1027275931 1067 dbSNP
rs202108048 1071 dbSNP
rs996268440 1074 dbSNP
rs1169255395 1081 dbSNP
rs1352298186 1089 dbSNP
rs1218991594 1098 dbSNP
rs544774904 1103 dbSNP
rs900236601 1104 dbSNP
rs927986344 1105 dbSNP
rs1040540833 1106 dbSNP
rs948035994 1120 dbSNP
rs1009043649 1152 dbSNP
rs141787382 1153 dbSNP
rs1053328488 1154 dbSNP
rs936228846 1157 dbSNP
rs1296349789 1158 dbSNP
rs952918080 1159 dbSNP
rs375256444 1160 dbSNP
rs904812896 1170 dbSNP
rs1467533726 1176 dbSNP
rs1211066822 1179 dbSNP
rs1421673771 1181 dbSNP
rs1361397746 1198 dbSNP
rs972999860 1199 dbSNP
rs1044397409 1200 dbSNP
rs559141667 1205 dbSNP
rs965644773 1206 dbSNP
rs1416928483 1219 dbSNP
rs1425105378 1222 dbSNP
rs1173303449 1224 dbSNP
rs1019867078 1225 dbSNP
rs1322415294 1228 dbSNP
rs1422753126 1243 dbSNP
rs1429616586 1245 dbSNP
rs948744804 1247 dbSNP
rs917318862 1248 dbSNP
rs1262391337 1256 dbSNP
rs1213817505 1275 dbSNP
rs1229315474 1283 dbSNP
rs1489016737 1285 dbSNP
rs993325768 1287 dbSNP
rs939166001 1295 dbSNP
rs766742868 1299 dbSNP
rs1286254151 1301 dbSNP
rs148058630 1303 dbSNP
rs1213920586 1309 dbSNP
rs1239502336 1314 dbSNP
rs983288717 1336 dbSNP
rs1281101299 1345 dbSNP
rs533893231 1354 dbSNP
rs1417038935 1365 dbSNP
rs1474203129 1367 dbSNP
rs893651930 1373 dbSNP
rs1412082936 1374 dbSNP
rs573601873 1380 dbSNP
rs1399688706 1381 dbSNP
rs1340448473 1383 dbSNP
rs1360594350 1383 dbSNP
rs556985601 1393 dbSNP
rs1401902065 1394 dbSNP
rs1354065016 1401 dbSNP
rs1412243993 1409 dbSNP
rs1027558149 1412 dbSNP
rs1341254831 1413 dbSNP
rs974405477 1418 dbSNP
rs964749628 1427 dbSNP
rs1018656825 1439 dbSNP
rs1280971216 1444 dbSNP
rs1313042072 1454 dbSNP
rs772642088 1456 dbSNP
rs906489126 1467 dbSNP
rs537774681 1473 dbSNP
rs571223578 1474 dbSNP
rs1184264038 1486 dbSNP
rs948082924 1487 dbSNP
rs1156350807 1489 dbSNP
rs1464690654 1494 dbSNP
rs1414710662 1495 dbSNP
rs1361127529 1516 dbSNP
rs578244318 1518 dbSNP
rs1432090442 1523 dbSNP
rs891583886 1531 dbSNP
rs895105048 1533 dbSNP
rs1414892983 1549 dbSNP
rs1368514724 1556 dbSNP
rs1031838950 1570 dbSNP
rs1048487844 1584 dbSNP
rs28731160 1586 dbSNP
rs931362695 1586 dbSNP
rs1345462553 1593 dbSNP
rs1408819564 1595 dbSNP
rs1207103186 1596 dbSNP
rs918658860 1597 dbSNP
rs1478497230 1600 dbSNP
rs1437203695 1607 dbSNP
rs1000388218 1608 dbSNP
rs904761900 1619 dbSNP
rs1045062934 1628 dbSNP
rs948711223 1629 dbSNP
rs1192618660 1633 dbSNP
rs895815442 1635 dbSNP
rs972926497 1640 dbSNP
rs538650977 1642 dbSNP
rs1431995564 1657 dbSNP
rs1169669840 1661 dbSNP
rs1396358378 1662 dbSNP
rs61932772 1668 dbSNP
rs1408737413 1669 dbSNP
rs1325542723 1681 dbSNP
rs1367680230 1681 dbSNP
rs551402124 1681 dbSNP
rs879531424 1681 dbSNP
rs1057169862 1690 dbSNP
rs1482034585 1696 dbSNP
rs76815549 1698 dbSNP
rs535196037 1702 dbSNP
rs1194013355 1703 dbSNP
rs908656305 1707 dbSNP
rs983236694 1708 dbSNP
rs1292028291 1709 dbSNP
rs1029045825 1715 dbSNP
rs1317749214 1717 dbSNP
rs1256683789 1720 dbSNP
rs1450979704 1739 dbSNP
rs1194285698 1752 dbSNP
rs529850232 1752 dbSNP
rs761514233 1753 dbSNP
rs957806148 1776 dbSNP
rs920488331 1783 dbSNP
rs529845205 1791 dbSNP
rs906373087 1793 dbSNP
rs114352020 1799 dbSNP
rs1436112016 1801 dbSNP
rs964376442 1808 dbSNP
rs1303699800 1817 dbSNP
rs1325640942 1820 dbSNP
rs1019018213 1821 dbSNP
rs1285862265 1823 dbSNP
rs7958377 1828 dbSNP
rs895168081 1842 dbSNP
rs1048898633 1845 dbSNP
rs931290637 1846 dbSNP
rs955754972 1851 dbSNP
rs897279173 1857 dbSNP
rs1031451973 1869 dbSNP
rs1000344018 1876 dbSNP
rs904696476 1878 dbSNP
rs1467071601 1879 dbSNP
rs535944364 1886 dbSNP
rs944188690 1888 dbSNP
rs1023185202 1899 dbSNP
rs1013579758 1900 dbSNP
rs1380284287 1908 dbSNP
rs1421608489 1909 dbSNP
rs896109972 1919 dbSNP
rs1355961308 1924 dbSNP
rs1057437154 1925 dbSNP
rs144705992 1926 dbSNP
rs1457067973 1938 dbSNP
rs989134252 1940 dbSNP
rs1259757575 1942 dbSNP
rs887164603 1952 dbSNP
rs957693184 1963 dbSNP
rs1258680501 1970 dbSNP
rs1485595838 1974 dbSNP
rs1030747808 1982 dbSNP
rs1254668850 1994 dbSNP
rs1458552253 1999 dbSNP
rs1419728747 2005 dbSNP
rs1331847968 2010 dbSNP
rs1048479895 2022 dbSNP
rs1265438829 2030 dbSNP
rs1181233854 2040 dbSNP
rs1362239183 2043 dbSNP
rs977777830 2049 dbSNP
rs1323630938 2054 dbSNP
rs748980363 2071 dbSNP
rs1375842534 2084 dbSNP
rs149345223 2086 dbSNP
rs1239640590 2088 dbSNP
rs1310979283 2089 dbSNP
rs1374978338 2091 dbSNP
rs557345040 2117 dbSNP
rs1305709404 2124 dbSNP
rs920430942 2125 dbSNP
rs1025206339 2126 dbSNP
rs1281403421 2134 dbSNP
rs1038901282 2137 dbSNP
rs1012064791 2139 dbSNP
rs1277361955 2142 dbSNP
rs1448809444 2162 dbSNP
rs1176644934 2163 dbSNP
rs1248529391 2170 dbSNP
rs943276716 2172 dbSNP
rs1435059214 2177 dbSNP
rs1317941057 2197 dbSNP
rs895085504 2203 dbSNP
rs1292920086 2205 dbSNP
rs868707080 2207 dbSNP
rs1453550348 2213 dbSNP
rs1171567646 2214 dbSNP
rs190831591 2225 dbSNP
rs1026897390 2226 dbSNP
rs1297049537 2241 dbSNP
rs987119939 2242 dbSNP
rs995548992 2244 dbSNP
rs955703241 2245 dbSNP
rs1037124078 2251 dbSNP
rs1369846732 2257 dbSNP
rs1369653499 2268 dbSNP
rs1300296465 2280 dbSNP
rs1308539436 2281 dbSNP
rs1204448522 2283 dbSNP
rs769579666 2311 dbSNP
rs978516340 2312 dbSNP
rs1214451607 2313 dbSNP
rs1252576887 2315 dbSNP
rs891311540 2328 dbSNP
rs1050369783 2341 dbSNP
rs1421404383 2344 dbSNP
rs1428976548 2350 dbSNP
rs772672738 2356 dbSNP
rs569095686 2360 dbSNP
rs1023554391 2363 dbSNP
rs374077853 2370 dbSNP
rs1326035219 2375 dbSNP
rs1393218480 2382 dbSNP
rs1290934291 2386 dbSNP
rs1438631977 2406 dbSNP
rs1294030731 2409 dbSNP
rs1324070028 2412 dbSNP
rs186429868 2419 dbSNP
rs1035960572 2420 dbSNP
rs1332873089 2422 dbSNP
rs778057199 2424 dbSNP
rs1210825368 2428 dbSNP
rs551168053 2436 dbSNP
rs914841728 2445 dbSNP
rs1185759621 2464 dbSNP
rs1004146718 2470 dbSNP
rs528224805 2474 dbSNP
rs887111948 2479 dbSNP
rs1440759823 2487 dbSNP
rs1048429476 2494 dbSNP
rs559495839 2495 dbSNP
rs936344016 2515 dbSNP
rs923579758 2517 dbSNP
rs180888550 2518 dbSNP
rs758545767 2519 dbSNP
rs1430419424 2520 dbSNP
rs1266054705 2523 dbSNP
rs970907647 2531 dbSNP
rs528965796 2536 dbSNP
rs563298972 2541 dbSNP
rs917663112 2542 dbSNP
rs565188177 2546 dbSNP
rs1311817283 2551 dbSNP
rs1292673360 2554 dbSNP
rs543416044 2556 dbSNP
rs1332756720 2558 dbSNP
rs1225590235 2564 dbSNP
rs771767152 2565 dbSNP
rs899953715 2567 dbSNP
rs576849205 2576 dbSNP
rs1039258606 2582 dbSNP
rs1214750500 2593 dbSNP
rs189205088 2598 dbSNP
rs911767445 2604 dbSNP
rs1384959814 2605 dbSNP
rs1188564538 2614 dbSNP
rs1392811406 2623 dbSNP
rs1473927964 2636 dbSNP
rs1051685619 2638 dbSNP
rs1178472388 2646 dbSNP
rs1303161763 2649 dbSNP
rs1418634280 2655 dbSNP
rs1399776270 2666 dbSNP
rs774713046 2668 dbSNP
rs995386944 2680 dbSNP
rs961380437 2690 dbSNP
rs1312788614 2695 dbSNP
rs1354165109 2704 dbSNP
rs1015578090 2705 dbSNP
rs1160134614 2705 dbSNP
rs1222290874 2714 dbSNP
rs1305986295 2732 dbSNP
rs1349767571 2749 dbSNP
rs1470698271 2755 dbSNP
rs1279485945 2757 dbSNP
rs1484667515 2758 dbSNP
rs934282644 2759 dbSNP
rs549143427 2765 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000322886.7 | 3UTR | UAUGUAGGUAUUAAUUUUAUUGCUGCUUACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000322886.7 | 3UTR | UAUUAAUUUUAUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.595 1.4e-3 -0.353 4.9e-2 23 Click to see details
GSE21032 Prostate cancer -0.313 2.0e-3 -0.184 4.8e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.548 6.2e-3 0.689 3.9e-4 20 Click to see details
GSE32688 Pancreatic cancer 0.381 1.6e-2 0.276 6.3e-2 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.316 6.2e-2 0.335 5.1e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.299 7.8e-2 -0.348 4.8e-2 24 Click to see details
GSE17306 Multiple myeloma 0.155 1.4e-1 0.199 8.5e-2 49 Click to see details
GSE27834 Pluripotent stem cells -0.244 1.8e-1 -0.285 1.4e-1 16 Click to see details
GSE19536 Breast cancer -0.077 2.2e-1 -0.035 3.6e-1 100 Click to see details
GSE19350 CNS germ cell tumors -0.217 2.5e-1 -0.490 5.3e-2 12 Click to see details
GSE19783 ER- ER- breast cancer -0.07 2.7e-1 -0.015 4.5e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.118 2.9e-1 -0.024 4.5e-1 25 Click to see details
GSE38226 Liver fibrosis 0.123 3.0e-1 0.006 4.9e-1 21 Click to see details
GSE21849 B cell lymphoma -0.094 3.1e-1 0.314 4.9e-2 29 Click to see details
GSE28544 Breast cancer 0.089 3.4e-1 0.403 2.5e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.035 3.9e-1 0.027 4.2e-1 64 Click to see details
GSE14794 Lymphoblastoid cells -0.028 4.0e-1 -0.037 3.6e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.043 4.4e-1 0.033 4.6e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer 0.005 4.9e-1 -0.116 3.1e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.005 4.9e-1 -0.116 3.1e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.581 0 0.573 0 32 Click to see details
PRAD 0.431 0 0.175 0.11 50 Click to see details
THCA 0.373 0 0.307 0.01 59 Click to see details
BLCA 0.524 0.01 0.505 0.02 18 Click to see details
HNSC 0.329 0.02 0.276 0.04 42 Click to see details
PCPG 0.899 0.14 1.000 0.5 3 Click to see details
COAD 0.415 0.15 0.381 0.18 8 Click to see details
ESCA 0.318 0.17 0.418 0.1 11 Click to see details
LIHC 0.136 0.18 0.217 0.07 49 Click to see details
KIRC 0.095 0.22 0.073 0.28 68 Click to see details
PAAD 0.536 0.23 0.400 0.3 4 Click to see details
KICH 0.137 0.26 0.085 0.34 25 Click to see details
BRCA -0.045 0.34 -0.008 0.47 84 Click to see details
LUSC -0.058 0.36 -0.059 0.36 38 Click to see details
CESC 0.306 0.4 0.500 0.33 3 Click to see details
KIRP -0.044 0.41 0.052 0.39 32 Click to see details
UCEC 0.045 0.43 0.154 0.26 19 Click to see details
LUAD 0.029 0.46 -0.231 0.24 12 Click to see details
CHOL -0.026 0.47 0.150 0.35 9 Click to see details
CHOL -0.026 0.47 0.150 0.35 9 Click to see details
CHOL -0.026 0.47 0.150 0.35 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*