miRTarBase - #MIRT501090 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC7A5   
Synonyms 4F2LC, CD98, D16S469E, E16, LAT1, MPE16
Description solute carrier family 7 member 5
Transcript NM_003486   
Expression
Putative miRNA Targets on SLC7A5
3'UTR of SLC7A5
(miRNA target sites are highlighted)
>SLC7A5|NM_003486|3'UTR
   1 CCAGGAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTCGAACCCACTCCGGTTC
  81 CCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTCCCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAAC
 161 TCTGGTACGAATCTCATCCCTCAACTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTC
 241 TCCTTGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAATTTTGGGTCAACTTGA
 321 CACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGCCTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGG
 401 CAAACAGAGCTACTGAGACTTGGAACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGG
 481 CTTGTGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGGAAACTCAGCCGTAGGG
 561 TGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTCCTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTG
 641 ACCATAATCCTAGCCCCGAGACACCATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCT
 721 CACCAGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTGAGTTCTGGTTCATGCA
 801 GACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAAGGCAGACACACCGCGGCCAGGCACCCATGTGGGCGC
 881 CCACCCTGGGCTCCACACAGCAGTGTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTA
 961 CCGCCCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTCTCCCTGTCACGCTCAT
1041 GTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCAAGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGG
1121 CCCCTGGGCTCTCACCCAGTCCCCACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATT
1201 TTTTTCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGCCTCCATGGCAGCAGCC
1281 AGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGCTCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCC
1361 TTCTCCCCAGCCAGAGGTGGAGCCAAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGC
1441 ACAGCCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCTGCTCAAGCCGCAAGCT
1521 CTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACCGGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACC
1601 TGATGAACAGTTTGGGGACTCAGGACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCC
1681 GTTGCTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTGGGGACGAATTCCACTC
1761 GTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCAGGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTC
1841 CCTCTGGGCCTGTTCTCTTGGCTGCAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCA
1921 GGAGGCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCACGCACCACTGCTTCCCA
2001 CTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTCCCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGT
2081 TCCAACCTCCTGCTCTGGGACGTGGACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTG
2161 TTGGCTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTAGTGAAATGGCTGGGGC
2241 CGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTCTGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGT
2321 GGGGGGTCCAGTCTGTGATCCTTGGTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGT
2401 CCCGCGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGACCAGGGCCACCGCAGG
2481 GGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCACACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTG
2561 TGGGCTTCAGGTGTTTTCAAGCACAACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCT
2641 AACGTCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCTTGCTGCTCTGCG
2721 TGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACGCAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTG
2801 GACACCCTCTGCCGAGTAATGACGTGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCT
2881 GGGTTGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATCCTACCGCTGAAAAAAA
2961 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuguGGUAACA---GUGUGAGGu 5'
                || || |   |||||||| 
Target 5' tccgtcCCTTTTTCTCCACACTCCa 3'
2506 - 2530 152.00 -14.84
2
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                ||:|  ||||||| | 
Target 5' tggggtCCGTCTTCACACTGCg 3'
2244 - 2265 128.00 -16.40
3
miRNA  3' guUUGUGGUA-ACAGUGUGAGGu 5'
            ::::|::| || | |||||| 
Target 5' ttGGTGCTGTGTGCCCCACTCCa 3'
2342 - 2364 128.00 -13.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26995521 10 COSMIC
COSN31560337 61 COSMIC
COSN31590226 75 COSMIC
COSN30517228 80 COSMIC
COSN30461435 82 COSMIC
COSN30163593 103 COSMIC
COSN30535564 119 COSMIC
COSN30500683 121 COSMIC
COSN30453121 128 COSMIC
COSN30453141 129 COSMIC
COSN30455814 134 COSMIC
COSN31526268 135 COSMIC
COSN30523267 144 COSMIC
COSN30758257 161 COSMIC
COSN30488986 162 COSMIC
COSN30190323 164 COSMIC
COSN30535874 200 COSMIC
COSN30514604 237 COSMIC
COSN30542081 251 COSMIC
COSN31480108 267 COSMIC
COSN20160565 644 COSMIC
COSN27546079 678 COSMIC
COSN20163598 858 COSMIC
COSN21788444 947 COSMIC
COSN32152255 1252 COSMIC
COSN6648019 1282 COSMIC
COSN20113172 1302 COSMIC
COSN20113171 1451 COSMIC
COSN25589910 1674 COSMIC
COSN8239569 1791 COSMIC
COSN8239568 2082 COSMIC
COSN16090756 2201 COSMIC
COSN24982271 2553 COSMIC
COSN22788595 2597 COSMIC
COSN28383258 2879 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750806434 1 dbSNP
rs747383028 2 dbSNP
rs778057796 5 dbSNP
rs758680565 8 dbSNP
rs141073967 9 dbSNP
rs1384125567 10 dbSNP
rs199652278 11 dbSNP
rs749900706 20 dbSNP
rs550600125 21 dbSNP
rs756902610 22 dbSNP
rs751411967 23 dbSNP
rs1473695619 31 dbSNP
rs764037421 33 dbSNP
rs369984883 34 dbSNP
rs1358789258 35 dbSNP
rs775549603 36 dbSNP
rs371881159 40 dbSNP
rs1248752446 43 dbSNP
rs776625917 44 dbSNP
rs1369263727 46 dbSNP
rs771159023 47 dbSNP
rs747293022 48 dbSNP
rs1370320146 51 dbSNP
rs1228602711 54 dbSNP
rs1372865734 54 dbSNP
rs1328474376 59 dbSNP
rs371639937 64 dbSNP
rs910813869 65 dbSNP
rs1295239839 74 dbSNP
rs986286333 75 dbSNP
rs532635996 76 dbSNP
rs1395342541 78 dbSNP
rs1327941976 80 dbSNP
rs571653934 83 dbSNP
rs116176256 84 dbSNP
rs1246375247 85 dbSNP
rs1162492907 87 dbSNP
rs962132602 91 dbSNP
rs1016203827 96 dbSNP
rs1449389666 97 dbSNP
rs1169846218 110 dbSNP
rs528287201 111 dbSNP
rs1374475168 112 dbSNP
rs1392390341 118 dbSNP
rs561136237 119 dbSNP
rs1006199232 121 dbSNP
rs1350124649 122 dbSNP
rs1437906043 125 dbSNP
rs1448448211 131 dbSNP
rs187682843 133 dbSNP
rs184153181 135 dbSNP
rs991325468 136 dbSNP
rs1353940103 137 dbSNP
rs958404320 138 dbSNP
rs1214939532 141 dbSNP
rs1035733294 143 dbSNP
rs1289347734 152 dbSNP
rs563272587 153 dbSNP
rs1322554722 163 dbSNP
rs776850971 164 dbSNP
rs1467574483 168 dbSNP
rs1289768306 169 dbSNP
rs1464538065 172 dbSNP
rs967558366 175 dbSNP
rs17782319 177 dbSNP
rs896308666 179 dbSNP
rs1020021141 184 dbSNP
rs1227962514 185 dbSNP
rs1371916544 187 dbSNP
rs1406729377 191 dbSNP
rs1011787659 199 dbSNP
rs113792715 202 dbSNP
rs893307550 205 dbSNP
rs1029252342 217 dbSNP
rs1435231476 220 dbSNP
rs569614757 237 dbSNP
rs996396555 238 dbSNP
rs1338639183 246 dbSNP
rs903629451 253 dbSNP
rs1284562266 261 dbSNP
rs1348100018 262 dbSNP
rs368640237 276 dbSNP
rs901857282 277 dbSNP
rs1040801480 280 dbSNP
rs545027130 282 dbSNP
rs2287119 283 dbSNP
rs2287118 284 dbSNP
rs1328525466 285 dbSNP
rs2287117 286 dbSNP
rs551055261 287 dbSNP
rs910769189 287 dbSNP
rs11117304 289 dbSNP
rs1187535341 289 dbSNP
rs1238392490 289 dbSNP
rs199861158 289 dbSNP
rs1049131374 295 dbSNP
rs565933814 296 dbSNP
rs931149477 296 dbSNP
rs1060252 309 dbSNP
rs1399515302 310 dbSNP
rs919724956 319 dbSNP
rs1334805685 326 dbSNP
rs1342009893 328 dbSNP
rs1407798011 333 dbSNP
rs1165875224 337 dbSNP
rs991376352 340 dbSNP
rs1229316280 341 dbSNP
rs984725093 341 dbSNP
rs1428707160 344 dbSNP
rs969798056 347 dbSNP
rs36027081 354 dbSNP
rs1195013178 355 dbSNP
rs1452003280 358 dbSNP
rs1279995224 366 dbSNP
rs1486832470 367 dbSNP
rs1203467514 369 dbSNP
rs1250521569 375 dbSNP
rs1472710380 377 dbSNP
rs1183605361 378 dbSNP
rs937230091 381 dbSNP
rs1375404917 388 dbSNP
rs1477430906 393 dbSNP
rs771974322 394 dbSNP
rs981544529 402 dbSNP
rs1023677587 405 dbSNP
rs1183198259 412 dbSNP
rs1307174848 415 dbSNP
rs540794282 419 dbSNP
rs1410643790 430 dbSNP
rs1013913884 436 dbSNP
rs967063517 437 dbSNP
rs1060253 438 dbSNP
rs1060254 440 dbSNP
rs1030821999 444 dbSNP
rs1204888108 446 dbSNP
rs989860836 448 dbSNP
rs957533752 457 dbSNP
rs16943310 458 dbSNP
rs996327229 463 dbSNP
rs1232231065 466 dbSNP
rs1483613899 467 dbSNP
rs115661907 469 dbSNP
rs1264866591 475 dbSNP
rs1280160249 485 dbSNP
rs575578649 489 dbSNP
rs1442850071 490 dbSNP
rs770691925 492 dbSNP
rs889446025 493 dbSNP
rs1396431098 495 dbSNP
rs1050816181 497 dbSNP
rs556889016 503 dbSNP
rs1390528625 506 dbSNP
rs1306024818 514 dbSNP
rs1300069046 518 dbSNP
rs1388868331 523 dbSNP
rs933552421 527 dbSNP
rs1005330425 531 dbSNP
rs1373356626 538 dbSNP
rs886401447 539 dbSNP
rs923546799 543 dbSNP
rs1036462736 554 dbSNP
rs1343266783 555 dbSNP
rs1230102370 556 dbSNP
rs1263255318 559 dbSNP
rs1355205296 560 dbSNP
rs368481957 563 dbSNP
rs1375728131 571 dbSNP
rs994850757 576 dbSNP
rs1175162865 577 dbSNP
rs75898183 579 dbSNP
rs546798283 582 dbSNP
rs1423876969 583 dbSNP
rs1055578711 589 dbSNP
rs144295628 594 dbSNP
rs1158573379 596 dbSNP
rs909262736 599 dbSNP
rs928579971 614 dbSNP
rs535145342 615 dbSNP
rs1165982353 617 dbSNP
rs1181969271 618 dbSNP
rs1396747484 620 dbSNP
rs114781228 628 dbSNP
rs550558160 629 dbSNP
rs1320412495 630 dbSNP
rs992196688 652 dbSNP
rs1030936017 654 dbSNP
rs960885051 654 dbSNP
rs912868222 656 dbSNP
rs77384806 657 dbSNP
rs967874558 658 dbSNP
rs563587509 661 dbSNP
rs755764174 679 dbSNP
rs1268615982 682 dbSNP
rs1486802573 683 dbSNP
rs1285045189 685 dbSNP
rs1180100395 688 dbSNP
rs561762733 692 dbSNP
rs1424215286 695 dbSNP
rs1188871691 696 dbSNP
rs1420320098 699 dbSNP
rs1225533348 700 dbSNP
rs113620181 704 dbSNP
rs543091980 705 dbSNP
rs1301650499 706 dbSNP
rs957086326 707 dbSNP
rs148779119 711 dbSNP
rs559329287 713 dbSNP
rs1348251228 714 dbSNP
rs1227479513 715 dbSNP
rs997878508 718 dbSNP
rs902072321 724 dbSNP
rs540754159 726 dbSNP
rs1255370556 727 dbSNP
rs1483426067 728 dbSNP
rs1212771494 731 dbSNP
rs1036577597 736 dbSNP
rs1471726334 741 dbSNP
rs11541879 745 dbSNP
rs1408769539 755 dbSNP
rs1420992152 760 dbSNP
rs190655752 764 dbSNP
rs1358215469 769 dbSNP
rs1318476896 771 dbSNP
rs1315179605 772 dbSNP
rs1369152467 776 dbSNP
rs1401919200 778 dbSNP
rs1298428606 783 dbSNP
rs1019617251 789 dbSNP
rs1216989457 802 dbSNP
rs1300432676 803 dbSNP
rs1481374522 807 dbSNP
rs1410448457 808 dbSNP
rs573735116 819 dbSNP
rs1049259921 822 dbSNP
rs1475791946 839 dbSNP
rs1204654909 845 dbSNP
rs948118167 850 dbSNP
rs1005098766 856 dbSNP
rs950730361 857 dbSNP
rs542815333 858 dbSNP
rs747673296 859 dbSNP
rs1176127220 861 dbSNP
rs978000670 867 dbSNP
rs895265388 872 dbSNP
rs575493117 873 dbSNP
rs1022122424 876 dbSNP
rs1055130024 878 dbSNP
rs1355931073 879 dbSNP
rs557244512 880 dbSNP
rs730214 884 dbSNP
rs1371156689 891 dbSNP
rs758971183 893 dbSNP
rs906997484 895 dbSNP
rs1046068427 900 dbSNP
rs1214958236 902 dbSNP
rs1273900684 903 dbSNP
rs1309483492 907 dbSNP
rs1219721821 908 dbSNP
rs1246176215 910 dbSNP
rs896826224 915 dbSNP
rs1196001463 917 dbSNP
rs1246748053 920 dbSNP
rs1267535425 923 dbSNP
rs537967503 924 dbSNP
rs1187475638 927 dbSNP
rs1015249706 945 dbSNP
rs912921529 946 dbSNP
rs1054150589 947 dbSNP
rs1005078893 949 dbSNP
rs1309675458 953 dbSNP
rs888053517 955 dbSNP
rs1049672812 956 dbSNP
rs935643738 961 dbSNP
rs553364140 962 dbSNP
rs1056553178 963 dbSNP
rs530878276 965 dbSNP
rs966617026 966 dbSNP
rs912033874 967 dbSNP
rs984126687 968 dbSNP
rs923929457 969 dbSNP
rs1385831311 970 dbSNP
rs1319233566 971 dbSNP
rs950989701 974 dbSNP
rs567766105 975 dbSNP
rs1266706888 979 dbSNP
rs1446924005 983 dbSNP
rs748196852 984 dbSNP
rs549160652 999 dbSNP
rs994834287 1001 dbSNP
rs959366222 1002 dbSNP
rs779580881 1003 dbSNP
rs1163186752 1004 dbSNP
rs1418142385 1007 dbSNP
rs80186383 1017 dbSNP
rs1420621422 1018 dbSNP
rs569937824 1019 dbSNP
rs551365734 1020 dbSNP
rs533293683 1021 dbSNP
rs1010055180 1022 dbSNP
rs1357170547 1026 dbSNP
rs1447041011 1029 dbSNP
rs953907232 1034 dbSNP
rs891750533 1035 dbSNP
rs1235441179 1044 dbSNP
rs976465883 1049 dbSNP
rs565527946 1054 dbSNP
rs1350108546 1056 dbSNP
rs961142925 1061 dbSNP
rs1015195744 1063 dbSNP
rs1286983529 1064 dbSNP
rs150027728 1068 dbSNP
rs1258742205 1069 dbSNP
rs952270031 1082 dbSNP
rs528909236 1086 dbSNP
rs1320923355 1088 dbSNP
rs563829290 1096 dbSNP
rs895313817 1099 dbSNP
rs1295965233 1101 dbSNP
rs1215974795 1105 dbSNP
rs1422993289 1106 dbSNP
rs1057068357 1111 dbSNP
rs1039205997 1112 dbSNP
rs1313259076 1112 dbSNP
rs1416832414 1112 dbSNP
rs1003614080 1121 dbSNP
rs186229967 1123 dbSNP
rs1440983043 1126 dbSNP
rs1281713983 1130 dbSNP
rs911611773 1134 dbSNP
rs542776237 1146 dbSNP
rs1373887341 1148 dbSNP
rs1350549122 1149 dbSNP
rs1292258299 1151 dbSNP
rs1249413262 1152 dbSNP
rs915105408 1169 dbSNP
rs531029077 1173 dbSNP
rs563932925 1175 dbSNP
rs1355498481 1176 dbSNP
rs920887078 1181 dbSNP
rs1172907737 1183 dbSNP
rs1453712417 1183 dbSNP
rs752758436 1185 dbSNP
rs545358826 1193 dbSNP
rs1396044842 1194 dbSNP
rs932597971 1202 dbSNP
rs1330957996 1206 dbSNP
rs1428140043 1207 dbSNP
rs1389768626 1210 dbSNP
rs973588578 1211 dbSNP
rs1304845310 1213 dbSNP
rs922450681 1217 dbSNP
rs767648007 1222 dbSNP
rs976578842 1223 dbSNP
rs1339656743 1225 dbSNP
rs959374483 1235 dbSNP
rs1189422813 1238 dbSNP
rs1033657476 1239 dbSNP
rs1194130241 1245 dbSNP
rs1254827370 1248 dbSNP
rs982623876 1251 dbSNP
rs970861279 1257 dbSNP
rs1447364082 1259 dbSNP
rs1251677695 1260 dbSNP
rs1373487727 1265 dbSNP
rs1462665203 1269 dbSNP
rs1169906300 1276 dbSNP
rs1392321117 1280 dbSNP
rs1060257 1282 dbSNP
rs1327099559 1286 dbSNP
rs1010112124 1287 dbSNP
rs1023091465 1288 dbSNP
rs1234432435 1297 dbSNP
rs201848498 1301 dbSNP
rs869243139 1302 dbSNP
rs397811145 1303 dbSNP
rs386385353 1305 dbSNP
rs959918920 1306 dbSNP
rs374667114 1307 dbSNP
rs386385352 1307 dbSNP
rs553239962 1307 dbSNP
rs5818648 1307 dbSNP
rs1195529296 1309 dbSNP
rs1032936774 1318 dbSNP
rs1300328707 1326 dbSNP
rs553047967 1327 dbSNP
rs373243616 1332 dbSNP
rs1452237446 1333 dbSNP
rs1288840193 1336 dbSNP
rs1174533419 1337 dbSNP
rs1038718622 1349 dbSNP
rs1436763821 1350 dbSNP
rs146380761 1351 dbSNP
rs141994153 1352 dbSNP
rs1294568524 1359 dbSNP
rs1432588935 1363 dbSNP
rs55936694 1375 dbSNP
rs893801484 1376 dbSNP
rs376915929 1386 dbSNP
rs920731137 1396 dbSNP
rs1250744824 1397 dbSNP
rs1420076300 1402 dbSNP
rs973639294 1403 dbSNP
rs938242015 1405 dbSNP
rs569850454 1406 dbSNP
rs1455866235 1408 dbSNP
rs1252967448 1424 dbSNP
rs1311427391 1432 dbSNP
rs1414982885 1439 dbSNP
rs1314361131 1442 dbSNP
rs557974979 1445 dbSNP
rs1390323444 1449 dbSNP
rs1307543898 1451 dbSNP
rs34684838 1455 dbSNP
rs796558699 1455 dbSNP
rs971132920 1462 dbSNP
rs113538348 1463 dbSNP
rs539347773 1472 dbSNP
rs1211819741 1473 dbSNP
rs565967507 1478 dbSNP
rs113089978 1479 dbSNP
rs1251407215 1481 dbSNP
rs1421374104 1482 dbSNP
rs1313805453 1483 dbSNP
rs1416857295 1484 dbSNP
rs1032820616 1485 dbSNP
rs1435748581 1486 dbSNP
rs796357152 1488 dbSNP
rs1302394493 1490 dbSNP
rs1454354785 1491 dbSNP
rs1171226094 1494 dbSNP
rs1175062512 1496 dbSNP
rs567627965 1500 dbSNP
rs964686234 1501 dbSNP
rs528874509 1502 dbSNP
rs1161321934 1504 dbSNP
rs1017928698 1508 dbSNP
rs1298240396 1509 dbSNP
rs368908903 1513 dbSNP
rs1410960827 1514 dbSNP
rs548369517 1517 dbSNP
rs1371399701 1522 dbSNP
rs1236239107 1526 dbSNP
rs9921219 1537 dbSNP
rs1305971340 1542 dbSNP
rs1204148749 1545 dbSNP
rs1443844659 1547 dbSNP
rs1047480445 1548 dbSNP
rs1192249429 1550 dbSNP
rs1252930786 1551 dbSNP
rs770805858 1552 dbSNP
rs1060258 1554 dbSNP
rs899358701 1555 dbSNP
rs1037858442 1557 dbSNP
rs1417892327 1560 dbSNP
rs35257784 1561 dbSNP
rs1485928353 1563 dbSNP
rs1028302359 1564 dbSNP
rs35886461 1568 dbSNP
rs997267289 1568 dbSNP
rs901057284 1572 dbSNP
rs1459435905 1573 dbSNP
rs182903836 1575 dbSNP
rs886933049 1580 dbSNP
rs1268172054 1582 dbSNP
rs1328997809 1585 dbSNP
rs1294357451 1588 dbSNP
rs1247417542 1589 dbSNP
rs537667433 1591 dbSNP
rs1047046161 1592 dbSNP
rs949420840 1593 dbSNP
rs769476851 1599 dbSNP
rs545589322 1606 dbSNP
rs1382948874 1608 dbSNP
rs767042312 1609 dbSNP
rs1216153417 1612 dbSNP
rs1240692702 1613 dbSNP
rs1387259288 1617 dbSNP
rs533420288 1626 dbSNP
rs1421222567 1627 dbSNP
rs1473901862 1634 dbSNP
rs1455640219 1635 dbSNP
rs560013529 1636 dbSNP
rs1316169976 1639 dbSNP
rs988240208 1645 dbSNP
rs1344333469 1646 dbSNP
rs958129713 1648 dbSNP
rs1289594758 1652 dbSNP
rs1342604117 1654 dbSNP
rs1165441475 1660 dbSNP
rs1292730144 1661 dbSNP
rs925344126 1672 dbSNP
rs928160820 1673 dbSNP
rs978624201 1678 dbSNP
rs964900663 1680 dbSNP
rs747878745 1681 dbSNP
rs1446727835 1690 dbSNP
rs113627776 1691 dbSNP
rs1484472706 1693 dbSNP
rs1428685997 1694 dbSNP
rs574061095 1699 dbSNP
rs1186828058 1701 dbSNP
rs1021118138 1702 dbSNP
rs954418024 1715 dbSNP
rs529511449 1716 dbSNP
rs1407163555 1723 dbSNP
rs1206274748 1725 dbSNP
rs78174881 1727 dbSNP
rs190296005 1728 dbSNP
rs138809019 1737 dbSNP
rs1274330227 1741 dbSNP
rs1212047775 1749 dbSNP
rs996820894 1750 dbSNP
rs1354724259 1751 dbSNP
rs901180687 1755 dbSNP
rs1350587310 1759 dbSNP
rs1228436194 1760 dbSNP
rs1002377021 1761 dbSNP
rs1288561709 1763 dbSNP
rs905324269 1765 dbSNP
rs1046655707 1768 dbSNP
rs949645916 1773 dbSNP
rs146102397 1774 dbSNP
rs1052462303 1775 dbSNP
rs141881425 1778 dbSNP
rs1255696177 1779 dbSNP
rs1180478128 1780 dbSNP
rs995758103 1783 dbSNP
rs894188352 1790 dbSNP
rs554056017 1791 dbSNP
rs751100968 1794 dbSNP
rs975457575 1796 dbSNP
rs1406972099 1797 dbSNP
rs1326920964 1798 dbSNP
rs1335287509 1799 dbSNP
rs938480875 1806 dbSNP
rs928273873 1809 dbSNP
rs1388329387 1822 dbSNP
rs1369157353 1823 dbSNP
rs1234021046 1824 dbSNP
rs58628744 1825 dbSNP
rs71973446 1825 dbSNP
rs964585511 1827 dbSNP
rs1462233975 1828 dbSNP
rs17175483 1831 dbSNP
rs914170354 1832 dbSNP
rs1180383805 1833 dbSNP
rs910349970 1834 dbSNP
rs987426996 1838 dbSNP
rs1186175489 1842 dbSNP
rs1194026895 1852 dbSNP
rs1379212886 1857 dbSNP
rs11541880 1859 dbSNP
rs1448316857 1861 dbSNP
rs954811490 1863 dbSNP
rs1395801249 1867 dbSNP
rs1201674932 1868 dbSNP
rs958451454 1872 dbSNP
rs1333872910 1873 dbSNP
rs535387532 1874 dbSNP
rs148106276 1880 dbSNP
rs1304593747 1882 dbSNP
rs1333233555 1886 dbSNP
rs1224743672 1893 dbSNP
rs1269256357 1894 dbSNP
rs549405626 1895 dbSNP
rs754205015 1896 dbSNP
rs778056149 1902 dbSNP
rs1270799312 1904 dbSNP
rs1019554145 1908 dbSNP
rs143140219 1910 dbSNP
rs570537685 1922 dbSNP
rs185833084 1930 dbSNP
rs1002331913 1936 dbSNP
rs905379104 1944 dbSNP
rs1025585170 1947 dbSNP
rs533595527 1948 dbSNP
rs756353030 1949 dbSNP
rs892755323 1954 dbSNP
rs55952628 1955 dbSNP
rs1461353450 1956 dbSNP
rs1329268513 1960 dbSNP
rs767739545 1965 dbSNP
rs1380902824 1969 dbSNP
rs181397450 1970 dbSNP
rs903824135 1975 dbSNP
rs1326651746 1980 dbSNP
rs536019703 1984 dbSNP
rs562062934 1985 dbSNP
rs543839456 1986 dbSNP
rs912631049 1987 dbSNP
rs1428650039 1988 dbSNP
rs1484731871 1992 dbSNP
rs1204325241 1994 dbSNP
rs1262232822 1999 dbSNP
rs987739325 2005 dbSNP
rs576416974 2008 dbSNP
rs564617634 2009 dbSNP
rs751678536 2012 dbSNP
rs1477360438 2017 dbSNP
rs545649184 2020 dbSNP
rs762915824 2021 dbSNP
rs980444973 2024 dbSNP
rs969570507 2025 dbSNP
rs1452341604 2027 dbSNP
rs1054444210 2028 dbSNP
rs149074946 2032 dbSNP
rs1014208139 2042 dbSNP
rs892597838 2045 dbSNP
rs1250008638 2046 dbSNP
rs565728885 2047 dbSNP
rs1310717200 2049 dbSNP
rs547693507 2051 dbSNP
rs553585014 2052 dbSNP
rs1001090802 2055 dbSNP
rs535352546 2058 dbSNP
rs1217532737 2061 dbSNP
rs1040135652 2065 dbSNP
rs942704072 2066 dbSNP
rs1274142670 2072 dbSNP
rs891240440 2073 dbSNP
rs138206111 2074 dbSNP
rs1352121154 2082 dbSNP
rs568359696 2083 dbSNP
rs919062404 2085 dbSNP
rs1027024868 2089 dbSNP
rs1181769966 2090 dbSNP
rs1381254610 2092 dbSNP
rs74039959 2093 dbSNP
rs35608280 2100 dbSNP
rs1060266 2101 dbSNP
rs909116929 2102 dbSNP
rs1423808988 2108 dbSNP
rs537464607 2109 dbSNP
rs1159680663 2110 dbSNP
rs1370587302 2115 dbSNP
rs1309917210 2123 dbSNP
rs189022360 2124 dbSNP
rs969076908 2129 dbSNP
rs1181907395 2130 dbSNP
rs1475689347 2133 dbSNP
rs1020048609 2134 dbSNP
rs1257804948 2137 dbSNP
rs1010028979 2138 dbSNP
rs892787169 2139 dbSNP
rs1442157769 2140 dbSNP
rs917659178 2141 dbSNP
rs936900372 2142 dbSNP
rs147009012 2144 dbSNP
rs563592783 2145 dbSNP
rs1031154326 2149 dbSNP
rs1001019181 2150 dbSNP
rs968318678 2152 dbSNP
rs11541884 2158 dbSNP
rs982825731 2165 dbSNP
rs1331044301 2171 dbSNP
rs930094921 2172 dbSNP
rs1219996678 2175 dbSNP
rs149804348 2177 dbSNP
rs533687834 2180 dbSNP
rs1218086875 2181 dbSNP
rs1258862899 2182 dbSNP
rs1286291470 2185 dbSNP
rs1459462526 2187 dbSNP
rs138559489 2188 dbSNP
rs1007343235 2189 dbSNP
rs974120862 2190 dbSNP
rs1489022655 2192 dbSNP
rs958845503 2196 dbSNP
rs1285627417 2197 dbSNP
rs746483004 2200 dbSNP
rs566257213 2201 dbSNP
rs548058831 2204 dbSNP
rs994188152 2205 dbSNP
rs1425211493 2207 dbSNP
rs529566759 2209 dbSNP
rs1325176259 2211 dbSNP
rs1387070858 2215 dbSNP
rs1158950995 2217 dbSNP
rs1286968775 2219 dbSNP
rs1036181612 2220 dbSNP
rs11541883 2227 dbSNP
rs892908849 2236 dbSNP
rs1180359416 2237 dbSNP
rs1472558291 2240 dbSNP
rs909159144 2241 dbSNP
rs1242779073 2242 dbSNP
rs1033066728 2245 dbSNP
rs1037511311 2249 dbSNP
rs1044948073 2251 dbSNP
rs116696164 2252 dbSNP
rs1039932612 2259 dbSNP
rs1264659042 2260 dbSNP
rs917563478 2264 dbSNP
rs991928870 2265 dbSNP
rs371258446 2271 dbSNP
rs956469735 2281 dbSNP
rs1047245274 2282 dbSNP
rs1322129849 2284 dbSNP
rs923675710 2293 dbSNP
rs1399585196 2294 dbSNP
rs1291691829 2296 dbSNP
rs979630735 2297 dbSNP
rs111922215 2298 dbSNP
rs771452324 2304 dbSNP
rs16943300 2307 dbSNP
rs1297770676 2308 dbSNP
rs1380518551 2317 dbSNP
rs1230584426 2321 dbSNP
rs551955281 2327 dbSNP
rs1436612932 2334 dbSNP
rs981349668 2341 dbSNP
rs971334078 2342 dbSNP
rs955574978 2344 dbSNP
rs868212111 2345 dbSNP
rs1186206719 2360 dbSNP
rs1020110519 2368 dbSNP
rs1320506138 2372 dbSNP
rs994115168 2379 dbSNP
rs1237598129 2381 dbSNP
rs897277022 2388 dbSNP
rs1473719083 2389 dbSNP
rs1038414471 2391 dbSNP
rs1458819858 2395 dbSNP
rs1006011400 2396 dbSNP
rs887583928 2403 dbSNP
rs1045401929 2404 dbSNP
rs947973839 2405 dbSNP
rs147766951 2406 dbSNP
rs1362691079 2412 dbSNP
rs187044466 2418 dbSNP
rs1359858710 2419 dbSNP
rs1170610614 2425 dbSNP
rs1450765522 2427 dbSNP
rs1278319756 2429 dbSNP
rs996203145 2431 dbSNP
rs1241318883 2433 dbSNP
rs1056171082 2436 dbSNP
rs964404182 2437 dbSNP
rs572487053 2438 dbSNP
rs934978989 2440 dbSNP
rs1278665480 2441 dbSNP
rs1202284332 2445 dbSNP
rs1018598118 2446 dbSNP
rs112381392 2450 dbSNP
rs1185875059 2456 dbSNP
rs979138398 2458 dbSNP
rs1180264590 2462 dbSNP
rs891397910 2471 dbSNP
rs1452776858 2472 dbSNP
rs946883770 2475 dbSNP
rs374132380 2476 dbSNP
rs898537787 2482 dbSNP
rs1248313949 2488 dbSNP
rs574357687 2489 dbSNP
rs11117303 2502 dbSNP
rs1400191375 2506 dbSNP
rs144333921 2508 dbSNP
rs756413254 2509 dbSNP
rs1232014333 2510 dbSNP
rs576760543 2511 dbSNP
rs1339472202 2513 dbSNP
rs1346421370 2514 dbSNP
rs748534290 2527 dbSNP
rs1256933855 2529 dbSNP
rs1458141917 2533 dbSNP
rs1016981477 2537 dbSNP
rs377702112 2540 dbSNP
rs1450847546 2542 dbSNP
rs373357057 2545 dbSNP
rs1387865655 2548 dbSNP
rs1370355450 2549 dbSNP
rs1168591104 2550 dbSNP
rs371057687 2558 dbSNP
rs1292206023 2561 dbSNP
rs558312406 2563 dbSNP
rs1371518259 2568 dbSNP
rs887625934 2573 dbSNP
rs533885645 2574 dbSNP
rs869308876 2574 dbSNP
rs989015436 2578 dbSNP
rs566576928 2580 dbSNP
rs957228350 2582 dbSNP
rs1428275730 2584 dbSNP
rs1276985466 2586 dbSNP
rs1318039127 2589 dbSNP
rs925818422 2594 dbSNP
rs1271215327 2595 dbSNP
rs1803523 2596 dbSNP
rs1355300798 2600 dbSNP
rs1210212285 2604 dbSNP
rs1269256239 2617 dbSNP
rs774359655 2618 dbSNP
rs1012481422 2619 dbSNP
rs1191811358 2620 dbSNP
rs554364978 2622 dbSNP
rs559348048 2623 dbSNP
rs536069933 2624 dbSNP
rs1367229993 2628 dbSNP
rs568739821 2630 dbSNP
rs1427157735 2634 dbSNP
rs1393381998 2635 dbSNP
rs182523553 2636 dbSNP
rs114696078 2643 dbSNP
rs1340539349 2644 dbSNP
rs898658774 2647 dbSNP
rs1252207086 2652 dbSNP
rs1290980173 2655 dbSNP
rs1206865061 2657 dbSNP
rs1481830145 2668 dbSNP
rs574212905 2669 dbSNP
rs1001609700 2674 dbSNP
rs905964377 2675 dbSNP
rs1045731738 2680 dbSNP
rs946509738 2681 dbSNP
rs950037774 2682 dbSNP
rs1423712958 2685 dbSNP
rs1188890998 2687 dbSNP
rs1370514529 2689 dbSNP
rs1438245350 2692 dbSNP
rs1299861554 2693 dbSNP
rs1360766079 2703 dbSNP
rs552334871 2719 dbSNP
rs985678517 2720 dbSNP
rs1310172205 2724 dbSNP
rs934150678 2725 dbSNP
rs1333698952 2727 dbSNP
rs1239152910 2740 dbSNP
rs935949250 2743 dbSNP
rs925794909 2745 dbSNP
rs922858814 2750 dbSNP
rs756680708 2751 dbSNP
rs746210823 2753 dbSNP
rs1173891459 2756 dbSNP
rs1480034126 2757 dbSNP
rs1274706485 2758 dbSNP
rs975004402 2761 dbSNP
rs527737576 2763 dbSNP
rs1173541771 2764 dbSNP
rs1376514666 2765 dbSNP
rs1466107693 2769 dbSNP
rs972925028 2770 dbSNP
rs560229419 2774 dbSNP
rs1249354433 2775 dbSNP
rs1016868786 2777 dbSNP
rs1311613898 2783 dbSNP
rs984511252 2783 dbSNP
rs766437709 2784 dbSNP
rs1198602442 2786 dbSNP
rs1026435912 2787 dbSNP
rs868454198 2790 dbSNP
rs541596804 2791 dbSNP
rs1330427717 2800 dbSNP
rs1177574900 2805 dbSNP
rs1420889221 2809 dbSNP
rs1465002450 2812 dbSNP
rs1012123692 2813 dbSNP
rs1290664479 2814 dbSNP
rs781663047 2822 dbSNP
rs896284172 2823 dbSNP
rs750273857 2824 dbSNP
rs529818513 2826 dbSNP
rs73251309 2836 dbSNP
rs1367157743 2845 dbSNP
rs1387614582 2846 dbSNP
rs1285224065 2858 dbSNP
rs905910672 2877 dbSNP
rs1024395915 2879 dbSNP
rs1313738064 2881 dbSNP
rs756912494 2886 dbSNP
rs1219809265 2890 dbSNP
rs1397951623 2904 dbSNP
rs1488584439 2908 dbSNP
rs1192600276 2909 dbSNP
rs1014385059 2913 dbSNP
rs1260347723 2929 dbSNP
rs891793538 2932 dbSNP
rs1053557365 2939 dbSNP
rs1425688148 2939 dbSNP
rs1302268256 2945 dbSNP
rs761656793 2948 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguGGUAACA---GUGUGAGGu 5'
                || || |   |||||||| 
Target 5' uccgucCCUUUUUCUCCACACUCCa 3'
6 - 30
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguGGUAACA---GUGUGAGGu 5'
                || || |   |||||||| 
Target 5' uccgucCCUUUUUCUCCACACUCCa 3'
6 - 30
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000565644.1 | 3UTR | AUUUUUCCGUCCCUUUUUCUCCACACUCCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000565644.1 | 3UTR | AUUUUUCCGUCCCUUUUUCUCCACACUCCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*