miRTarBase - #MIRT500953
-
| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-15a |
| Genomic Coordinates | chr13: 50049119 - 50049201 |
| Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
| Description | Homo sapiens miR-15a stem-loop |
| Comment | Reference . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | hsa-miR-15a-5p |
| Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 |
| Evidence | Experimental |
| Experiments | Cloned |
| SNPs in miRNA | |
| Putative Targets | |
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | SREK1 | ||||||||||||||||||||
| Synonyms | SFRS12, SRrp508, SRrp86 | ||||||||||||||||||||
| Description | splicing regulatory glutamic acid and lysine rich protein 1 | ||||||||||||||||||||
| Transcript | NM_001077199 | ||||||||||||||||||||
| Other Transcripts | NM_139168 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on SREK1 | |||||||||||||||||||||
| 3'UTR of SREK1 (miRNA target sites are highlighted) |
>SREK1|NM_001077199|3'UTR 1 GACCGACAAGTGTACCTCTGCACTCAATGCTGGAATCAAATCCAAAGCTTTTAATTCTCTCAACAAGATGTAAACAGGAA 81 AGAAATCTAGTTGAGCATGAAGATAGGATCTAACAGCTTTTCCAGTTGTTAGATGACTTTGTGGCCATCTTGTTATTGAG 161 TAAGAAAATAAAGCATGGACATCATGAAAATAACAGATGTTACCCAAACTCATCTTCTAAAATCTGTGCATTTCCATGGT 241 GGCTGACACACTTGTCATGTGGTCTGTTAGTGTTTGCCAAGAACCATTGCAAATAAATTGAACATCAAAGATCCAAGTTT 321 GTACTATCCCTAAAGACTGGAGATAAGCATTGGAGGCTCTTTTAAAAAATGCTAGTTACTGAATTTTGTATTGTTTTACT 401 TTTTTTTTTATTTCAATATATACAGTTTGATGATGTGCTTGAAATTGGTGCAAATATATACACACCCTTGTAAGTGCAAA 481 GTATGTAAGAAGTTTTAACATTTACTTCACAGGACTTGTGATTGTGTTAAATTCTCACTATTGTGTTTTCTTTTGCTCAC 561 TGTTTAGGACAATTTTTCTTTAAAATAGTTTTGCAGATTAAAATTGCTTAAATAAGTGGATTAAAAAACTGACAATGCAT 641 GCTACTGTTCTCTTTCAAAAGGAAGAGCAACCGTGTTGAATACTAATAATGATGAATTAGTATTCAGTGTTTAGAATCAT 721 TGGGACTACCCACAAAGTGAGCATTTCTTTTTAAATTTTCTTGACATTTCCAAGCTTATTATGAATAATATTGCAGTGTG 801 TCTTGTCAGCTGTAGGTGGCAAAGGTGCCCTTATAAAAAAGGAAACTGGCTTTTCAAAATGGGCTATGGGAGCACAAGCT 881 GAAGCTTTAGTGCCTTCTACAATGTGGTATACTGTTTTCTAGAATTTTATATGTGCTAGTCATTCTCAATTCATATGGAA 961 TCTAGATGGATATTTCATGCATACCCATAGAGAAGTGTGTAAGTGATATGTCAGAAGAGCTTCTTACTGATTTCACCTAA 1041 AATGAGAAGGAAGTCCTGTTTTCAAGAATGACATTAGAGTCATGCAGCTTTGGGACCATCAGTTTTATACTGTGATAATT 1121 GAAAATGAAACATGTTCTTATTTTCCTTAAATTGAAGAAAACCCTTTAGTTGTCTACATTGGATGGCCTTATTACCTCTC 1201 AATCATCTTTTCATAAATGATGTGCAGAAATTGTACTTAAGGACTTAGGAGTATATGGGAGGTTATTGGTTTTATGTTTA 1281 AGGATACGTTTACTTGAGTTTAAGATACAGGTCATCCATCATTCTTAGGCTCACTTTTTACAGAAAGTATGCAAATAGTA 1361 AAGTGACAGCACTGCTAATGTTTTTCCCCAGTACTATAACTTGTGGTTTCTGAACTCATTATTGTTGTATTTCCAAAAAA 1441 GTAATACCTTTTAATTAGTGTATTAAAAGTTAAGTATAATTATTTTAATGCAATCTAATACAATCAGATTACTCAGTTGC 1521 CTTACCTCATGGGAAGAGTTACTTTTTTAGATCTAAAAAGCTGAATAGCATGTTAGTTACTTGGTTTCAACTTGAGTTTT 1601 CTTTTAATGTTAATAAGATTGAAACTTTAGTATTTAGTGGGGAATGGAAAGAGTTGCCCTTGTTGCAAGTAATGAAGCCT 1681 GATTTGATTATGAAGCTGCTTAATCACTCTTCATGTGTTCAGAATTACTGTTTTTTTTGTTTGTTTTTCCTTTTTGTCAC 1761 TGTGTACATTAAAATTTTGGAAGATGCTTTACTATGTAAAGTATAGATGGTCATTTTAATCATTCAGCCACATACGGTTG 1841 GCTGGTAAACAGCTTATTCTGATACAAGAATGCTTGGGTGCATATGGAAAGATTGTGAAAGAGTGTGTCTTGCATCAACA 1921 GCTGTCTTATTTATGATATATAAGTAGAAATAGAGCAAATGTTGGAATCTGTTATTTTTAGTACCATGTCTTTAATAAAG 2001 CTAAGTATTTTAGAGGAAAATGTTTGTTTATGCATTTCAAAAAAGCATTTTAGTTTTATCCTGCTCATTTTAGTTGTCAT 2081 AGAGATTGTTGTGACGTGGAGAGTGCATGTTTGTGTGGTGTCTATAAAACAAGTCATTTAAAGTATGAGTGTTTTCTTGT 2161 ACTCTGGACCTATTACATGTTTCTTTATGTTGGTAATTAACATTTAATTTGGTTCTTGCTGCTAATTATTTTCTCTGCTG 2241 ATATTTATTAAGCTTTAAAATAATCGTACTATAATCTTGAAACACTGATTTGTAAAAACTAAGAATGAGTAGGAATACAA 2321 GAGATCTGGAGGAACAAATCAGATTGTTATTAGGGTTTGACTTTTTTTTTACATGGGCTTATGGAAGCAAGGCATTCTAG 2401 GGTCTAGAGGGATGTGTGTGTGTGCTTGTGTGTCCATGTGTGCGCATGCGCACGTGTGTATCTGTTTGAGACATACTTTC 2481 TCTGTTCACTTAAAAGAGCTCATGTTTTCATTTGTTTATTCTTTTCTTTCAGGGTATTTTGTTTTTTTCTTTAAGACTTC 2561 TTTTTTTAAATCCCAGGTAGATGTTGTCAGATAAACTTGAGGTAAGGCCAAGAAGACAGACATTTTATGCTTCATACTTT 2641 CTGTAATTATCTTTTGTAGCTTGATTACATAGAGTACCCTCTCTTCCTTAAGTTGTAGTTGCTATTTATCATTGTAGACA 2721 AATTCTGTTGCCTTTCAGCAACGTATGCTGAACTAGTATCATAAGATGGTGCATCAGTTCATAAGCTAGTGCATAAGTTT 2801 TGTGTCAAAACTTTTAAATCCTGAAGTTCTGCAGTTATCATCTTAGTTATTTTCTATCTAATTAGCTTATAATTGCAAAC 2881 ACTAGTCAGCTTGTGATCTCTGTGTTTCAAGTTCTTTTCTTCACGAGGTTCAGTACCTGCTATGTTGATCTTTGGCAGTG 2961 CCAGAGGCTTAAATTTTGACCTGCTCAATTAAAAATAAACACTGGCGTTTATAATGAAAAGGTTTTTTTGTCGGGGGGGG 3041 GGGGGTCAAGAGAATTTATTTTGTGATAGTAATAATTTTCAAGACCTTCAGTCATTCCTATGTCTATGTTGCTATCTTTA 3121 TTTTAAAACTTAGAACCCTGATCTAACTCCCTTCTCAAGTGAAGATACTGTGTAGATTCAAGAATTATAATGTAGAGTAA 3201 TAGGCCTTTAAGTTTTTTTTTAATCTGTTAGAAATAAAGAGCATGATTTAATTATTGTTGAATTAACAATTAAAATGAAT 3281 CCCTTTGGAGGGATGGCATTGAATAACTTATAATTTCAGTGAATCATTTACGTTTTCATTGGAAGACAGTATCTGATTTC 3361 AACTGGTGCGTTACGAAGTAGAGCCATTCCCACAAAGTAAATGTGCAGTGCCCATGTTTCTTGTGTTTAAATATTTTTTA 3441 TTTTCACTACATATATATTATTTTCTCATGTTTATTTACTAATGTAATTTTCACTTAAAATTAGATGTTTATTTTCAAAT 3521 TTTAAAAGCTAGTGCTCTTAAAAGAGCTAAATTATATTTCTGGAAGCAGGAGTTTAGTATAAATGTAATAAAATTTTAAA 3601 ATAAAATTGACTTCCCTACTTAATCTTGGGTTTGTGGGTGAGTTTGTTTTTAGTACACTCTTATTGGTGGTTTTGCCTGA 3681 AGAGTAATACATTATTATTATTACTTTTCTTTTTGAGACAGGGTCTCACTCTGTCACTCAGGCTGGAGTGCAGTGACACG 3761 ATCATGGCTCACTGCAATCTTGACCTTTCTCGGCATGGATGATCCTCTCACCTCAGCCTCTTGAATAGCTGGGACCACAG 3841 ACATGTGCCACCAAGCCCAGTTAATTTTAGAATTTTTTTTGTAGAGACAGGATCTTGCCATGTTGCCTAGACTGGTCTCA 3921 AACTCCTGGGCTCAAACAATCTGTCTGCCTCAGCCTTCTAAAGTGCTGAGATTACAGGTGTGAGGTACTGCACCTGGCAA 4001 TACGTTATTTTAAAAGTAAACGCTAAGCCATTTATGACTTTGGTTATATTCAGTCAGTTGGATTTAGTAACTAATAACTA 4081 GCTTTCTTCCATTCTAAGGTACTTTTATAGTTTCTAGCAATTAGTTTGTTACAATTAGCTTATATCAGATATAACAGTTC 4161 TTAATATAATGTTTATAAAAGGTTTTAAGTCTGTTGCCTGATTTTTAAATTTATATCTAGTTAACATTTTAATTTTAAAA 4241 TTGCCAACTTTTGGGAGATTTCACATATTTTACCTCTATATTTTATTTTTCCAGGATTGGTATGGAGGAGTAGTACCTTC 4321 TATTCTTGGTTTATTTTTATTTGCTAGACATAATTTCTTAACTACATATGTAAGTATAAATTCATAAAAATCACACTGAA 4401 AGAATAGGTTGATTTCAACCATTTTGAGGGTACTGGTAGGTAACACACTGTTGGGGAATAAACTAAAGAATTTCTGATTT 4481 CTACAATAGATTTAAGTATGAAATTTGAGTATACTGTGTAGCTGTGTAGATCAACTTAATGCTTAAAAAATTACCTCCTT 4561 AATGATTAGATTAATAGAACAGTGTTAGATTATCAAGGGAAGAGTTTGGAATGTAAACATAAACATGCTGCATAGGTGGT 4641 GGTTATTTGTGAGTAGGACTACTTTTAAATGGTACTAGTAAAGATTTATCAAACAATGCTGCTATTATGTTGCTATATTT 4721 TTAATAAAATGAAAATCTTAAAATCTTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
DRVs in gene 3'UTRs | |||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB
HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG
PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8
PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7
PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
| Method / RBP | HITS-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000334121.6 | 3UTR | GAUUUAUCAAACAAUGCUGCUAUUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
| Method / RBP | PAR-CLIP / AGO1 |
|---|---|
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545216 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545217 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714645 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1065667 | |
| Method / RBP | PAR-CLIP / AGO1 |
|---|---|
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1065668 | |
| Method / RBP | PAR-CLIP / AGO1 |
|---|---|
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1065669 | |
| Method / RBP | PAR-CLIP / AGO1 |
|---|---|
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065670 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset SRR1045082 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Transcription factor regulation Circular RNA sponge
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000280 | BMI1 | BMI1 proto-oncogene, polycomb ring finger |  |
|
|
|
|
5 | 3 | |||
| MIRT000282 | WNT3A | Wnt family member 3A | |
|
|
3 | 2 | |||||
| MIRT000283 | MYB | MYB proto-oncogene, transcription factor | |
|
|
|
|
5 | 3 | |||
| MIRT000284 | CDC25A | cell division cycle 25A | |
|
|
3 | 3 | |||||
| MIRT000285 | CCND2 | cyclin D2 | |
|
|
3 | 5 | |||||
| MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT000806 | ACTR1A | ARP1 actin related protein 1 homolog A | |
1 | 1 | |||||||
| MIRT000808 | TPI1 | triosephosphate isomerase 1 | |
1 | 1 | |||||||
| MIRT000810 | PDCD4 | programmed cell death 4 | |
|
|
3 | 2 | |||||
| MIRT000812 | RAB21 | RAB21, member RAS oncogene family | |
|
2 | 1 | ||||||
| MIRT000815 | BCL2 | BCL2, apoptosis regulator | |
|
|
|
|
|
6 | 13 | ||
| MIRT000817 | WT1 | Wilms tumor 1 | |
|
2 | 1 | ||||||
| MIRT000819 | ASXL2 | additional sex combs like 2, transcriptional regulator | |
|
2 | 1 | ||||||
| MIRT000823 | TMEM251 | transmembrane protein 251 | |
|
2 | 1 | ||||||
| MIRT000825 | CARD8 | caspase recruitment domain family member 8 | |
|
2 | 1 | ||||||
| MIRT000827 | CDC14B | cell division cycle 14B | |
|
2 | 1 | ||||||
| MIRT000829 | CENPJ | centromere protein J | |
|
2 | 1 | ||||||
| MIRT000831 | CEP63 | centrosomal protein 63 | |
|
2 | 1 | ||||||
| MIRT000833 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
|
3 | 3 | |||||
| MIRT000835 | ECHDC1 | ethylmalonyl-CoA decarboxylase 1 | |
|
2 | 1 | ||||||
| MIRT000847 | GOLGA5 | golgin A5 | |
|
2 | 1 | ||||||
| MIRT000849 | GOLPH3L | golgi phosphoprotein 3 like | |
|
2 | 1 | ||||||
| MIRT000851 | GTF2H1 | general transcription factor IIH subunit 1 | |
|
2 | 1 | ||||||
| MIRT000853 | H3F3B | H3 histone family member 3B | |
|
2 | 1 | ||||||
| MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | |
|
2 | 1 | ||||||
| MIRT000857 | HDHD2 | haloacid dehalogenase like hydrolase domain containing 2 | |
|
2 | 1 | ||||||
| MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | |
|
2 | 1 | ||||||
| MIRT000863 | HRSP12 | reactive intermediate imine deaminase A homolog | |
|
2 | 1 | ||||||
| MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | |
|
2 | 1 | ||||||
| MIRT000866 | HSPA1A | heat shock protein family A (Hsp70) member 1A | |
|
2 | 1 | ||||||
| MIRT000868 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | |
|
2 | 1 | ||||||
| MIRT000878 | MCL1 | MCL1, BCL2 family apoptosis regulator | |
|
2 | 1 | ||||||
| MIRT000880 | MSH2 | mutS homolog 2 | |
|
2 | 1 | ||||||
| MIRT000884 | OMA1 | OMA1 zinc metallopeptidase | |
|
2 | 1 | ||||||
| MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase like 1 | |
|
2 | 1 | ||||||
| MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | |
|
2 | 1 | ||||||
| MIRT000890 | PHKB | phosphorylase kinase regulatory subunit beta | |
|
2 | 1 | ||||||
| MIRT000892 | PMS1 | PMS1 homolog 1, mismatch repair system component | |
|
2 | 1 | ||||||
| MIRT000894 | PNN | pinin, desmosome associated protein | |
|
2 | 1 | ||||||
| MIRT000896 | PRIM1 | DNA primase subunit 1 | |
|
2 | 1 | ||||||
| MIRT000898 | RAD51C | RAD51 paralog C | |
|
2 | 1 | ||||||
| MIRT000900 | RHOT1 | ras homolog family member T1 | |
|
2 | 1 | ||||||
| MIRT000902 | RNASEL | ribonuclease L | |
|
2 | 1 | ||||||
| MIRT000906 | SLC35A1 | solute carrier family 35 member A1 | |
|
2 | 1 | ||||||
| MIRT000908 | SLC35B3 | solute carrier family 35 member B3 | |
|
2 | 1 | ||||||
| MIRT000910 | TIA1 | TIA1 cytotoxic granule associated RNA binding protein | |
|
2 | 1 | ||||||
| MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | |
|
2 | 1 | ||||||
| MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | |
|
2 | 1 | ||||||
| MIRT000922 | ZNF559 | zinc finger protein 559 | |
|
2 | 1 | ||||||
| MIRT001227 | CCND1 | cyclin D1 | |
|
|
|
|
5 | 7 | |||
| MIRT001228 | CCNE1 | cyclin E1 | |
|
|
|
|
|
6 | 8 | ||
| MIRT001802 | BACE1 | beta-secretase 1 | |
|
2 | 1 | ||||||
| MIRT002946 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
|
3 | 3 | |||||
| MIRT003333 | BRCA1 | BRCA1, DNA repair associated | |
|
2 | 2 | ||||||
| MIRT003334 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 4 | ||||||
| MIRT003872 | WIPF1 | WAS/WASL interacting protein family member 1 | |
|
2 | 1 | ||||||
| MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog | |
|
2 | 1 | ||||||
| MIRT003874 | HSP90B1 | heat shock protein 90 beta family member 1 | |
|
2 | 1 | ||||||
| MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | |
|
|
3 | 1 | |||||
| MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | |
|
2 | 1 | ||||||
| MIRT003877 | FAM69A | family with sequence similarity 69 member A | |
|
2 | 1 | ||||||
| MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | |
1 | 1 | |||||||
| MIRT003879 | FAM122C | family with sequence similarity 122C | |
|
2 | 1 | ||||||
| MIRT003880 | PWWP2A | PWWP domain containing 2A | |
|
2 | 1 | ||||||
| MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | |
|
2 | 1 | ||||||
| MIRT003882 | CCDC111 | primase and DNA directed polymerase | |
|
2 | 1 | ||||||
| MIRT003883 | C2orf43 | lipid droplet associated hydrolase | |
|
2 | 1 | ||||||
| MIRT003884 | C4orf27 | histone PARylation factor 1 | |
|
2 | 1 | ||||||
| MIRT003885 | NIPAL2 | NIPA like domain containing 2 | |
|
2 | 1 | ||||||
| MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog | |
|
2 | 1 | ||||||
| MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | |
|
2 | 1 | ||||||
| MIRT003888 | CADM1 | cell adhesion molecule 1 | |
|
|
3 | 1 | |||||
| MIRT003891 | TMEM184B | transmembrane protein 184B | |
|
2 | 1 | ||||||
| MIRT003899 | APP | amyloid beta precursor protein | |
|
|
3 | 2 | |||||
| MIRT004046 | UCP2 | uncoupling protein 2 | |
|
|
3 | 1 | |||||
| MIRT004275 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
|
6 | 11 | ||
| MIRT004680 | TSPYL2 | TSPY like 2 | |
|
2 | 1 | ||||||
| MIRT004829 | NFKB1 | nuclear factor kappa B subunit 1 | |
|
|
3 | 1 | |||||
| MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | |
|
|
|
4 | 1 | ||||
| MIRT005763 | TP53 | tumor protein p53 | |
1 | 1 | |||||||
| MIRT006027 | FGF7 | fibroblast growth factor 7 | |
|
2 | 1 | ||||||
| MIRT006176 | CLCN3 | chloride voltage-gated channel 3 | |
|
|
|
4 | 1 | ||||
| MIRT006177 | CRKL | CRK like proto-oncogene, adaptor protein | |
|
|
|
|
5 | 2 | |||
| MIRT006181 | MN1 | MN1 proto-oncogene, transcriptional regulator | |
|
|
|
4 | 1 | ||||
| MIRT006658 | Ccnd1 | cyclin D1 | |
1 | 1 | |||||||
| MIRT006801 | HMGA1 | high mobility group AT-hook 1 | |
|
|
|
4 | 2 | ||||
| MIRT006805 | HMGA2 | high mobility group AT-hook 2 | |
|
|
3 | 1 | |||||
| MIRT006913 | IFNG | interferon gamma | |
|
2 | 1 | ||||||
| MIRT006998 | PURA | purine rich element binding protein A | |
|
2 | 2 | ||||||
| MIRT007090 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
|
3 | 2 | |||||
| MIRT032077 | DLK1 | delta like non-canonical Notch ligand 1 | |
|
2 | 1 | ||||||
| MIRT051311 | PLA2G2D | phospholipase A2 group IID | |
1 | 1 | |||||||
| MIRT051312 | ACVR1B | activin A receptor type 1B | |
1 | 1 | |||||||
| MIRT051313 | IKBKG | inhibitor of nuclear factor kappa B kinase subunit gamma | |
1 | 1 | |||||||
| MIRT051314 | GCLM | glutamate-cysteine ligase modifier subunit | |
1 | 1 | |||||||
| MIRT051315 | PCF11 | PCF11 cleavage and polyadenylation factor subunit | |
1 | 1 | |||||||
| MIRT051316 | HIST1H2BK | histone cluster 1 H2B family member k | |
1 | 1 | |||||||
| MIRT051317 | ODC1 | ornithine decarboxylase 1 | |
1 | 1 | |||||||
| MIRT051318 | CALD1 | caldesmon 1 | |
1 | 1 | |||||||
| MIRT051319 | RPP30 | ribonuclease P/MRP subunit p30 | |
1 | 1 | |||||||
| MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | |
1 | 1 | |||||||
| MIRT051321 | CCNYL1 | cyclin Y like 1 | |
1 | 1 | |||||||
| MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | |
1 | 1 | |||||||
| MIRT051323 | PREB | prolactin regulatory element binding | |
1 | 1 | |||||||
| MIRT051324 | PDHX | pyruvate dehydrogenase complex component X | |
1 | 1 | |||||||
| MIRT051325 | SNX6 | sorting nexin 6 | |
1 | 1 | |||||||
| MIRT051326 | CNN3 | calponin 3 | |
1 | 1 | |||||||
| MIRT051327 | KIF1A | kinesin family member 1A | |
1 | 1 | |||||||
| MIRT051328 | NAB1 | NGFI-A binding protein 1 | |
1 | 1 | |||||||
| MIRT051329 | CCT6B | chaperonin containing TCP1 subunit 6B | |
1 | 1 | |||||||
| MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | |
1 | 1 | |||||||
| MIRT051331 | CLCC1 | chloride channel CLIC like 1 | |
1 | 1 | |||||||
| MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | |
1 | 1 | |||||||
| MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | |
1 | 1 | |||||||
| MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | |
1 | 1 | |||||||
| MIRT051335 | PSMC4 | proteasome 26S subunit, ATPase 4 | |
1 | 1 | |||||||
| MIRT051336 | ATF2 | activating transcription factor 2 | |
1 | 1 | |||||||
| MIRT051337 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | |
1 | 1 | |||||||
| MIRT051338 | FBXO3 | F-box protein 3 | |
1 | 1 | |||||||
| MIRT051339 | PRDX3 | peroxiredoxin 3 | |
1 | 1 | |||||||
| MIRT051340 | CABIN1 | calcineurin binding protein 1 | |
1 | 1 | |||||||
| MIRT051341 | FASN | fatty acid synthase | |
1 | 3 | |||||||
| MIRT051342 | SEC63 | SEC63 homolog, protein translocation regulator | |
1 | 1 | |||||||
| MIRT051343 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
1 | 1 | |||||||
| MIRT051344 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
1 | 1 | |||||||
| MIRT051345 | FOXO1 | forkhead box O1 | |
|
|
|
4 | 2 | ||||
| MIRT051346 | TMEM214 | transmembrane protein 214 | |
1 | 1 | |||||||
| MIRT051347 | TRIM28 | tripartite motif containing 28 | |
1 | 1 | |||||||
| MIRT051348 | NOP2 | NOP2 nucleolar protein | |
1 | 1 | |||||||
| MIRT051349 | MYBL1 | MYB proto-oncogene like 1 | |
1 | 1 | |||||||
| MIRT051350 | TTC1 | tetratricopeptide repeat domain 1 | |
1 | 1 | |||||||
| MIRT051351 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
1 | 2 | |||||||
| MIRT052930 | REPIN1 | replication initiator 1 | |
|
2 | 1 | ||||||
| MIRT053079 | KLF4 | Kruppel like factor 4 | |
1 | 1 | |||||||
| MIRT054283 | YAP1 | Yes associated protein 1 | |
|
|
3 | 1 | |||||
| MIRT054424 | CARM1 | coactivator associated arginine methyltransferase 1 | |
|
|
3 | 1 | |||||
| MIRT054895 | SOX5 | SRY-box 5 | |
|
2 | 1 | ||||||
| MIRT055421 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
1 | 6 | |||||||
| MIRT055811 | PLEKHA1 | pleckstrin homology domain containing A1 | |
1 | 1 | |||||||
| MIRT057514 | CEP55 | centrosomal protein 55 | |
1 | 4 | |||||||
| MIRT057729 | ZDHHC16 | zinc finger DHHC-type containing 16 | |
1 | 1 | |||||||
| MIRT057906 | STXBP3 | syntaxin binding protein 3 | |
1 | 1 | |||||||
| MIRT061005 | C1ORF21 | chromosome 1 open reading frame 21 | |
1 | 3 | |||||||
| MIRT061244 | AMOTL1 | angiomotin like 1 | |
1 | 6 | |||||||
| MIRT061529 | BTG2 | BTG anti-proliferation factor 2 | |
1 | 1 | |||||||
| MIRT063394 | ETNK1 | ethanolamine kinase 1 | |
1 | 1 | |||||||
| MIRT065711 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | |
1 | 2 | |||||||
| MIRT066291 | MTFR1L | mitochondrial fission regulator 1 like | |
1 | 1 | |||||||
| MIRT066312 | USP15 | ubiquitin specific peptidase 15 | |
1 | 1 | |||||||
| MIRT068655 | AKAP11 | A-kinase anchoring protein 11 | |
1 | 1 | |||||||
| MIRT071206 | FCF1 | FCF1, rRNA-processing protein | |
1 | 1 | |||||||
| MIRT072822 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
1 | 3 | |||||||
| MIRT074530 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
1 | 2 | |||||||
| MIRT075249 | SNTB2 | syntrophin beta 2 | |
1 | 2 | |||||||
| MIRT075273 | VPS4A | vacuolar protein sorting 4 homolog A | |
1 | 4 | |||||||
| MIRT075891 | C16ORF72 | chromosome 16 open reading frame 72 | |
1 | 4 | |||||||
| MIRT076791 | GOSR1 | golgi SNAP receptor complex member 1 | |
1 | 1 | |||||||
| MIRT077781 | MINK1 | misshapen like kinase 1 | |
1 | 1 | |||||||
| MIRT078282 | RPS6KB1 | ribosomal protein S6 kinase B1 | |
1 | 1 | |||||||
| MIRT079655 | NAPG | NSF attachment protein gamma | |
1 | 6 | |||||||
| MIRT080011 | GALNT1 | polypeptide N-acetylgalactosaminyltransferase 1 | |
1 | 2 | |||||||
| MIRT082985 | PNPLA6 | patatin like phospholipase domain containing 6 | |
1 | 1 | |||||||
| MIRT083265 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
1 | 3 | |||||||
| MIRT084462 | SOWAHC | sosondowah ankyrin repeat domain family member C | |
1 | 2 | |||||||
| MIRT085215 | CCNT2 | cyclin T2 | |
1 | 1 | |||||||
| MIRT086005 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
1 | 1 | |||||||
| MIRT087424 | ZNRF3 | zinc and ring finger 3 | |
1 | 1 | |||||||
| MIRT087554 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | |
1 | 1 | |||||||
| MIRT088102 | SEPT2 | septin 2 | |
1 | 1 | |||||||
| MIRT089105 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | |
1 | 2 | |||||||
| MIRT089206 | ACTR2 | ARP2 actin related protein 2 homolog | |
1 | 2 | |||||||
| MIRT090446 | CDV3 | CDV3 homolog | |
1 | 1 | |||||||
| MIRT090688 | U2SURP | U2 snRNP associated SURP domain containing | |
1 | 1 | |||||||
| MIRT091667 | RARB | retinoic acid receptor beta | |
1 | 3 | |||||||
| MIRT092190 | ITPR1 | inositol 1,4,5-trisphosphate receptor type 1 | |
1 | 1 | |||||||
| MIRT092209 | BHLHE40 | basic helix-loop-helix family member e40 | |
1 | 1 | |||||||
| MIRT093682 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
1 | 3 | |||||||
| MIRT096234 | CANX | calnexin | |
1 | 1 | |||||||
| MIRT098827 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
1 | 1 | |||||||
| MIRT099631 | E2F3 | E2F transcription factor 3 | |
1 | 1 | |||||||
| MIRT100207 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
1 | 1 | |||||||
| MIRT100364 | HSPA1B | heat shock protein family A (Hsp70) member 1B | |
|
2 | 5 | ||||||
| MIRT100566 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | |
1 | 1 | |||||||
| MIRT100896 | CD2AP | CD2 associated protein | |
1 | 1 | |||||||
| MIRT102434 | CALU | calumenin | |
1 | 2 | |||||||
| MIRT102632 | UBN2 | ubinuclein 2 | |
1 | 6 | |||||||
| MIRT102971 | EN2 | engrailed homeobox 2 | |
1 | 3 | |||||||
| MIRT103092 | MAFK | MAF bZIP transcription factor K | |
1 | 3 | |||||||
| MIRT103856 | FOXK1 | forkhead box K1 | |
1 | 2 | |||||||
| MIRT104015 | USP42 | ubiquitin specific peptidase 42 | |
1 | 3 | |||||||
| MIRT106292 | ZFHX4 | zinc finger homeobox 4 | |
1 | 3 | |||||||
| MIRT106733 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | |
1 | 2 | |||||||
| MIRT107218 | ZBTB34 | zinc finger and BTB domain containing 34 | |
1 | 1 | |||||||
| MIRT108983 | SLC9A6 | solute carrier family 9 member A6 | |
1 | 1 | |||||||
| MIRT109240 | ZNF275 | zinc finger protein 275 | |
1 | 1 | |||||||
| MIRT110051 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
1 | 4 | |||||||
| MIRT112969 | LUZP1 | leucine zipper protein 1 | |
1 | 3 | |||||||
| MIRT114923 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
1 | 1 | |||||||
| MIRT117655 | SCAMP4 | secretory carrier membrane protein 4 | |
1 | 1 | |||||||
| MIRT120680 | PAK2 | p21 (RAC1) activated kinase 2 | |
1 | 1 | |||||||
| MIRT127725 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
1 | 2 | |||||||
| MIRT128798 | UBE4A | ubiquitination factor E4A | |
1 | 1 | |||||||
| MIRT129055 | ARCN1 | archain 1 | |
1 | 1 | |||||||
| MIRT130380 | PTPRJ | protein tyrosine phosphatase, receptor type J | |
1 | 1 | |||||||
| MIRT131097 | TMEM138 | transmembrane protein 138 | |
1 | 1 | |||||||
| MIRT132734 | RASSF5 | Ras association domain family member 5 | |
1 | 1 | |||||||
| MIRT132831 | MAPKAPK2 | mitogen-activated protein kinase-activated protein kinase 2 | |
1 | 1 | |||||||
| MIRT133334 | BCL7A | BCL tumor suppressor 7A | |
1 | 1 | |||||||
| MIRT133769 | SKI | SKI proto-oncogene | |
1 | 2 | |||||||
| MIRT137517 | RCOR1 | REST corepressor 1 | |
1 | 1 | |||||||
| MIRT140146 | SPRED1 | sprouty related EVH1 domain containing 1 | |
1 | 2 | |||||||
| MIRT140820 | SMAD3 | SMAD family member 3 | |
1 | 1 | |||||||
| MIRT141243 | SCAMP5 | secretory carrier membrane protein 5 | |
1 | 1 | |||||||
| MIRT141279 | UBE2Q2 | ubiquitin conjugating enzyme E2 Q2 | |
1 | 1 | |||||||
| MIRT142237 | DCTN5 | dynactin subunit 5 | |
1 | 5 | |||||||
| MIRT144019 | PSKH1 | protein serine kinase H1 | |
1 | 1 | |||||||
| MIRT145377 | ANKRD13B | ankyrin repeat domain 13B | |
1 | 1 | |||||||
| MIRT146014 | EZH1 | enhancer of zeste 1 polycomb repressive complex 2 subunit | |
1 | 1 | |||||||
| MIRT146351 | PNPO | pyridoxamine 5'-phosphate oxidase | |
1 | 1 | |||||||
| MIRT146496 | SNX11 | sorting nexin 11 | |
1 | 1 | |||||||
| MIRT148302 | RNF138 | ring finger protein 138 | |
1 | 1 | |||||||
| MIRT150354 | IER2 | immediate early response 2 | |
1 | 1 | |||||||
| MIRT152274 | TNFSF9 | TNF superfamily member 9 | |
1 | 2 | |||||||
| MIRT152503 | ENTPD6 | ectonucleoside triphosphate diphosphohydrolase 6 (putative) | |
1 | 1 | |||||||
| MIRT152736 | KIF3B | kinesin family member 3B | |
1 | 1 | |||||||
| MIRT152922 | NOL4L | nucleolar protein 4 like | |
1 | 1 | |||||||
| MIRT154043 | RASSF2 | Ras association domain family member 2 | |
1 | 1 | |||||||
| MIRT154392 | CDS2 | CDP-diacylglycerol synthase 2 | |
1 | 1 | |||||||
| MIRT156452 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | |
1 | 1 | |||||||