miRTarBase - #MIRT499456 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ODF2L   
Synonyms dJ977L11.1
Description outer dense fiber of sperm tails 2 like
Transcript NM_001007022   
Other Transcripts NM_001184765 , NM_001184766 , NM_020729   
Expression
Putative miRNA Targets on ODF2L
3'UTR of ODF2L
(miRNA target sites are highlighted)
>ODF2L|NM_001007022|3'UTR
   1 AATCTATTTTTTTAATTCCCAAGTGTCTAAAAAGTTGAAAACCTAAAAGATTCAAGAGTTAAATGATTTTTGGCATGCAC
  81 AATTTGATTTTATTGCCATCAAAAGTTTCATGACAACTTAGTCAGAACAAAACGTCGATCACCTTTAATTTAGCACAGGC
 161 CTTCCATTTATTTCTAAACTTTTTTTTAACTCACCATTTGACTTTCTGATATTGTAAAATGTGTGTGCTGTTTTTTTGTG
 241 TAATTGAAGCCTCTGAAAAAATAAATGAGGTGGGTTTTGCTGTAATGTCCCTAGTACTTGGCTAAAGCTAGTAAAATAAA
 321 TAGATCCCATTCACAATTGCCACAAAGAGAATAAAATACCTAGGAATCCAAATTACAAGGAATGTGAAGGACCTCTTCAA
 401 GGAGAACTACAAACCACTGCTTAAGGAAATAAGAGAGGACACAAACAAATGGAAAACATTCCATGCTTATGAATAAGATG
 481 AAACAAGATCATGAAAATGGCTATACTCCCCAAAGTAATTTATAGATTCAGTGCTATCCCCATCAAGCTACCATTGACTT
 561 TCTTCACAGAATTAGAAAAAACTACTTCAAATTTCATATGGAACCAAAAAAGAGCTCACATAACCAAGACAATCCTAAGC
 641 AAAAAGAACAAAGCTGTAGGCATCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAATAGCATGGTA
 721 CTGGTGCCAAAACAGATATATAGACCAATGGAACAGAACAGAGGCCTCAGAAATAACTCCACACATCTACAACCATCTGC
 801 TGTTTGACATACCTGAGAAAAACAAGAAATGGGGAAAGGATTCCCTATTTAATAAATGGTGTTGGGAAAACTGGCTAGCC
 881 ATATGCAGAAAACTGAAACTGGATCCCTTCCTTACACCTTATACAAAAATTAACTCAAGATGGATTAAAGACTTAAGTGT
 961 AAGACCTAAAACCATAAAAACCCTAGAGGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGACGAATACTTCATGA
1041 CTAAAACACCAAAAGTAATGGCAATAAAAGCCAAGATTGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCA
1121 AAAGAAACTATCATCAGAGTGAACAGGAACCGACAGAATGGGAGAAAATTTTTGCAATCTATCCATCTGACAAAGGGCCA
1201 ATATCCAGAATCTACAAAGAACTTAAACAAATTTACAAGAAAAAAAACCCCATCAAAAAGTGTGCAAAGAATATGAACAG
1281 ACACTTCTCAAGAGAAGACATTTAGTCAGCCAAAAAACATATGAAAAAAAGCTCATCACTGGTCATTCAGAGAAATGCAA
1361 ATCAAAACTACAGTGAGATACCATGTCACACCAATTAGAATGGTGATCATTAAAAAGACAGGAAACAACAGATGCTGGAG
1441 AGGATGTGGAGAAATAGGATGCTTTTACACTGTTGGTGGGAGTGTAAATTAGTTCAACCACTGCGGAAGACAGTGTGGCG
1521 ATTCCTCAAGGATCTAGAACCAGAAATACCATTTGACCCAGCAATCCCATTACTGGGTATATACCCAAAGGACTATAAAT
1601 CATGCTGCTATAGAGACACATGCACACGTATATTTATTGTGGCACTATTCACAATAGCAAAGACTTGGAGCCAACCCAAA
1681 TGCCCATCAATGATAGACTGAATAAAGAAAATGTGGCACATACACCATGGAATACTATGCAGCCATAAAAAAGGATGAGT
1761 TCATGTCCTTTGCAGGGACATGGATGAAGCTGGAAACCATCATTCTCAGCAAACTAACACAAGAACAGAAAACCAAACAC
1841 CGCATGTTCTCACTCATAAGTGGGAGTTGAACAATGAGAATACATGGATACAGGGCAGGGAACATCACACACCAGGGCCT
1921 GTCAGGGCGTGGGGGGCTAGGGGAGGGATAACATTAGAAATTCCTAATGTAGATGACGGGTTGATGAGTGCAGCAAACCA
2001 CCATGGCACGTGTATACCTATGTAACCAACCTGTACGTTCTGTACATGTATCCCAGAACTTAAAGTATAATAAAAATTAA
2081 AAAAAATAAAGATCTGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU---UGGUA-AUA-CACGACGAu 5'
            |||   ||:||  ||  ||||||| 
Target 5' ccCAAAGGACTATAAATCATGCTGCTa 3'
1584 - 1610 152.00 -16.20
2
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            :|||  || |:|||||||:| 
Target 5' tgTAAA--ATGTGTGTGCTGTTt 3'
213 - 233 148.00 -15.00
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||||   || |||||:| 
Target 5' ctacAACC---ATCTGCTGTTt 3'
787 - 805 139.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26957758 18 COSMIC
COSN30544670 43 COSMIC
COSN30528359 45 COSMIC
COSN31607449 48 COSMIC
COSN31550919 51 COSMIC
COSN31521498 76 COSMIC
COSN6471566 151 COSMIC
COSN1109470 173 COSMIC
COSN30586895 180 COSMIC
COSN29329922 212 COSMIC
COSN30511364 255 COSMIC
COSN20074012 280 COSMIC
COSN16182739 300 COSMIC
COSN6471565 477 COSMIC
COSN8512562 719 COSMIC
COSN1461716 783 COSMIC
COSN8916374 953 COSMIC
COSN23429711 1076 COSMIC
COSN16404439 1163 COSMIC
COSN5378710 1773 COSMIC
COSN32082120 1864 COSMIC
COSN14873628 2076 COSMIC
COSN8512561 2204 COSMIC
COSN28205266 2235 COSMIC
COSN28438828 2552 COSMIC
COSN6471563 2555 COSMIC
COSN19176379 2788 COSMIC
COSN15721848 2797 COSMIC
COSN27752284 2844 COSMIC
COSN23261479 2950 COSMIC
COSN30533320 3170 COSMIC
COSN30145446 3211 COSMIC
COSN24889186 3218 COSMIC
COSN15185670 3230 COSMIC
COSN30526203 3253 COSMIC
COSN30144955 3265 COSMIC
COSN30478820 3299 COSMIC
COSN31530973 3301 COSMIC
COSM7293172 3311 COSMIC
COSM8754584 3320 COSMIC
COSM2244296 3368 COSMIC
COSM267053 3377 COSMIC
COSM7748989 3382 COSMIC
COSM6732967 3384 COSMIC
COSM912751 3393 COSMIC
COSM8520419 3399 COSMIC
COSM8607551 3406 COSMIC
COSM2244295 3421 COSMIC
COSM4916125 3429 COSMIC
COSN24295313 3447 COSMIC
COSN1109469 3470 COSMIC
COSN30597570 3521 COSMIC
COSN15803690 3540 COSMIC
COSN17181754 3787 COSMIC
COSN6471562 4045 COSMIC
COSN16820301 4105 COSMIC
COSN31643093 4184 COSMIC
COSN21588534 4374 COSMIC
COSN22559937 4579 COSMIC
COSN21208767 4687 COSMIC
COSN5744981 4885 COSMIC
COSN1109468 4888 COSMIC
COSN1461715 4892 COSMIC
COSN16785867 4992 COSMIC
COSN1461714 5035 COSMIC
COSN30299622 5080 COSMIC
COSN28058565 5195 COSMIC
COSN505810 5323 COSMIC
COSN19173845 5351 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1487508512 4 dbSNP
rs1426617908 9 dbSNP
rs762446940 13 dbSNP
rs1436770997 14 dbSNP
rs1369030798 16 dbSNP
rs895021793 20 dbSNP
rs775029429 22 dbSNP
rs553599279 24 dbSNP
rs1455982541 26 dbSNP
rs1217560425 27 dbSNP
rs1353299660 34 dbSNP
rs764836366 43 dbSNP
rs76505373 48 dbSNP
rs1448620494 49 dbSNP
rs188724697 57 dbSNP
rs888564256 58 dbSNP
rs554394774 66 dbSNP
rs1314470247 75 dbSNP
rs1047170094 96 dbSNP
rs930166530 110 dbSNP
rs922856981 123 dbSNP
rs749174669 126 dbSNP
rs978349530 127 dbSNP
rs538260193 128 dbSNP
rs373569147 133 dbSNP
rs375047067 134 dbSNP
rs371856267 136 dbSNP
rs1010914862 137 dbSNP
rs1384092642 146 dbSNP
rs1345399900 153 dbSNP
rs1439878817 156 dbSNP
rs552526208 162 dbSNP
rs959726986 172 dbSNP
rs1361752659 174 dbSNP
rs532524567 184 dbSNP
rs1453480838 185 dbSNP
rs1303860178 186 dbSNP
rs1408855317 188 dbSNP
rs911437078 188 dbSNP
rs1336108822 206 dbSNP
rs1402496551 211 dbSNP
rs1377787028 212 dbSNP
rs1393257216 215 dbSNP
rs1305108697 220 dbSNP
rs551583013 221 dbSNP
rs1003950678 228 dbSNP
rs957927768 228 dbSNP
rs1298327742 234 dbSNP
rs923727542 238 dbSNP
rs1201721718 244 dbSNP
rs1242496156 262 dbSNP
rs1457803535 262 dbSNP
rs1461304507 267 dbSNP
rs977810481 269 dbSNP
rs184177966 270 dbSNP
rs1418153899 274 dbSNP
rs1177169172 280 dbSNP
rs1431933555 281 dbSNP
rs1047664619 285 dbSNP
rs1177965092 287 dbSNP
rs993437227 294 dbSNP
rs1024774358 310 dbSNP
rs1428490465 317 dbSNP
rs111815942 321 dbSNP
rs1037553042 325 dbSNP
rs1296594638 326 dbSNP
rs959336742 329 dbSNP
rs1387583696 335 dbSNP
rs1252822609 336 dbSNP
rs1195389176 337 dbSNP
rs1479774162 341 dbSNP
rs1258176114 342 dbSNP
rs1221510364 344 dbSNP
rs1262415653 348 dbSNP
rs1308074350 357 dbSNP
rs1211232202 372 dbSNP
rs1323476551 381 dbSNP
rs1205922846 383 dbSNP
rs1249128670 388 dbSNP
rs943099691 392 dbSNP
rs1261766636 400 dbSNP
rs562762669 402 dbSNP
rs1005580298 405 dbSNP
rs192129943 409 dbSNP
rs1199159423 410 dbSNP
rs1051564211 412 dbSNP
rs1390526942 422 dbSNP
rs1412191022 425 dbSNP
rs932976290 437 dbSNP
rs1304423981 440 dbSNP
rs924310338 441 dbSNP
rs1405308574 442 dbSNP
rs190275672 444 dbSNP
rs773318302 457 dbSNP
rs769895924 461 dbSNP
rs1412871024 463 dbSNP
rs966945453 470 dbSNP
rs7515651 477 dbSNP
rs1417606184 480 dbSNP
rs994261110 488 dbSNP
rs562373235 490 dbSNP
rs775767479 501 dbSNP
rs865798866 503 dbSNP
rs1041249580 506 dbSNP
rs1293418824 507 dbSNP
rs1489720923 510 dbSNP
rs1211186120 514 dbSNP
rs959603745 520 dbSNP
rs1330421013 521 dbSNP
rs1034171747 522 dbSNP
rs1185252505 530 dbSNP
rs1260847331 531 dbSNP
rs1003658617 533 dbSNP
rs1237676547 543 dbSNP
rs149193439 545 dbSNP
rs1314789198 547 dbSNP
rs1424416222 553 dbSNP
rs971116705 560 dbSNP
rs1314385073 562 dbSNP
rs1026337348 576 dbSNP
rs1453111969 582 dbSNP
rs1302280031 590 dbSNP
rs1345609108 597 dbSNP
rs1432673382 601 dbSNP
rs1286994892 612 dbSNP
rs1361197944 613 dbSNP
rs576906436 617 dbSNP
rs1245985088 622 dbSNP
rs1381703529 632 dbSNP
rs533986881 640 dbSNP
rs1334434557 645 dbSNP
rs993386467 657 dbSNP
rs1356802240 665 dbSNP
rs772038302 666 dbSNP
rs1037501064 667 dbSNP
rs1449053561 672 dbSNP
rs1214107901 679 dbSNP
rs1385549123 686 dbSNP
rs1462209047 689 dbSNP
rs367552137 699 dbSNP
rs888990825 711 dbSNP
rs1451667007 725 dbSNP
rs1051941047 726 dbSNP
rs933110905 737 dbSNP
rs746104261 739 dbSNP
rs1164387756 743 dbSNP
rs1159324440 744 dbSNP
rs1041369871 745 dbSNP
rs185599100 748 dbSNP
rs1241754532 754 dbSNP
rs540040955 758 dbSNP
rs574263390 763 dbSNP
rs1344526087 764 dbSNP
rs1453355481 765 dbSNP
rs1465786903 777 dbSNP
rs1261584903 779 dbSNP
rs12031536 790 dbSNP
rs989781656 792 dbSNP
rs796863628 798 dbSNP
rs272495 800 dbSNP
rs1246338054 806 dbSNP
rs1358282492 809 dbSNP
rs201098883 826 dbSNP
rs569109203 827 dbSNP
rs1284079639 830 dbSNP
rs982581171 832 dbSNP
rs990692984 834 dbSNP
rs970814918 838 dbSNP
rs1326983220 844 dbSNP
rs1460888320 851 dbSNP
rs558727257 851 dbSNP
rs1317465551 854 dbSNP
rs1234746905 861 dbSNP
rs1380617594 869 dbSNP
rs1468854631 875 dbSNP
rs972063639 876 dbSNP
rs985114857 881 dbSNP
rs1470157094 886 dbSNP
rs272494 887 dbSNP
rs1025662974 899 dbSNP
rs1468773614 903 dbSNP
rs1383596539 915 dbSNP
rs1329026508 917 dbSNP
rs1016589233 931 dbSNP
rs1475923424 932 dbSNP
rs867468131 934 dbSNP
rs994143573 949 dbSNP
rs1346499453 950 dbSNP
rs888930939 957 dbSNP
rs1268932180 959 dbSNP
rs1030184854 961 dbSNP
rs997639082 965 dbSNP
rs1289086794 972 dbSNP
rs1275274015 974 dbSNP
rs902940831 988 dbSNP
rs1041485431 991 dbSNP
rs1181404701 995 dbSNP
rs1269904408 997 dbSNP
rs1207038873 998 dbSNP
rs566976795 1001 dbSNP
rs547089354 1002 dbSNP
rs1054426729 1010 dbSNP
rs1477691457 1020 dbSNP
rs1167968343 1027 dbSNP
rs938295012 1028 dbSNP
rs1407743783 1044 dbSNP
rs1225235603 1051 dbSNP
rs889950577 1054 dbSNP
rs1365822093 1059 dbSNP
rs1407074108 1072 dbSNP
rs150727597 1088 dbSNP
rs1345417808 1103 dbSNP
rs1228851349 1110 dbSNP
rs1271968213 1117 dbSNP
rs567896106 1120 dbSNP
rs982310830 1130 dbSNP
rs949411556 1131 dbSNP
rs1375228111 1135 dbSNP
rs1404361055 1140 dbSNP
rs778078316 1144 dbSNP
rs1363982154 1148 dbSNP
rs753826528 1149 dbSNP
rs919339526 1151 dbSNP
rs972178397 1152 dbSNP
rs902746209 1154 dbSNP
rs551132496 1158 dbSNP
rs531155480 1161 dbSNP
rs1193761618 1163 dbSNP
rs1396305575 1166 dbSNP
rs1299701637 1177 dbSNP
rs193136353 1181 dbSNP
rs986431294 1187 dbSNP
rs917695537 1202 dbSNP
rs1479314905 1204 dbSNP
rs1426221070 1213 dbSNP
rs1301651638 1214 dbSNP
rs953327508 1216 dbSNP
rs990970050 1217 dbSNP
rs551895487 1219 dbSNP
rs1199548179 1221 dbSNP
rs1227762892 1225 dbSNP
rs1479783539 1241 dbSNP
rs909046577 1243 dbSNP
rs1183608508 1245 dbSNP
rs75262674 1247 dbSNP
rs531934371 1248 dbSNP
rs545185328 1248 dbSNP
rs903056960 1249 dbSNP
rs61804061 1251 dbSNP
rs950630846 1256 dbSNP
rs1263676729 1262 dbSNP
rs1445278485 1263 dbSNP
rs1019977818 1269 dbSNP
rs919154480 1271 dbSNP
rs1011304038 1274 dbSNP
rs892780445 1276 dbSNP
rs972755208 1282 dbSNP
rs1055477964 1284 dbSNP
rs1454574484 1287 dbSNP
rs1160721978 1302 dbSNP
rs1383425809 1310 dbSNP
rs938229221 1311 dbSNP
rs1435075844 1312 dbSNP
rs1337436963 1316 dbSNP
rs773168595 1319 dbSNP
rs1047126499 1320 dbSNP
rs1263639832 1322 dbSNP
rs760150886 1323 dbSNP
rs1019733313 1328 dbSNP
rs1239496840 1331 dbSNP
rs1343656032 1331 dbSNP
rs1454437887 1331 dbSNP
rs949525285 1335 dbSNP
rs1208071613 1338 dbSNP
rs1007390582 1340 dbSNP
rs559835403 1344 dbSNP
rs769630274 1345 dbSNP
rs116206370 1352 dbSNP
rs1335368715 1355 dbSNP
rs909178863 1358 dbSNP
rs1184404869 1360 dbSNP
rs1416477307 1362 dbSNP
rs986149074 1365 dbSNP
rs902798227 1369 dbSNP
rs1408957030 1370 dbSNP
rs1468236502 1374 dbSNP
rs1302400929 1379 dbSNP
rs1176260040 1382 dbSNP
rs1374310192 1384 dbSNP
rs1042606917 1401 dbSNP
rs1013240029 1412 dbSNP
rs953540283 1416 dbSNP
rs1227577608 1425 dbSNP
rs187833587 1443 dbSNP
rs184545153 1446 dbSNP
rs1159763494 1455 dbSNP
rs1054763883 1457 dbSNP
rs937771547 1464 dbSNP
rs544388365 1475 dbSNP
rs1470335358 1476 dbSNP
rs1248006977 1479 dbSNP
rs375197082 1480 dbSNP
rs545120550 1480 dbSNP
rs1200606528 1486 dbSNP
rs975998460 1490 dbSNP
rs967165453 1495 dbSNP
rs1462436719 1497 dbSNP
rs1355226718 1504 dbSNP
rs1020092210 1505 dbSNP
rs1243689264 1516 dbSNP
rs191630586 1519 dbSNP
rs1321333154 1520 dbSNP
rs1408989402 1536 dbSNP
rs957151735 1541 dbSNP
rs1034391081 1545 dbSNP
rs1283758913 1549 dbSNP
rs919208274 1558 dbSNP
rs1217448630 1559 dbSNP
rs1001206797 1563 dbSNP
rs1307518241 1568 dbSNP
rs111445636 1569 dbSNP
rs906897621 1573 dbSNP
rs1482561361 1576 dbSNP
rs912563704 1581 dbSNP
rs1046671188 1593 dbSNP
rs1013870096 1594 dbSNP
rs897974647 1595 dbSNP
rs1430319914 1606 dbSNP
rs1168512314 1607 dbSNP
rs558773836 1610 dbSNP
rs942051563 1616 dbSNP
rs1303505043 1623 dbSNP
rs909294049 1627 dbSNP
rs1050977085 1628 dbSNP
rs1001018030 1630 dbSNP
rs966842621 1637 dbSNP
rs931986385 1639 dbSNP
rs1021202722 1642 dbSNP
rs1340992286 1649 dbSNP
rs538680882 1650 dbSNP
rs1293526590 1652 dbSNP
rs573242639 1655 dbSNP
rs1391438788 1670 dbSNP
rs553391271 1671 dbSNP
rs967280491 1681 dbSNP
rs1487172332 1683 dbSNP
rs536775128 1684 dbSNP
rs913032498 1691 dbSNP
rs187222035 1693 dbSNP
rs550934539 1698 dbSNP
rs1445353926 1700 dbSNP
rs1165655202 1702 dbSNP
rs1001858368 1712 dbSNP
rs1403323572 1713 dbSNP
rs887549044 1716 dbSNP
rs1048832675 1717 dbSNP
rs929161626 1719 dbSNP
rs957472545 1725 dbSNP
rs919093703 1727 dbSNP
rs1034095778 1729 dbSNP
rs1001721460 1737 dbSNP
rs1452752345 1740 dbSNP
rs1446071208 1743 dbSNP
rs944635796 1744 dbSNP
rs910448757 1745 dbSNP
rs537612466 1747 dbSNP
rs1023997077 1753 dbSNP
rs1182723322 1753 dbSNP
rs1268079073 1757 dbSNP
rs1013819316 1763 dbSNP
rs985888462 1767 dbSNP
rs898089351 1768 dbSNP
rs144285412 1771 dbSNP
rs1006379929 1772 dbSNP
rs1181045823 1772 dbSNP
rs979484752 1773 dbSNP
rs1282223977 1780 dbSNP
rs1387829967 1782 dbSNP
rs1469805054 1802 dbSNP
rs887970850 1820 dbSNP
rs1338205920 1823 dbSNP
rs552022471 1834 dbSNP
rs4497186 1838 dbSNP
rs559750102 1839 dbSNP
rs901822092 1841 dbSNP
rs1314851371 1842 dbSNP
rs1226959324 1843 dbSNP
rs1288200280 1844 dbSNP
rs1040359629 1845 dbSNP
rs1205627208 1850 dbSNP
rs1276645929 1856 dbSNP
rs1442026751 1860 dbSNP
rs1205437424 1865 dbSNP
rs1234832424 1866 dbSNP
rs1473414870 1867 dbSNP
rs1179750281 1874 dbSNP
rs1244174319 1881 dbSNP
rs1368011224 1891 dbSNP
rs992262675 1892 dbSNP
rs945927586 1897 dbSNP
rs1413437072 1898 dbSNP
rs35166283 1901 dbSNP
rs1430843507 1902 dbSNP
rs546166453 1905 dbSNP
rs1344150268 1911 dbSNP
rs767060274 1913 dbSNP
rs1408385504 1914 dbSNP
rs1315608048 1915 dbSNP
rs1033920770 1917 dbSNP
rs1002309074 1921 dbSNP
rs887446580 1928 dbSNP
rs754389191 1929 dbSNP
rs935837077 1931 dbSNP
rs927144582 1934 dbSNP
rs529783612 1936 dbSNP
rs1027282988 1937 dbSNP
rs1250857421 1937 dbSNP
rs993255696 1948 dbSNP
rs897551359 1967 dbSNP
rs182899058 1977 dbSNP
rs1168059387 1978 dbSNP
rs1391619491 1980 dbSNP
rs762072744 1985 dbSNP
rs1187092376 1986 dbSNP
rs1475038729 1987 dbSNP
rs944540372 1994 dbSNP
rs1388910048 2003 dbSNP
rs1023946176 2007 dbSNP
rs1050358540 2009 dbSNP
rs1272057511 2010 dbSNP
rs544083650 2012 dbSNP
rs925290900 2014 dbSNP
rs867118382 2017 dbSNP
rs979371796 2020 dbSNP
rs1211420721 2026 dbSNP
rs1265180304 2028 dbSNP
rs961063056 2036 dbSNP
rs1015169307 2037 dbSNP
rs1006906659 2042 dbSNP
rs575370909 2045 dbSNP
rs1187486950 2046 dbSNP
rs1385487780 2049 dbSNP
rs1309574939 2050 dbSNP
rs1296722709 2066 dbSNP
rs1161893706 2067 dbSNP
rs774476432 2068 dbSNP
rs1214568114 2071 dbSNP
rs1029588302 2074 dbSNP
rs1360458904 2077 dbSNP
rs1275815023 2078 dbSNP
rs996240355 2084 dbSNP
rs751247418 2086 dbSNP
rs1302075575 2087 dbSNP
rs1315922539 2087 dbSNP
rs1363064329 2087 dbSNP
rs960894560 2087 dbSNP
rs1422343251 2088 dbSNP
rs1342559218 2090 dbSNP
rs1246699873 2091 dbSNP
rs1356125880 2091 dbSNP
rs1263508850 2093 dbSNP
rs1355519238 2104 dbSNP
rs1040474960 2106 dbSNP
rs565049673 2114 dbSNP
rs1269963880 2115 dbSNP
rs891827716 2129 dbSNP
rs545358293 2130 dbSNP
rs1463118157 2139 dbSNP
rs1187391388 2144 dbSNP
rs1054361306 2148 dbSNP
rs1425245171 2153 dbSNP
rs1185836763 2156 dbSNP
rs1368219439 2165 dbSNP
rs981047181 2170 dbSNP
rs1409353489 2171 dbSNP
rs952360412 2182 dbSNP
rs1456771995 2188 dbSNP
rs1337538286 2200 dbSNP
rs1404591512 2213 dbSNP
rs573155176 2215 dbSNP
rs1027338444 2219 dbSNP
rs1312314928 2221 dbSNP
rs927122000 2222 dbSNP
rs980352242 2233 dbSNP
rs765911728 2243 dbSNP
rs768775461 2246 dbSNP
rs1290062478 2254 dbSNP
rs897603838 2273 dbSNP
rs1207534945 2280 dbSNP
rs949793700 2288 dbSNP
rs115313988 2291 dbSNP
rs190711130 2293 dbSNP
rs1255068320 2298 dbSNP
rs1050645872 2301 dbSNP
rs536972499 2302 dbSNP
rs1252300476 2304 dbSNP
rs557380394 2314 dbSNP
rs1464626819 2317 dbSNP
rs1306295925 2332 dbSNP
rs1302422198 2341 dbSNP
rs147170768 2350 dbSNP
rs188483287 2352 dbSNP
rs1265502434 2360 dbSNP
rs1309680173 2367 dbSNP
rs1224828712 2371 dbSNP
rs1348528126 2381 dbSNP
rs1345654803 2382 dbSNP
rs76940920 2384 dbSNP
rs1384755277 2385 dbSNP
rs1313384626 2412 dbSNP
rs1029123603 2426 dbSNP
rs1298553694 2431 dbSNP
rs1056548008 2432 dbSNP
rs1352692392 2438 dbSNP
rs535013679 2440 dbSNP
rs1470242702 2445 dbSNP
rs1482952404 2447 dbSNP
rs1200718252 2454 dbSNP
rs1270110699 2463 dbSNP
rs902054416 2465 dbSNP
rs926818188 2477 dbSNP
rs1175532301 2479 dbSNP
rs1373842209 2484 dbSNP
rs35261823 2495 dbSNP
rs1010301298 2515 dbSNP
rs1174328876 2517 dbSNP
rs1409006489 2523 dbSNP
rs546226945 2528 dbSNP
rs1293975988 2530 dbSNP
rs1369723677 2534 dbSNP
rs952293633 2538 dbSNP
rs920830863 2540 dbSNP
rs272493 2555 dbSNP
rs1272073565 2562 dbSNP
rs1054879645 2563 dbSNP
rs17129078 2571 dbSNP
rs1267748667 2576 dbSNP
rs905780450 2587 dbSNP
rs550617436 2595 dbSNP
rs183985623 2610 dbSNP
rs1177024491 2625 dbSNP
rs1262563208 2626 dbSNP
rs949849715 2630 dbSNP
rs1186850365 2634 dbSNP
rs1389790786 2635 dbSNP
rs1428864385 2650 dbSNP
rs917108670 2655 dbSNP
rs1036757453 2659 dbSNP
rs1165291484 2661 dbSNP
rs1479826263 2665 dbSNP
rs1456370658 2666 dbSNP
rs1245339720 2671 dbSNP
rs1365230653 2672 dbSNP
rs1436660052 2675 dbSNP
rs1294859416 2686 dbSNP
rs953215739 2690 dbSNP
rs1229230315 2695 dbSNP
rs939763944 2696 dbSNP
rs1320411825 2697 dbSNP
rs1000416816 2703 dbSNP
rs759484113 2709 dbSNP
rs1466259248 2715 dbSNP
rs1206981010 2722 dbSNP
rs984194103 2724 dbSNP
rs1473277063 2745 dbSNP
rs1262015267 2749 dbSNP
rs953776281 2753 dbSNP
rs1182205919 2757 dbSNP
rs774664363 2766 dbSNP
rs777405533 2767 dbSNP
rs1163921349 2774 dbSNP
rs1389289233 2798 dbSNP
rs1458351775 2800 dbSNP
rs1318017706 2809 dbSNP
rs975052224 2817 dbSNP
rs1285624250 2820 dbSNP
rs1377364859 2820 dbSNP
rs892469043 2820 dbSNP
rs966165870 2823 dbSNP
rs1318384802 2828 dbSNP
rs1019089989 2837 dbSNP
rs1307181413 2840 dbSNP
rs423991 2852 dbSNP
rs1374458722 2857 dbSNP
rs956134150 2858 dbSNP
rs1338450296 2860 dbSNP
rs1032976955 2864 dbSNP
rs545224502 2886 dbSNP
rs1482113681 2888 dbSNP
rs559646162 2890 dbSNP
rs1473557631 2892 dbSNP
rs543047752 2893 dbSNP
rs1405238303 2904 dbSNP
rs1301195041 2911 dbSNP
rs573951538 2912 dbSNP
rs1044683977 2919 dbSNP
rs1335715222 2924 dbSNP
rs1357139333 2930 dbSNP
rs1447748573 2944 dbSNP
rs1309072011 2946 dbSNP
rs1364608532 2946 dbSNP
rs1158586606 2950 dbSNP
rs1014196913 2954 dbSNP
rs11476580 2954 dbSNP
rs796205883 2954 dbSNP
rs895621645 2959 dbSNP
rs1276763134 2967 dbSNP
rs1311887513 2978 dbSNP
rs1209856835 2981 dbSNP
rs1252319259 2981 dbSNP
rs1036872092 2986 dbSNP
rs1179861757 2992 dbSNP
rs1232247112 2993 dbSNP
rs1478068135 2995 dbSNP
rs557188411 3006 dbSNP
rs1173880477 3008 dbSNP
rs1422594091 3012 dbSNP
rs1433757920 3013 dbSNP
rs939711486 3019 dbSNP
rs911571363 3020 dbSNP
rs1408403943 3028 dbSNP
rs1307893434 3034 dbSNP
rs1332243601 3036 dbSNP
rs1184564493 3055 dbSNP
rs1438683247 3055 dbSNP
rs909620469 3057 dbSNP
rs1461280172 3067 dbSNP
rs1481762724 3075 dbSNP
rs1241792880 3076 dbSNP
rs1202764639 3077 dbSNP
rs1048176654 3078 dbSNP
rs932296948 3083 dbSNP
rs987517224 3086 dbSNP
rs1486528004 3087 dbSNP
rs1244433998 3088 dbSNP
rs953178851 3091 dbSNP
rs1188741576 3092 dbSNP
rs1391638854 3101 dbSNP
rs1260789181 3110 dbSNP
rs1237964390 3115 dbSNP
rs1167754849 3116 dbSNP
rs1351013966 3123 dbSNP
rs1407609841 3124 dbSNP
rs1316961067 3126 dbSNP
rs920963728 3127 dbSNP
rs1435923268 3129 dbSNP
rs272492 3131 dbSNP
rs1381988012 3132 dbSNP
rs966281992 3133 dbSNP
rs1269420387 3143 dbSNP
rs1356825502 3149 dbSNP
rs1211517636 3150 dbSNP
rs1000017063 3153 dbSNP
rs1467587703 3159 dbSNP
rs968519907 3167 dbSNP
rs1020035188 3169 dbSNP
rs1384012296 3172 dbSNP
rs912028391 3179 dbSNP
rs272491 3186 dbSNP
rs1369368791 3187 dbSNP
rs1473990833 3190 dbSNP
rs956249668 3197 dbSNP
rs1161915806 3206 dbSNP
rs1033495991 3209 dbSNP
rs1457830364 3210 dbSNP
rs1000306890 3212 dbSNP
rs1254622006 3213 dbSNP
rs1386690575 3214 dbSNP
rs1381824275 3217 dbSNP
rs1035047311 3220 dbSNP
rs1003937378 3221 dbSNP
rs1418151703 3224 dbSNP
rs970437411 3228 dbSNP
rs1045549176 3230 dbSNP
rs1334143752 3233 dbSNP
rs1022977368 3238 dbSNP
rs1269515127 3242 dbSNP
rs899336273 3253 dbSNP
rs1164644433 3254 dbSNP
rs1444318603 3256 dbSNP
rs1036499404 3260 dbSNP
rs776239750 3266 dbSNP
rs1245911877 3267 dbSNP
rs1417748907 3271 dbSNP
rs1190307851 3273 dbSNP
rs1448889945 3275 dbSNP
rs1262712865 3276 dbSNP
rs770769574 3279 dbSNP
rs763215464 3281 dbSNP
rs1267726991 3282 dbSNP
rs1409789729 3287 dbSNP
rs1332099154 3299 dbSNP
rs773543285 3299 dbSNP
rs1247413063 3300 dbSNP
rs1342108838 3307 dbSNP
rs192094466 3310 dbSNP
rs1404706799 3311 dbSNP
rs895737806 3315 dbSNP
rs868257419 3316 dbSNP
rs1015558420 3319 dbSNP
rs1397552332 3326 dbSNP
rs773194222 3328 dbSNP
rs1322552307 3342 dbSNP
rs1299528358 3343 dbSNP
rs772190719 3343 dbSNP
rs1419817844 3346 dbSNP
rs749360046 3349 dbSNP
rs534876020 3353 dbSNP
rs756368932 3361 dbSNP
rs566039482 3368 dbSNP
rs769944900 3368 dbSNP
rs373791078 3369 dbSNP
rs781353934 3378 dbSNP
rs757645108 3381 dbSNP
rs751937551 3384 dbSNP
rs764651030 3386 dbSNP
rs1048601074 3388 dbSNP
rs758942827 3390 dbSNP
rs752161248 3391 dbSNP
rs764749631 3400 dbSNP
rs1346754597 3401 dbSNP
rs376059730 3404 dbSNP
rs748251656 3405 dbSNP
rs759130767 3419 dbSNP
rs555592277 3421 dbSNP
rs766010008 3424 dbSNP
rs760502942 3427 dbSNP
rs772926019 3428 dbSNP
rs772106732 3429 dbSNP
rs144355767 3430 dbSNP
rs775665581 3440 dbSNP
rs770008545 3442 dbSNP
rs746010575 3444 dbSNP
rs781473590 3449 dbSNP
rs781185857 3451 dbSNP
rs771118319 3459 dbSNP
rs1194441810 3460 dbSNP
rs186066009 3463 dbSNP
rs768581172 3468 dbSNP
rs746952094 3472 dbSNP
rs778139650 3475 dbSNP
rs758853045 3485 dbSNP
rs1424247320 3493 dbSNP
rs113732309 3506 dbSNP
rs970174519 3516 dbSNP
rs1309702109 3520 dbSNP
rs1371179359 3521 dbSNP
rs978483911 3523 dbSNP
rs1169976638 3526 dbSNP
rs1462990215 3545 dbSNP
rs1372961563 3558 dbSNP
rs1231562483 3567 dbSNP
rs1332350894 3567 dbSNP
rs180852119 3568 dbSNP
rs968404219 3587 dbSNP
rs1343238918 3591 dbSNP
rs1207827351 3599 dbSNP
rs1476518190 3602 dbSNP
rs12742411 3604 dbSNP
rs1270617421 3606 dbSNP
rs189945759 3612 dbSNP
rs1480621546 3617 dbSNP
rs1199774900 3634 dbSNP
rs1022939046 3635 dbSNP
rs1020087304 3642 dbSNP
rs1490074438 3653 dbSNP
rs988579876 3659 dbSNP
rs960008581 3664 dbSNP
rs992821019 3686 dbSNP
rs530680177 3690 dbSNP
rs960067863 3692 dbSNP
rs1170317617 3694 dbSNP
rs1015501364 3696 dbSNP
rs35381541 3698 dbSNP
rs1250623237 3702 dbSNP
rs1216888224 3703 dbSNP
rs1325825793 3714 dbSNP
rs1283995941 3715 dbSNP
rs1302234817 3717 dbSNP
rs1365550639 3742 dbSNP
rs1004160650 3756 dbSNP
rs888248078 3759 dbSNP
rs571245406 3763 dbSNP
rs1026836725 3771 dbSNP
rs1222884583 3779 dbSNP
rs1329542113 3793 dbSNP
rs540554909 3797 dbSNP
rs996960156 3825 dbSNP
rs1023599080 3828 dbSNP
rs1392292187 3833 dbSNP
rs899586700 3834 dbSNP
rs994932989 3835 dbSNP
rs551611688 3841 dbSNP
rs116527427 3846 dbSNP
rs940824102 3859 dbSNP
rs559707055 3868 dbSNP
rs1459406043 3869 dbSNP
rs1324696691 3872 dbSNP
rs890745352 3873 dbSNP
rs1052441387 3874 dbSNP
rs1286773749 3875 dbSNP
rs1361626223 3881 dbSNP
rs185561334 3882 dbSNP
rs921601889 3884 dbSNP
rs112038708 3886 dbSNP
rs1232727233 3890 dbSNP
rs892163521 3892 dbSNP
rs1466327627 3894 dbSNP
rs181291473 3903 dbSNP
rs1213837120 3920 dbSNP
rs1053273313 3922 dbSNP
rs934948821 3934 dbSNP
rs563728723 3940 dbSNP
rs1485420089 3942 dbSNP
rs926076274 3946 dbSNP
rs1182296083 3958 dbSNP
rs1244577614 3959 dbSNP
rs756138218 3960 dbSNP
rs1164170429 3961 dbSNP
rs978962334 3981 dbSNP
rs543449900 3985 dbSNP
rs915995597 3993 dbSNP
rs1183726868 3998 dbSNP
rs992936925 3999 dbSNP
rs781503134 4010 dbSNP
rs578076652 4013 dbSNP
rs908557093 4023 dbSNP
rs1449193388 4027 dbSNP
rs1305008964 4028 dbSNP
rs564198113 4034 dbSNP
rs368226092 4035 dbSNP
rs1289540304 4044 dbSNP
rs56201191 4045 dbSNP
rs1027198568 4056 dbSNP
rs980432157 4060 dbSNP
rs1210526866 4062 dbSNP
rs996682046 4077 dbSNP
rs1222931276 4081 dbSNP
rs1484578262 4083 dbSNP
rs1187060982 4089 dbSNP
rs963884027 4092 dbSNP
rs1470874937 4102 dbSNP
rs2275000 4104 dbSNP
rs555526989 4105 dbSNP
rs1240230029 4108 dbSNP
rs1335607452 4113 dbSNP
rs1015007145 4136 dbSNP
rs1175158512 4141 dbSNP
rs190185467 4157 dbSNP
rs892109782 4169 dbSNP
rs2274999 4177 dbSNP
rs1352929610 4178 dbSNP
rs1407412742 4187 dbSNP
rs1440089987 4198 dbSNP
rs1051905389 4199 dbSNP
rs758185504 4201 dbSNP
rs373214951 4204 dbSNP
rs1422636283 4210 dbSNP
rs1278468219 4222 dbSNP
rs35378378 4224 dbSNP
rs1345383077 4228 dbSNP
rs556960815 4233 dbSNP
rs1209974126 4241 dbSNP
rs1275245172 4249 dbSNP
rs904767213 4252 dbSNP
rs11803763 4264 dbSNP
rs948897341 4269 dbSNP
rs913019141 4271 dbSNP
rs1470305373 4276 dbSNP
rs1052800989 4280 dbSNP
rs1392953058 4292 dbSNP
rs916110317 4297 dbSNP
rs1379497259 4298 dbSNP
rs1057209702 4310 dbSNP
rs1176522172 4310 dbSNP
rs938766030 4320 dbSNP
rs908502509 4323 dbSNP
rs982810506 4324 dbSNP
rs1209513400 4328 dbSNP
rs1328804507 4337 dbSNP
rs1440717423 4346 dbSNP
rs1350479839 4350 dbSNP
rs1438705493 4363 dbSNP
rs928468519 4364 dbSNP
rs979934072 4369 dbSNP
rs970399681 4370 dbSNP
rs1298112245 4377 dbSNP
rs1341247095 4378 dbSNP
rs919826759 4383 dbSNP
rs185334176 4393 dbSNP
rs1215086009 4399 dbSNP
rs919849274 4403 dbSNP
rs1467785714 4413 dbSNP
rs35846740 4422 dbSNP
rs370086453 4422 dbSNP
rs1375095870 4433 dbSNP
rs975757068 4434 dbSNP
rs1307555804 4444 dbSNP
rs534829853 4455 dbSNP
rs963820349 4458 dbSNP
rs565914812 4475 dbSNP
rs1167770257 4479 dbSNP
rs1384184457 4495 dbSNP
rs1415236435 4500 dbSNP
rs1463063156 4518 dbSNP
rs1324022403 4521 dbSNP
rs1393978148 4525 dbSNP
rs1436036321 4541 dbSNP
rs1314889806 4565 dbSNP
rs1005385655 4567 dbSNP
rs74539436 4568 dbSNP
rs1269508722 4572 dbSNP
rs1356996698 4574 dbSNP
rs1234560431 4575 dbSNP
rs1270691333 4575 dbSNP
rs1030933707 4592 dbSNP
rs1319681183 4593 dbSNP
rs1208906881 4594 dbSNP
rs996339643 4595 dbSNP
rs1445628881 4597 dbSNP
rs945728369 4598 dbSNP
rs1007895358 4608 dbSNP
rs956465293 4611 dbSNP
rs1163441089 4619 dbSNP
rs1417192887 4621 dbSNP
rs1457848556 4623 dbSNP
rs1160508552 4629 dbSNP
rs1031202933 4637 dbSNP
rs529233139 4638 dbSNP
rs1174202960 4640 dbSNP
rs1446163320 4655 dbSNP
rs1458556854 4661 dbSNP
rs1011236953 4663 dbSNP
rs117783135 4667 dbSNP
rs903540525 4669 dbSNP
rs1354200936 4671 dbSNP
rs1228537476 4688 dbSNP
rs148035695 4691 dbSNP
rs1243961340 4694 dbSNP
rs1204882983 4696 dbSNP
rs938445335 4705 dbSNP
rs928382162 4706 dbSNP
rs1486870334 4707 dbSNP
rs1186353440 4709 dbSNP
rs750092875 4710 dbSNP
rs894624018 4713 dbSNP
rs1184138046 4716 dbSNP
rs1044646177 4719 dbSNP
rs948571312 4722 dbSNP
rs919879191 4723 dbSNP
rs112684281 4727 dbSNP
rs1310984536 4728 dbSNP
rs938713508 4728 dbSNP
rs1360686484 4730 dbSNP
rs79860911 4737 dbSNP
rs182394615 4738 dbSNP
rs1308563287 4739 dbSNP
rs907888405 4741 dbSNP
rs1364671503 4742 dbSNP
rs1047627936 4749 dbSNP
rs1303710173 4751 dbSNP
rs1350418584 4752 dbSNP
rs983448216 4752 dbSNP
rs954981763 4764 dbSNP
rs190405101 4770 dbSNP
rs1198113059 4772 dbSNP
rs975351551 4787 dbSNP
rs964847345 4788 dbSNP
rs1339453829 4801 dbSNP
rs931310505 4817 dbSNP
rs1171574753 4819 dbSNP
rs1021709095 4833 dbSNP
rs1295903569 4834 dbSNP
rs919948182 4840 dbSNP
rs1393619072 4849 dbSNP
rs1390317723 4851 dbSNP
rs1326163852 4856 dbSNP
rs1372786352 4866 dbSNP
rs1232512780 4869 dbSNP
rs975336061 4876 dbSNP
rs753832100 4880 dbSNP
rs912362986 4881 dbSNP
rs986589838 4886 dbSNP
rs956579508 4894 dbSNP
rs1002525864 4895 dbSNP
rs1163774516 4897 dbSNP
rs1030732883 4900 dbSNP
rs1214455951 4901 dbSNP
rs574255804 4902 dbSNP
rs1044147587 4903 dbSNP
rs1421516303 4912 dbSNP
rs948410060 4914 dbSNP
rs898337812 4924 dbSNP
rs1428914429 4939 dbSNP
rs1187187308 4940 dbSNP
rs1038180361 4945 dbSNP
rs1461024110 4946 dbSNP
rs989860788 4961 dbSNP
rs554218087 4965 dbSNP
rs572187648 4966 dbSNP
rs1438197629 4977 dbSNP
rs1261103864 4979 dbSNP
rs561994207 4984 dbSNP
rs1363006268 4990 dbSNP
rs967711481 4991 dbSNP
rs1490565792 4992 dbSNP
rs1246540410 4993 dbSNP
rs1219762513 4996 dbSNP
rs1309816727 4997 dbSNP
rs1294037293 5000 dbSNP
rs1023739511 5006 dbSNP
rs1307477847 5007 dbSNP
rs939937805 5009 dbSNP
rs149335351 5012 dbSNP
rs983886213 5013 dbSNP
rs1316825587 5016 dbSNP
rs1213240398 5021 dbSNP
rs894736772 5027 dbSNP
rs1242920406 5035 dbSNP
rs1486069896 5042 dbSNP
rs576683062 5045 dbSNP
rs1275755705 5047 dbSNP
rs1298284655 5050 dbSNP
rs1035978323 5066 dbSNP
rs1406437461 5087 dbSNP
rs1259535830 5088 dbSNP
rs556533230 5092 dbSNP
rs1165588981 5113 dbSNP
rs933328812 5114 dbSNP
rs1459415721 5115 dbSNP
rs1163749828 5117 dbSNP
rs760629664 5125 dbSNP
rs1433944907 5127 dbSNP
rs934488101 5127 dbSNP
rs1361740972 5131 dbSNP
rs1415886415 5139 dbSNP
rs1295672919 5140 dbSNP
rs775578048 5141 dbSNP
rs1047126891 5145 dbSNP
rs1232822358 5152 dbSNP
rs537072409 5164 dbSNP
rs1285202594 5166 dbSNP
rs577678869 5172 dbSNP
rs1213954561 5180 dbSNP
rs1171122203 5183 dbSNP
rs931409220 5186 dbSNP
rs1258684725 5187 dbSNP
rs1487846408 5194 dbSNP
rs770237232 5197 dbSNP
rs1465032560 5200 dbSNP
rs1259609041 5201 dbSNP
rs1473929918 5203 dbSNP
rs1180820485 5213 dbSNP
rs545824672 5214 dbSNP
rs1040119683 5216 dbSNP
rs1156527166 5219 dbSNP
rs942739996 5222 dbSNP
rs774341061 5225 dbSNP
rs956316305 5226 dbSNP
rs912477438 5230 dbSNP
rs557769315 5231 dbSNP
rs71662157 5243 dbSNP
rs1481791086 5244 dbSNP
rs1233805916 5249 dbSNP
rs1198647839 5250 dbSNP
rs1023017656 5252 dbSNP
rs1352706216 5261 dbSNP
rs1211401510 5267 dbSNP
rs577722248 5287 dbSNP
rs1282348806 5290 dbSNP
rs1484671050 5291 dbSNP
rs935152868 5292 dbSNP
rs1255666764 5293 dbSNP
rs1224747929 5295 dbSNP
rs1175052022 5309 dbSNP
rs1379374117 5311 dbSNP
rs923784423 5315 dbSNP
rs1300110250 5320 dbSNP
rs898223439 5327 dbSNP
rs763168317 5328 dbSNP
rs1254614713 5331 dbSNP
rs1375312639 5349 dbSNP
rs1330160986 5351 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUU---UGGUA-AUA-CACGACGAu 5'
            |||   ||:||  ||  ||||||| 
Target 5' -cCAAAGGACUAUAAAUCAUGCUGCUa 3'
1 - 26
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000359242.3 | 3UTR | CCAAAGGACUAUAAAUCAUGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000359242.3 | 3UTR | UAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000359242.3 | 3UTR | AAAGGACUAUAAAUCAUGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000359242.3 | 3UTR | AAAUACCAUUUGACCCAGCAAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000359242.3 | 3UTR | UAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.752 1.8e-5 -0.707 8.1e-5 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.711 2.2e-4 -0.671 6.0e-4 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.623 1.7e-3 0.776 2.9e-5 20 Click to see details
GSE21032 Prostate cancer 0.269 7.0e-3 0.248 1.2e-2 83 Click to see details
GSE32688 Pancreatic cancer 0.43 7.0e-3 0.490 2.2e-3 32 Click to see details
GSE38226 Liver fibrosis -0.499 1.1e-2 -0.390 4.0e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.421 2.0e-2 0.320 6.4e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.246 2.5e-2 0.218 4.2e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.516 4.3e-2 0.490 5.3e-2 12 Click to see details
GSE28260 Renal cortex and medulla -0.397 9.0e-2 -0.324 1.4e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.218 1.5e-1 -0.019 4.6e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.092 1.9e-1 0.082 2.2e-1 90 Click to see details
GSE19536 Breast cancer -0.084 2.0e-1 -0.064 2.6e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.136 2.6e-1 0.050 4.1e-1 25 Click to see details
GSE19783 ER- ER- breast cancer 0.071 2.7e-1 0.093 2.1e-1 79 Click to see details
GSE21849 B cell lymphoma -0.082 3.4e-1 -0.003 4.9e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.108 3.5e-1 0.165 2.7e-1 16 Click to see details
GSE28544 Breast cancer -0.059 3.9e-1 -0.390 3.0e-2 24 Click to see details
GSE17306 Multiple myeloma 0.027 4.3e-1 0.031 4.2e-1 49 Click to see details
GSE17306 Multiple myeloma 0.027 4.3e-1 0.031 4.2e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.252 0.01 -0.220 0.02 84 Click to see details
CHOL 0.721 0.01 0.600 0.04 9 Click to see details
THCA 0.244 0.03 0.188 0.08 59 Click to see details
BLCA 0.415 0.04 0.304 0.11 18 Click to see details
PRAD 0.199 0.08 0.135 0.17 50 Click to see details
PAAD 0.755 0.12 0.400 0.3 4 Click to see details
KIRC 0.14 0.13 0.199 0.05 68 Click to see details
UCEC -0.215 0.19 -0.154 0.26 19 Click to see details
STAD -0.158 0.19 -0.189 0.15 32 Click to see details
KICH 0.163 0.22 0.187 0.19 25 Click to see details
LIHC 0.089 0.27 -0.001 0.5 49 Click to see details
LUAD 0.191 0.28 0.056 0.43 12 Click to see details
KIRP 0.104 0.29 0.146 0.21 32 Click to see details
COAD -0.202 0.32 -0.429 0.14 8 Click to see details
HNSC 0.067 0.34 0.100 0.26 42 Click to see details
PCPG -0.393 0.37 -0.500 0.33 3 Click to see details
LUSC -0.029 0.43 -0.085 0.31 38 Click to see details
ESCA 0.027 0.47 0.155 0.32 11 Click to see details
CESC -0.088 0.47 -0.500 0.33 3 Click to see details
CESC -0.088 0.47 -0.500 0.33 3 Click to see details
CESC -0.088 0.47 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1