miRTarBase - #MIRT498984 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ORC4   
Synonyms ORC4L, ORC4P
Description origin recognition complex subunit 4
Transcript NM_002552   
Other Transcripts NM_181741 , NM_181742   
Expression
Putative miRNA Targets on ORC4
3'UTR of ORC4
(miRNA target sites are highlighted)
>ORC4|NM_002552|3'UTR
   1 ATATAACCAGTGACTTCAACTTTGGCATTTCATTCATACTTCTGTAGAGAACGGAAAACTATTGTCCATTAACATGATAT
  81 GCTAAACATTCTATAAACATTCTTGTATTTATGTGAGACTTGCCCATCTACTGTCTTGGCTGTGTCTTGCCTTTTAATCA
 161 TGAACAGTTACATGATTTATAATTTCACTGATTGAGATTACTTTGTAAGTAGCTGTTCAGAAGAATAAAATATGACTGTT
 241 TTAGGGACTAGACCATGTGCTTTTTTAACACTTATATATATAATGGTCTATTTGAAGAGCTCACTTCAACCTAACAGCTA
 321 GATGTCTTTACAAACCTTAAACCAAAGGAGTAAAAAAAACAATGGTAAGCACTGAAGTATAATAAGTAACCTTTGGTACA
 401 GCAGGTTTGCTGCAGTGTTTTTTTCTGTCCACATGCAAATTTTGGATTCTATCCCAGACCCAGGTTTTCTAGTTCAGAAG
 481 ACTAACCAGCTTAGTCAGAAGATGGTTCCATGGAAGAAAAAGGCCAAGGAGTTTGAAGATTTTTCTTCTAGACATCTCAA
 561 AATGTGGTACTCATACCATCCACATCAGAATCCCTTGTAGGATTTTCTAAAATTACAGATTGTTGAGCCTACCATAGGTC
 641 AAAAGGACTGGAATTTTCCTTCTTAACAAGTATAGTCATGGCACCACGTAACATTTTGGTCAATGACATTGTATAAAGGG
 721 TGGTCTCATAAGATTATACCATATTTTTACTGTACCTTTTCTATGTCTAAATATACAAATGTTTTACCATTGTGTTACAG
 801 TTGCCTACAGTATGATTACAGTAACATTCTGTACAGTGCTATAGCTGAAGAGTAATAGGCTAGGCTATCTGTATAGCCTA
 881 AGTGTGTAACAGGCTATATACATATCATCAGGGTCTGTGTAAGTATACTCTGTGATGTTCATACAGTGATGAAATCACCC
 961 AAAGACACATTTCTCAGAACGTAGCCCCATCATGAAGTGACGTGACTACCAGAGATTTCTGGAAAAGCACTCCCAAAAGT
1041 AATGAGATGTGTATGGCAATGTTAACTGAACCTGTTTGTATTAAAAAGTAAATCCCTATGAGGAATGTGGAAATGTCCGT
1121 CAAAGCATTGTCTTTTAAGTAAGTTCCAAGATCCATGAATTAACAGAGGCATATATTTAAAATGAAATTTAATGAGCACT
1201 TAGTGACTTCATTTGTTCAAGAATATTTGATTTCCTATTGTGTGCATGGGAGGTTTACAAAAGACAGACTGTCCCTATGC
1281 TTGTGCAGCTTACAATCTATTTAACTATTAGAGGCCCTGTGAGATGTAGGCAGTTATTTACAGATGAGAAAACTAACACA
1361 GCAGTGGCAATGCTGGGAATGGCCAACAGGCTTGGAATTCAACTCAGTTTAGCACCAAAGCCAGTGCTATTAAGACCTGA
1441 AGTTCAACAGTGGATTCCTTACCAAATAGTTTTTAAAGTATGCTCTAAGGAACAATGTTTTAATGAAATCTTGGATACAA
1521 AGTGGAATAAAAGGTTTCTGAGCATAAAGTAGCTCTTCAGTAGTTACAACCTATTCTTTTGCATACATAGCCTTTCCTTC
1601 CCTGCAAAAAGTTAAGCCTGCTAAGTATTCAGATCCCTGTCATTTACTTCTCAGCAGTCTCATTCAAGCTAAGGCTTGCA
1681 TACTCAATCTGTGCCGTAGTCTACACATTTTTAGGGGATATTTCACCAAAATACTTGACATGGTAACATCACTATTATAT
1761 ACTAGAAGCAAGAATTTTACACTTATGCTCTAAGTGATCCTTTTAAAAATTTTCTGAACTATTTGAGGAAAGTATTATTT
1841 GTCTTAAAGGGTAACAGCCTCATGAAATGACTTGAGGATTCCAATTTCTTATTAGCTTAAGATGTCACTTAAAAGCTGAC
1921 AGCCCTCATCTGTCTCATTGGCTACATAAGAGCTGCAGAAGATCCATCAATAACCAAGTATAAAGAAAGATTTTAAGACT
2001 AAGTACCAATTGAGGTAAACATGAAACCGTTATAAAGCAAATTAAAAAAAAATACATTAGGAAAAGTTACACAAATGAAG
2081 TGTACGCCTATTATATTCCCAAGGCATTTTTGTGGGGAGGAACAGTGCTGCTTGTTGGCCTTTCCATATTCCCTCATACA
2161 AAAATGCTAAAATCTATTCGCAAGAGTTTTGAGCTAACTTCGTCTCTTAAATTGCTTTAATTGTCATCAATAAAAACAAA
2241 TATGAAAAACCCTAGTTTAAAAAGCGGTTCAAGAATAATGTAAACTTATACATATAGCTTATTTTCTTCATTTACTAGAG
2321 GAGGAAAAATAGAACCAAAAAATGCATGAACTCCTGCTTTTCAATCTGATTACCTCAAACTGAAAAGCAGGTGAAAGGAG
2401 GAATATTTCAGTGTGTTTTTACATCTGAATCCAAGGGATCCAAGTGGCCCAGCAGAAACGGAATTCTTGTTAAAATGACT
2481 GATTCTCGTGCATGTGAAAGGCTCTGGGGAATGAATACCTGTTTGGTCCAAACTTACTGTATCATAATGCTGTATATGTT
2561 GAAAACGTAATACCTGTTAATGTCCTAATGAATCACGTTTTGCAGAAAACACCGTAAGAAACACTTCAGTCTTTCTGTAG
2641 TTTCCATGCATATTTCACCATGGTTCGCACTCTGATCCTCATCTGGTTTAGAAAGCAATTCAGTTTCTTTCAAACCACCA
2721 TAACCTAAGTGCTGCCCCATCCTTCACCTTTACCCTAGAAAATCTGAGAATCCATTGGTGTGTACTGTGTGACACAATGC
2801 CAACAAGCCTCTGGTTTCTAATACTGGCAGGACCAACACACATACTTTAGTGGGAATATAATCTGTTTAGACGATAATAG
2881 AGGGAAATGCCATAATTAACAAATCTCCCTTCACTCACCACTATCCTCATTCTTGCAGTTGTCAAGGTGTAAGCCTCACT
2961 GTAAGTTACAAAGCTACCACTCCCCTCTTTAAGAACACATAGCTTAGGATTGCCTTGGCGATGTGGGCTCTTTTTTGGTT
3041 CCATATGAACTTAAGTAGTTTTTTCCAATTCTGTGAAGAAAGTCATTGGTAGCTTGATGGGGATGGCATTGAATCTGTAA
3121 ATTACCTTGGGCAGTATGGCCATTTTCACAATATTGATTCTTCCTACCCAAGAGCATGGAATGTTCTTCCATTTGTTTGT
3201 ATCCTCTTTTATTTCCTTGAGCAGTAGCTTGTAGTTCTCCTTGAAGAGGTCCTTCACATCCCTTGTAAGTTGGATTCCTA
3281 GGTATTTTATTCTCTTTGAAGCAATTGTGAATGGGAGTTCACTCATGATTTGGCTCTCTGTTTGTCTGTTGTTGGTGTAT
3361 AAGAATGCTTGTGATTTTTGTACATTGATTTTGTATCCTGAGACTTTGCTGAAGTTGCTTATCAGCTTAAGGAGATTTTG
3441 GGCTGAGACGATGGGGTTTTCTAGATATACAATCATGTCGTCTGCAAACGGACAATTTGACTTCCTCTTTTCCTAATTGA
3521 ATACCCTTTATTTCCTTCTCCTGCCTAATTGCCCTGGCCAGAACTTCCAACACTATGTTGAATACGAGTGGTGAGAGAGG
3601 GCATCCCTGTCTTGTGCCAGTTTTCAAAGGGAATGCTTCCAGTTTTTGCCCATTCAGTATGATATTGGCTGTGGGTTTGT
3681 CATAGATAGCTCTTATTATTTTGAAATACACCCCATCAATCCCTAATTTATTGAGAGTTTTTAGCATGAAGGGTTGTTGA
3761 ATTTTGTCAAAGGCTTTTTCTGCATCTATTGAGATAATCATGTGTTTTTTGTCTTTGGCTCTGTTTATATGCTGGATTAC
3841 ATTCATTGATTTGCGTATATTGAACCAGCCTTGCATCCCAGGGATGAAGCCCACTTGATCATGGTGGATAAGCTTTTTGA
3921 TGTGCTGCTGGATTCGTTTTGCCAGTATTTTATCCAGTTAGAATGGCAATCATTAAAAAGTCAGGAAACAACAGGTGCTG
4001 GAGAGGATGTGGAGAAATAGGAACACTTTCACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGT
4081 GGCGATTCCTCAGGGATCTAGAACTGGAAACACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTAT
4161 AAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGTGGCATTATTCACAATAGCAAAGACTTGGAACCAACC
4241 CAAATGTCCAACAATGATAGACTGGATTAAGAAAACGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATG
4321 ATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAATCATCATTCTCAGTAAACTATCACAAGAACAAAAAACC
4401 AAACACCGCATATTCTCACTCATAGGTGGGAATTGAACAATGAGATCACATGGACACAGGAAGGGGAATATCACACTCTG
4481 GGGACTGTTGTGGGGTGGGGGGATGGGGGAGGGATAGCATTAGGAGATATACCTAATGCTAGATGACGAGTTAGTGGGTG
4561 CAGCGCACCAGCATGGCACATGTATACCTATGTAACTAACCTGCACAATGTGCACATGTACCCTAAAACTTAAAGTATAA
4641 AAAAAAAAAAAAACATAGCTAAAGAAAAACTGCATATGCAAATCATACCGTATTCATTTTTTTATTTAACTTGGGGATGG
4721 AATGGGGATAGCATACATTTTATTTGTACAATATTTAACAATCACTTATCCAAGGTGGGGTTTTATGGGGATTTTAAGCT
4801 TTCTGTTAAATACTTGCAGAAAAAATAGCAAGTACGATTTGACAGTAGTACAATAACCTGTGCCCAAAACACAAGAAATA
4881 CAGAGTAAAGCGAAAATAACTGCTTACCAATATTCTGAGAGGTAACAAATGGGATATGGGTTGAGACTGCATAAAAAACG
4961 TACTGCTGGTTGAATATCTGAGGTAAATGATGTTCAATCAAGATGCTACTTGTATCATTTTGCCCATAAATGGATAAATA
5041 ATTTTATGCATATCATACCAAATGTTCCTAAAAAGTAATCTTTCAAAAAAGTATAAAAGAGAAACTGGAAAGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            :||:|: ||  |||||||||| 
Target 5' gaTAAGCTTTTTGATGTGCTGCTg 3'
3907 - 3930 170.00 -20.50
2
miRNA  3' guGUU---UGGUA-AUA-CACGACGAu 5'
            |||   ||:||  ||  ||||||| 
Target 5' ccCAAAGGACTATAAATCATGCTGCTa 3'
4148 - 4174 152.00 -16.20
3
miRNA  3' guGUU---UGGUA----AUACACGACGau 5'
            |||   |||||    || |||||||  
Target 5' ttCAAACCACCATAACCTAAGTGCTGCcc 3'
2709 - 2737 146.00 -15.11
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN23676156 18 COSMIC
COSN30466480 35 COSMIC
COSN31555339 37 COSMIC
COSN9862516 38 COSMIC
COSN30511089 39 COSMIC
COSN14540425 47 COSMIC
COSN30150030 52 COSMIC
COSN30530543 70 COSMIC
COSN16951722 86 COSMIC
COSN14531970 113 COSMIC
COSN30154666 115 COSMIC
COSN1797038 199 COSMIC
COSN20090659 333 COSMIC
COSN30445661 497 COSMIC
COSN20570312 1408 COSMIC
COSN19104213 1875 COSMIC
COSN15764849 2460 COSMIC
COSN21724598 2514 COSMIC
COSN31959794 2614 COSMIC
COSN7107995 2807 COSMIC
COSN24206787 3076 COSMIC
COSN8555272 3116 COSMIC
COSN24208919 3117 COSMIC
COSN23983768 3553 COSMIC
COSN30301293 3766 COSMIC
COSN18850730 4277 COSMIC
COSN18850729 4297 COSMIC
COSN26937506 4394 COSMIC
COSN26937505 4419 COSMIC
COSN29029299 4638 COSMIC
COSN30029508 4732 COSMIC
COSN31592607 4733 COSMIC
COSN9067879 4761 COSMIC
COSN31523841 4849 COSMIC
COSN28778519 4873 COSMIC
COSN31547359 4891 COSMIC
COSN31531182 4985 COSMIC
COSN7107993 5010 COSMIC
COSN26636642 5049 COSMIC
COSN7107992 5050 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1489028575 3 dbSNP
rs762192618 5 dbSNP
rs776839519 18 dbSNP
rs1315513432 20 dbSNP
rs1461044595 22 dbSNP
rs769106675 25 dbSNP
rs746655058 32 dbSNP
rs1328072637 38 dbSNP
rs1428468632 39 dbSNP
rs779910559 40 dbSNP
rs373845219 42 dbSNP
rs558870854 43 dbSNP
rs1425914632 45 dbSNP
rs1394997766 46 dbSNP
rs371407420 52 dbSNP
rs912403300 56 dbSNP
rs1032061268 61 dbSNP
rs1000537154 63 dbSNP
rs1416049545 65 dbSNP
rs868656412 67 dbSNP
rs1457451971 68 dbSNP
rs1322198936 74 dbSNP
rs1050918290 81 dbSNP
rs949358667 82 dbSNP
rs1269930827 86 dbSNP
rs1368959000 89 dbSNP
rs17232050 91 dbSNP
rs896387708 92 dbSNP
rs1276606031 93 dbSNP
rs1322996445 100 dbSNP
rs745900988 105 dbSNP
rs112659436 107 dbSNP
rs138914665 111 dbSNP
rs1463693674 112 dbSNP
rs17225656 122 dbSNP
rs1180455152 124 dbSNP
rs1247026244 128 dbSNP
rs1048498672 133 dbSNP
rs1189335932 136 dbSNP
rs936664896 146 dbSNP
rs1428497498 150 dbSNP
rs1472669509 151 dbSNP
rs1160695805 152 dbSNP
rs1386030553 155 dbSNP
rs931388339 179 dbSNP
rs1318084508 194 dbSNP
rs918615172 199 dbSNP
rs1439036844 203 dbSNP
rs1273652224 205 dbSNP
rs1345402783 206 dbSNP
rs572171591 207 dbSNP
rs1290234677 210 dbSNP
rs1327379754 213 dbSNP
rs966032992 218 dbSNP
rs1290344653 220 dbSNP
rs553809440 229 dbSNP
rs1219098875 230 dbSNP
rs986039929 232 dbSNP
rs1483327773 233 dbSNP
rs1200886994 236 dbSNP
rs1484103068 237 dbSNP
rs768704038 243 dbSNP
rs535402993 248 dbSNP
rs755246352 252 dbSNP
rs966798564 254 dbSNP
rs568283575 255 dbSNP
rs1310742725 257 dbSNP
rs1244434152 259 dbSNP
rs1365531310 260 dbSNP
rs1410933118 267 dbSNP
rs1309941707 273 dbSNP
rs149189517 274 dbSNP
rs111856332 275 dbSNP
rs537732421 278 dbSNP
rs1226445105 280 dbSNP
rs1358696265 280 dbSNP
rs1013231118 283 dbSNP
rs1342795924 283 dbSNP
rs1398209572 283 dbSNP
rs1207144668 285 dbSNP
rs778859440 288 dbSNP
rs992327852 292 dbSNP
rs1249519541 300 dbSNP
rs3768686 303 dbSNP
rs1288541341 307 dbSNP
rs1187603317 313 dbSNP
rs1238896283 319 dbSNP
rs1033930382 320 dbSNP
rs995205625 333 dbSNP
rs1384927046 334 dbSNP
rs1430967514 336 dbSNP
rs1171102959 337 dbSNP
rs1394957285 343 dbSNP
rs1390929986 344 dbSNP
rs1334891507 345 dbSNP
rs1362552858 351 dbSNP
rs147163546 352 dbSNP
rs1342685956 360 dbSNP
rs887644604 362 dbSNP
rs1015244531 374 dbSNP
rs552083172 378 dbSNP
rs527783139 380 dbSNP
rs890865775 382 dbSNP
rs1440341021 383 dbSNP
rs1182536827 390 dbSNP
rs1248245729 390 dbSNP
rs1051392820 391 dbSNP
rs932496812 394 dbSNP
rs780942883 395 dbSNP
rs1371896694 407 dbSNP
rs566585619 415 dbSNP
rs918643060 423 dbSNP
rs1037457739 426 dbSNP
rs1259344791 433 dbSNP
rs1468290684 435 dbSNP
rs1054306609 436 dbSNP
rs944014414 436 dbSNP
rs1204202646 446 dbSNP
rs1366164220 450 dbSNP
rs1437071476 452 dbSNP
rs1488377454 458 dbSNP
rs1451670184 462 dbSNP
rs1293119040 472 dbSNP
rs912813373 478 dbSNP
rs985763733 478 dbSNP
rs1233796794 501 dbSNP
rs1276119153 502 dbSNP
rs954273309 506 dbSNP
rs1287712399 509 dbSNP
rs754805806 519 dbSNP
rs548192798 529 dbSNP
rs751341522 533 dbSNP
rs766291761 536 dbSNP
rs1260035984 537 dbSNP
rs1428457100 540 dbSNP
rs1200270936 549 dbSNP
rs935883649 550 dbSNP
rs1479523210 569 dbSNP
rs190945657 569 dbSNP
rs1285344274 570 dbSNP
rs1247572520 573 dbSNP
rs925307453 574 dbSNP
rs1295231928 576 dbSNP
rs762813321 577 dbSNP
rs978091207 579 dbSNP
rs1013679684 580 dbSNP
rs960440030 582 dbSNP
rs1033762712 583 dbSNP
rs543566518 592 dbSNP
rs1343530915 601 dbSNP
rs1222422627 602 dbSNP
rs917990499 602 dbSNP
rs992775758 608 dbSNP
rs562719647 612 dbSNP
rs1342683505 622 dbSNP
rs1288374486 627 dbSNP
rs1330807862 628 dbSNP
rs1002102231 633 dbSNP
rs887683840 640 dbSNP
rs959559435 644 dbSNP
rs1210777415 648 dbSNP
rs749882833 663 dbSNP
rs1424148124 675 dbSNP
rs1033814309 679 dbSNP
rs73003455 682 dbSNP
rs532687372 687 dbSNP
rs1015296589 688 dbSNP
rs17225670 696 dbSNP
rs1371137308 698 dbSNP
rs1262909241 708 dbSNP
rs890908603 713 dbSNP
rs1458253336 716 dbSNP
rs1029404773 728 dbSNP
rs1363661630 731 dbSNP
rs891166019 735 dbSNP
rs1049737558 737 dbSNP
rs1389173583 740 dbSNP
rs996964777 757 dbSNP
rs540785661 765 dbSNP
rs374988277 778 dbSNP
rs1196799458 781 dbSNP
rs925494348 784 dbSNP
rs1294356308 785 dbSNP
rs1289909108 788 dbSNP
rs572184035 791 dbSNP
rs1253145185 796 dbSNP
rs1484113626 799 dbSNP
rs1337942860 802 dbSNP
rs1251236325 806 dbSNP
rs1000085095 808 dbSNP
rs1219691449 809 dbSNP
rs903097682 812 dbSNP
rs1175520168 820 dbSNP
rs1042807482 832 dbSNP
rs761548471 844 dbSNP
rs17225677 846 dbSNP
rs1424565543 849 dbSNP
rs918030322 850 dbSNP
rs769113936 852 dbSNP
rs914051203 855 dbSNP
rs1423753812 859 dbSNP
rs938039077 863 dbSNP
rs1372296747 865 dbSNP
rs926791443 867 dbSNP
rs761069940 870 dbSNP
rs960720457 874 dbSNP
rs1331769871 879 dbSNP
rs879540030 900 dbSNP
rs962978179 906 dbSNP
rs1389740426 913 dbSNP
rs1394326077 917 dbSNP
rs1397351625 921 dbSNP
rs541923433 930 dbSNP
rs1381112827 934 dbSNP
rs574407220 950 dbSNP
rs555875856 952 dbSNP
rs1309752966 959 dbSNP
rs1425456193 968 dbSNP
rs1202551895 969 dbSNP
rs1250790549 970 dbSNP
rs185991209 980 dbSNP
rs570606827 981 dbSNP
rs982888263 982 dbSNP
rs1246785073 987 dbSNP
rs1188944471 1002 dbSNP
rs558340352 1018 dbSNP
rs1408105600 1027 dbSNP
rs756206130 1051 dbSNP
rs1359180960 1055 dbSNP
rs996629874 1056 dbSNP
rs775728324 1059 dbSNP
rs1032837473 1063 dbSNP
rs560951258 1066 dbSNP
rs533705557 1085 dbSNP
rs566646375 1088 dbSNP
rs772559533 1091 dbSNP
rs1199787285 1093 dbSNP
rs1298731270 1095 dbSNP
rs1364735306 1100 dbSNP
rs1320480098 1110 dbSNP
rs1261597294 1113 dbSNP
rs1218870597 1114 dbSNP
rs1294959126 1114 dbSNP
rs1205610236 1116 dbSNP
rs548305446 1118 dbSNP
rs746425422 1119 dbSNP
rs891190916 1127 dbSNP
rs1049768251 1132 dbSNP
rs1237041310 1137 dbSNP
rs559260183 1153 dbSNP
rs530119252 1155 dbSNP
rs1243568235 1164 dbSNP
rs1474395474 1170 dbSNP
rs932613579 1172 dbSNP
rs1425777110 1173 dbSNP
rs904105190 1177 dbSNP
rs903148417 1183 dbSNP
rs775471407 1203 dbSNP
rs1321648497 1205 dbSNP
rs17225684 1206 dbSNP
rs774474965 1218 dbSNP
rs1429043915 1221 dbSNP
rs1335219897 1229 dbSNP
rs771048299 1238 dbSNP
rs1330631807 1249 dbSNP
rs1014555508 1263 dbSNP
rs749479191 1269 dbSNP
rs1225453454 1276 dbSNP
rs1281410366 1282 dbSNP
rs1402208991 1283 dbSNP
rs1044038729 1284 dbSNP
rs1286597082 1294 dbSNP
rs1445131555 1314 dbSNP
rs182648494 1317 dbSNP
rs1247264440 1321 dbSNP
rs914098887 1323 dbSNP
rs1196690095 1334 dbSNP
rs1056838764 1336 dbSNP
rs550698182 1337 dbSNP
rs992725205 1353 dbSNP
rs1472721054 1355 dbSNP
rs938104619 1361 dbSNP
rs1405309405 1367 dbSNP
rs1399371176 1370 dbSNP
rs1158773788 1386 dbSNP
rs1413692247 1396 dbSNP
rs926675536 1397 dbSNP
rs939129723 1402 dbSNP
rs1038587871 1403 dbSNP
rs1425499616 1404 dbSNP
rs926351674 1411 dbSNP
rs1345031862 1412 dbSNP
rs1410515259 1415 dbSNP
rs941499407 1428 dbSNP
rs1281528624 1434 dbSNP
rs908666919 1436 dbSNP
rs1379108510 1440 dbSNP
rs542296445 1441 dbSNP
rs1179831055 1444 dbSNP
rs1361507793 1447 dbSNP
rs1459430795 1449 dbSNP
rs777930652 1453 dbSNP
rs1268076503 1464 dbSNP
rs750909811 1466 dbSNP
rs1483134770 1467 dbSNP
rs1183325636 1472 dbSNP
rs1209929134 1474 dbSNP
rs756352280 1481 dbSNP
rs980408481 1485 dbSNP
rs532847008 1493 dbSNP
rs1426935916 1495 dbSNP
rs1027269398 1513 dbSNP
rs1365469997 1532 dbSNP
rs1281049097 1533 dbSNP
rs971993872 1534 dbSNP
rs1330916408 1536 dbSNP
rs746763498 1542 dbSNP
rs962250694 1551 dbSNP
rs1353108754 1559 dbSNP
rs1309996899 1570 dbSNP
rs1384793731 1571 dbSNP
rs572692696 1574 dbSNP
rs963790041 1577 dbSNP
rs1342728312 1580 dbSNP
rs891226763 1583 dbSNP
rs529561749 1597 dbSNP
rs1270192308 1598 dbSNP
rs1436880509 1605 dbSNP
rs1032722891 1609 dbSNP
rs372047682 1623 dbSNP
rs1446867915 1625 dbSNP
rs1385180602 1635 dbSNP
rs903896358 1646 dbSNP
rs189970908 1647 dbSNP
rs1335813923 1656 dbSNP
rs540848816 1657 dbSNP
rs1014191147 1660 dbSNP
rs1408531013 1671 dbSNP
rs185950925 1680 dbSNP
rs17232057 1687 dbSNP
rs554069693 1696 dbSNP
rs750388414 1697 dbSNP
rs905311729 1703 dbSNP
rs769659913 1706 dbSNP
rs1338264038 1707 dbSNP
rs1440986534 1711 dbSNP
rs1264667900 1713 dbSNP
rs939476452 1716 dbSNP
rs1038469834 1717 dbSNP
rs1296045830 1718 dbSNP
rs1242843188 1720 dbSNP
rs941383578 1726 dbSNP
rs1181764314 1732 dbSNP
rs17232064 1734 dbSNP
rs1475148499 1743 dbSNP
rs1177181797 1750 dbSNP
rs1239532077 1751 dbSNP
rs1431762954 1758 dbSNP
rs1047647053 1760 dbSNP
rs1335857131 1763 dbSNP
rs1385480714 1769 dbSNP
rs1213932369 1772 dbSNP
rs17232071 1782 dbSNP
rs1287001843 1786 dbSNP
rs1325766742 1791 dbSNP
rs1284598786 1794 dbSNP
rs922829854 1794 dbSNP
rs1320973996 1799 dbSNP
rs1218958374 1803 dbSNP
rs1222455723 1809 dbSNP
rs1357343919 1816 dbSNP
rs1287691738 1818 dbSNP
rs17232078 1823 dbSNP
rs1207230033 1824 dbSNP
rs1379648923 1825 dbSNP
rs1446889103 1825 dbSNP
rs138015010 1831 dbSNP
rs1271072292 1835 dbSNP
rs942363040 1837 dbSNP
rs925587947 1843 dbSNP
rs961998835 1853 dbSNP
rs1176068001 1857 dbSNP
rs1364571248 1868 dbSNP
rs867050981 1872 dbSNP
rs978485520 1882 dbSNP
rs1384198337 1884 dbSNP
rs967509291 1888 dbSNP
rs190664746 1889 dbSNP
rs1304442072 1892 dbSNP
rs1421036689 1900 dbSNP
rs533815198 1922 dbSNP
rs556209839 1937 dbSNP
rs1318329005 1938 dbSNP
rs1241665559 1939 dbSNP
rs1259264099 1939 dbSNP
rs1353640994 1940 dbSNP
rs1034259636 1946 dbSNP
rs1294587594 1949 dbSNP
rs1489892606 1958 dbSNP
rs996960321 1963 dbSNP
rs146923314 1964 dbSNP
rs1185210590 1967 dbSNP
rs1421062034 1968 dbSNP
rs375155777 1978 dbSNP
rs1016920761 1982 dbSNP
rs187377554 1986 dbSNP
rs1165466262 1991 dbSNP
rs1363602151 1991 dbSNP
rs1423505924 1996 dbSNP
rs887179864 2000 dbSNP
rs1389264654 2001 dbSNP
rs1264225584 2006 dbSNP
rs1376716096 2007 dbSNP
rs1009961239 2009 dbSNP
rs892721961 2014 dbSNP
rs1489889065 2020 dbSNP
rs1047251487 2028 dbSNP
rs569246843 2029 dbSNP
rs1251891244 2032 dbSNP
rs763779367 2033 dbSNP
rs1481748284 2037 dbSNP
rs550991254 2044 dbSNP
rs1220758152 2048 dbSNP
rs1322328264 2049 dbSNP
rs1291922171 2052 dbSNP
rs1445058531 2053 dbSNP
rs567338886 2053 dbSNP
rs901461526 2053 dbSNP
rs1170550334 2054 dbSNP
rs1216625047 2054 dbSNP
rs1039940743 2056 dbSNP
rs930423777 2058 dbSNP
rs920315421 2060 dbSNP
rs1036045406 2066 dbSNP
rs1278484780 2068 dbSNP
rs1317567255 2070 dbSNP
rs1401411982 2074 dbSNP
rs1381227701 2076 dbSNP
rs942916810 2078 dbSNP
rs925641744 2080 dbSNP
rs1364898404 2081 dbSNP
rs1292371340 2085 dbSNP
rs1436564928 2090 dbSNP
rs1257718435 2096 dbSNP
rs1461904356 2098 dbSNP
rs1205365003 2104 dbSNP
rs538638237 2110 dbSNP
rs1168920763 2112 dbSNP
rs764522068 2122 dbSNP
rs945839505 2122 dbSNP
rs1421533953 2125 dbSNP
rs1426273659 2130 dbSNP
rs1465469560 2131 dbSNP
rs1169077482 2132 dbSNP
rs912969335 2134 dbSNP
rs1470715821 2143 dbSNP
rs535754607 2165 dbSNP
rs760246585 2170 dbSNP
rs1339115478 2173 dbSNP
rs978565085 2174 dbSNP
rs968143696 2180 dbSNP
rs1173119456 2186 dbSNP
rs571643376 2186 dbSNP
rs1022764237 2192 dbSNP
rs1212903816 2196 dbSNP
rs1034143402 2198 dbSNP
rs1009579134 2199 dbSNP
rs980030847 2201 dbSNP
rs963261161 2202 dbSNP
rs1311432769 2204 dbSNP
rs1216215492 2212 dbSNP
rs1243801630 2221 dbSNP
rs1004226582 2223 dbSNP
rs778087783 2223 dbSNP
rs1268902520 2226 dbSNP
rs1481122130 2230 dbSNP
rs547335513 2243 dbSNP
rs1005948730 2251 dbSNP
rs905438603 2253 dbSNP
rs1347494708 2255 dbSNP
rs1429154748 2256 dbSNP
rs377715503 2265 dbSNP
rs1026143511 2266 dbSNP
rs1248424965 2282 dbSNP
rs561471359 2289 dbSNP
rs549596837 2292 dbSNP
rs998246866 2294 dbSNP
rs1196638386 2297 dbSNP
rs1286008982 2297 dbSNP
rs529837661 2299 dbSNP
rs1258407209 2300 dbSNP
rs1292398759 2303 dbSNP
rs1490707926 2316 dbSNP
rs891947729 2323 dbSNP
rs1196618574 2328 dbSNP
rs1245791474 2330 dbSNP
rs562428480 2335 dbSNP
rs1039825066 2337 dbSNP
rs1178143758 2343 dbSNP
rs1220096767 2344 dbSNP
rs1410693243 2344 dbSNP
rs1310139490 2345 dbSNP
rs1158618004 2346 dbSNP
rs1366712132 2347 dbSNP
rs1007110250 2351 dbSNP
rs904764680 2356 dbSNP
rs940441661 2357 dbSNP
rs1042742187 2368 dbSNP
rs945695886 2371 dbSNP
rs1219352716 2373 dbSNP
rs1443135100 2387 dbSNP
rs538339860 2389 dbSNP
rs1329946568 2395 dbSNP
rs1239118898 2399 dbSNP
rs567511549 2400 dbSNP
rs890143288 2403 dbSNP
rs1361441907 2405 dbSNP
rs1219655648 2408 dbSNP
rs1051427089 2417 dbSNP
rs931900787 2434 dbSNP
rs1438060989 2441 dbSNP
rs921824992 2446 dbSNP
rs531062912 2448 dbSNP
rs1333705943 2451 dbSNP
rs947170541 2453 dbSNP
rs913056341 2459 dbSNP
rs1386446177 2460 dbSNP
rs1464847991 2466 dbSNP
rs17225691 2484 dbSNP
rs374715851 2484 dbSNP
rs1057284374 2487 dbSNP
rs775915583 2488 dbSNP
rs927122503 2490 dbSNP
rs979917127 2492 dbSNP
rs368356465 2493 dbSNP
rs963315004 2505 dbSNP
rs1422547368 2509 dbSNP
rs1384911824 2510 dbSNP
rs1243604953 2512 dbSNP
rs1438938135 2514 dbSNP
rs76952738 2516 dbSNP
rs1200363402 2519 dbSNP
rs1482139256 2526 dbSNP
rs1215791321 2534 dbSNP
rs984175192 2536 dbSNP
rs1457011374 2537 dbSNP
rs1255087697 2541 dbSNP
rs951469998 2542 dbSNP
rs1025605874 2543 dbSNP
rs1416647235 2566 dbSNP
rs1244070207 2567 dbSNP
rs998695751 2570 dbSNP
rs1210329765 2576 dbSNP
rs965405449 2579 dbSNP
rs1018427900 2584 dbSNP
rs1313463342 2589 dbSNP
rs1368364340 2590 dbSNP
rs1306380957 2594 dbSNP
rs1240062588 2596 dbSNP
rs1378369599 2608 dbSNP
rs1421797438 2611 dbSNP
rs767826966 2613 dbSNP
rs760065543 2614 dbSNP
rs549356038 2616 dbSNP
rs1333485485 2631 dbSNP
rs1401895258 2631 dbSNP
rs774760783 2635 dbSNP
rs1303671408 2637 dbSNP
rs17225698 2641 dbSNP
rs565966054 2644 dbSNP
rs1316939648 2647 dbSNP
rs1223812093 2654 dbSNP
rs1158198725 2658 dbSNP
rs10928371 2666 dbSNP
rs1010447808 2667 dbSNP
rs773294890 2669 dbSNP
rs1448038804 2675 dbSNP
rs1195420548 2682 dbSNP
rs1261046826 2683 dbSNP
rs891472310 2685 dbSNP
rs1380892269 2687 dbSNP
rs1005071615 2689 dbSNP
rs1056768625 2698 dbSNP
rs1485688956 2703 dbSNP
rs1421864531 2715 dbSNP
rs1255158509 2716 dbSNP
rs1402319197 2718 dbSNP
rs1182099445 2722 dbSNP
rs1483990212 2729 dbSNP
rs769938247 2737 dbSNP
rs1284854946 2738 dbSNP
rs1328949776 2747 dbSNP
rs927009916 2748 dbSNP
rs1051887798 2761 dbSNP
rs931598239 2763 dbSNP
rs182379399 2768 dbSNP
rs900429192 2775 dbSNP
rs1288822214 2779 dbSNP
rs1044293698 2783 dbSNP
rs1284499261 2784 dbSNP
rs1340266987 2797 dbSNP
rs1488032141 2803 dbSNP
rs1313803991 2804 dbSNP
rs572752834 2815 dbSNP
rs1431587618 2816 dbSNP
rs1197919057 2818 dbSNP
rs1043028678 2828 dbSNP
rs554388380 2832 dbSNP
rs947284904 2833 dbSNP
rs189292276 2838 dbSNP
rs1398154665 2839 dbSNP
rs1338796896 2846 dbSNP
rs17225705 2848 dbSNP
rs909013686 2854 dbSNP
rs1420425573 2856 dbSNP
rs1385821551 2863 dbSNP
rs1307246609 2864 dbSNP
rs775193720 2865 dbSNP
rs1307741295 2866 dbSNP
rs950640094 2872 dbSNP
rs1353564481 2873 dbSNP
rs575723902 2874 dbSNP
rs928046095 2878 dbSNP
rs1251470217 2890 dbSNP
rs976767438 2897 dbSNP
rs1420710805 2901 dbSNP
rs1176497590 2909 dbSNP
rs1379651266 2914 dbSNP
rs982079364 2918 dbSNP
rs769198941 2923 dbSNP
rs1476052962 2926 dbSNP
rs1260646068 2931 dbSNP
rs1192430492 2932 dbSNP
rs557198632 2934 dbSNP
rs1456965764 2936 dbSNP
rs1488345185 2938 dbSNP
rs1398125125 2939 dbSNP
rs1449507422 2940 dbSNP
rs1329645544 2941 dbSNP
rs1018305130 2946 dbSNP
rs539091540 2949 dbSNP
rs779888870 2954 dbSNP
rs1208587679 2955 dbSNP
rs969325798 2958 dbSNP
rs1244125368 2959 dbSNP
rs1252135818 2967 dbSNP
rs1459230487 2967 dbSNP
rs1356348036 2977 dbSNP
rs571680128 2988 dbSNP
rs1196535305 2989 dbSNP
rs1266536107 2991 dbSNP
rs1247502293 2999 dbSNP
rs557462196 3002 dbSNP
rs1461594680 3003 dbSNP
rs546970844 3005 dbSNP
rs1277833868 3010 dbSNP
rs1021768851 3013 dbSNP
rs1422749834 3014 dbSNP
rs745308180 3019 dbSNP
rs1342465783 3020 dbSNP
rs2059422 3024 dbSNP
rs1035785779 3025 dbSNP
rs567951075 3026 dbSNP
rs1389995476 3027 dbSNP
rs1015523601 3032 dbSNP
rs1294009840 3037 dbSNP
rs1395560982 3043 dbSNP
rs1296308998 3045 dbSNP
rs1462848835 3053 dbSNP
rs867189635 3053 dbSNP
rs1005030044 3055 dbSNP
rs1421144823 3058 dbSNP
rs1257661847 3060 dbSNP
rs1324053941 3063 dbSNP
rs1211947751 3065 dbSNP
rs1235694262 3066 dbSNP
rs1482848081 3067 dbSNP
rs17232085 3068 dbSNP
rs1477907681 3071 dbSNP
rs1374434630 3074 dbSNP
rs1476551068 3077 dbSNP
rs1192532285 3084 dbSNP
rs1196207065 3085 dbSNP
rs1450518697 3087 dbSNP
rs1429523389 3091 dbSNP
rs1030053003 3096 dbSNP
rs565078745 3104 dbSNP
rs1357936769 3108 dbSNP
rs1216052039 3109 dbSNP
rs900208340 3110 dbSNP
rs941723496 3117 dbSNP
rs1398194804 3121 dbSNP
rs887625723 3123 dbSNP
rs1011528529 3124 dbSNP
rs183732145 3130 dbSNP
rs1047528508 3131 dbSNP
rs891682285 3132 dbSNP
rs549863710 3134 dbSNP
rs929244015 3135 dbSNP
rs1311373887 3137 dbSNP
rs923195749 3145 dbSNP
rs149085256 3149 dbSNP
rs977190994 3150 dbSNP
rs1053379723 3153 dbSNP
rs1269198042 3154 dbSNP
rs938489040 3154 dbSNP
rs928045430 3157 dbSNP
rs1193301732 3158 dbSNP
rs944048649 3160 dbSNP
rs1432965043 3170 dbSNP
rs746929999 3171 dbSNP
rs1362982533 3173 dbSNP
rs985527400 3180 dbSNP
rs968742367 3181 dbSNP
rs550418588 3182 dbSNP
rs1438944799 3183 dbSNP
rs1273293801 3197 dbSNP
rs1366690291 3200 dbSNP
rs777588916 3203 dbSNP
rs1442939370 3204 dbSNP
rs1215268590 3207 dbSNP
rs1351361048 3207 dbSNP
rs1291801525 3208 dbSNP
rs372373489 3210 dbSNP
rs1314719725 3211 dbSNP
rs1397859051 3211 dbSNP
rs963986136 3211 dbSNP
rs1245739432 3215 dbSNP
rs988974371 3216 dbSNP
rs956527187 3219 dbSNP
rs1382736293 3222 dbSNP
rs868333780 3223 dbSNP
rs1035939883 3224 dbSNP
rs1438319371 3225 dbSNP
rs1003094933 3226 dbSNP
rs905532522 3228 dbSNP
rs1022614790 3255 dbSNP
rs564540978 3258 dbSNP
rs1407120498 3264 dbSNP
rs908081242 3270 dbSNP
rs1477424430 3271 dbSNP
rs1377646215 3277 dbSNP
rs1442696920 3281 dbSNP
rs539837668 3287 dbSNP
rs984033749 3295 dbSNP
rs1239412721 3296 dbSNP
rs954935767 3303 dbSNP
rs1226096788 3304 dbSNP
rs1030502765 3307 dbSNP
rs572840511 3308 dbSNP
rs1240479240 3313 dbSNP
rs1456711872 3320 dbSNP
rs560831050 3321 dbSNP
rs1238531697 3322 dbSNP
rs1199728169 3323 dbSNP
rs1161489630 3325 dbSNP
rs1439896593 3330 dbSNP
rs1466289406 3334 dbSNP
rs1173082403 3336 dbSNP
rs1397932188 3337 dbSNP
rs1334808698 3340 dbSNP
rs1445737486 3340 dbSNP
rs542883074 3342 dbSNP
rs1233859507 3346 dbSNP
rs964444084 3346 dbSNP
rs1220160382 3350 dbSNP
rs758187253 3350 dbSNP
rs12996285 3351 dbSNP
rs1021314563 3352 dbSNP
rs1345826245 3355 dbSNP
rs557080379 3359 dbSNP
rs1238054535 3362 dbSNP
rs1444565532 3363 dbSNP
rs1185533347 3366 dbSNP
rs1237039334 3367 dbSNP
rs373790510 3368 dbSNP
rs1374653647 3375 dbSNP
rs1196174250 3378 dbSNP
rs1308423051 3379 dbSNP
rs1011216240 3380 dbSNP
rs1464929986 3380 dbSNP
rs1172906973 3381 dbSNP
rs370576482 3381 dbSNP
rs1337264538 3382 dbSNP
rs1412745663 3385 dbSNP
rs1331812973 3386 dbSNP
rs891709083 3387 dbSNP
rs1340637962 3389 dbSNP
rs1413493515 3393 dbSNP
rs377605300 3398 dbSNP
rs538761984 3409 dbSNP
rs1003193983 3413 dbSNP
rs1175046076 3418 dbSNP
rs1417303422 3419 dbSNP
rs1347569317 3423 dbSNP
rs1278502322 3425 dbSNP
rs907081966 3425 dbSNP
rs1488688548 3428 dbSNP
rs1044189152 3431 dbSNP
rs1261344040 3432 dbSNP
rs1477580269 3434 dbSNP
rs370854015 3443 dbSNP
rs1379219330 3449 dbSNP
rs376752347 3449 dbSNP
rs373810609 3450 dbSNP
rs1471374349 3451 dbSNP
rs1421017454 3454 dbSNP
rs1359509429 3455 dbSNP
rs1387055875 3462 dbSNP
rs1325112533 3464 dbSNP
rs916643383 3468 dbSNP
rs1303344868 3470 dbSNP
rs578143236 3471 dbSNP
rs1187115041 3473 dbSNP
rs1283903340 3474 dbSNP
rs531429557 3475 dbSNP
rs1210701284 3480 dbSNP
rs1269708613 3482 dbSNP
rs1282727370 3483 dbSNP
rs535001981 3487 dbSNP
rs1380843810 3489 dbSNP
rs1441401063 3490 dbSNP
rs555514910 3490 dbSNP
rs907859988 3492 dbSNP
rs983760875 3494 dbSNP
rs1294979606 3500 dbSNP
rs371194057 3501 dbSNP
rs1388074372 3504 dbSNP
rs1285256723 3505 dbSNP
rs955110531 3515 dbSNP
rs923463176 3517 dbSNP
rs974879231 3525 dbSNP
rs964474950 3527 dbSNP
rs1245551178 3530 dbSNP
rs1282143165 3531 dbSNP
rs1354422955 3533 dbSNP
rs1209033526 3543 dbSNP
rs376929254 3544 dbSNP
rs1458925464 3547 dbSNP
rs1176746620 3548 dbSNP
rs1021344272 3549 dbSNP
rs1423916566 3551 dbSNP
rs1166240490 3552 dbSNP
rs1447008313 3553 dbSNP
rs990229610 3560 dbSNP
rs199520131 3562 dbSNP
rs1397636847 3565 dbSNP
rs1359297024 3569 dbSNP
rs1467489137 3573 dbSNP
rs1373190782 3575 dbSNP
rs202164933 3575 dbSNP
rs1402886645 3576 dbSNP
rs1412259034 3577 dbSNP
rs1352013979 3578 dbSNP
rs1314863805 3583 dbSNP
rs1163102634 3585 dbSNP
rs567987856 3586 dbSNP
rs1319796120 3588 dbSNP
rs550043097 3589 dbSNP
rs955765375 3589 dbSNP
rs1483498843 3590 dbSNP
rs555807167 3593 dbSNP
rs1422725723 3598 dbSNP
rs1193995473 3609 dbSNP
rs1425264259 3609 dbSNP
rs7421968 3614 dbSNP
rs1488014838 3618 dbSNP
rs1354475334 3626 dbSNP
rs1467051707 3633 dbSNP
rs1263920160 3640 dbSNP
rs1400213045 3642 dbSNP
rs1216412887 3646 dbSNP
rs1318727163 3649 dbSNP
rs1279109627 3657 dbSNP
rs1287623617 3658 dbSNP
rs1227579417 3659 dbSNP
rs1335201018 3660 dbSNP
rs1294779635 3679 dbSNP
rs1312544613 3685 dbSNP
rs1212236399 3687 dbSNP
rs1216348801 3688 dbSNP
rs1485070859 3705 dbSNP
rs1339281921 3706 dbSNP
rs7423878 3710 dbSNP
rs1432277642 3711 dbSNP
rs1348698370 3715 dbSNP
rs1185553894 3717 dbSNP
rs1419330828 3718 dbSNP
rs1434089597 3719 dbSNP
rs865867206 3721 dbSNP
rs907114486 3722 dbSNP
rs1434221718 3725 dbSNP
rs1298819726 3728 dbSNP
rs1022773239 3729 dbSNP
rs1398448622 3732 dbSNP
rs551903798 3733 dbSNP
rs1420408576 3736 dbSNP
rs895244319 3737 dbSNP
rs1220690998 3738 dbSNP
rs1299143391 3738 dbSNP
rs1037823792 3746 dbSNP
rs1477578618 3751 dbSNP
rs200457894 3752 dbSNP
rs942107424 3753 dbSNP
rs532121404 3754 dbSNP
rs1244951185 3757 dbSNP
rs1048180662 3760 dbSNP
rs1393819399 3769 dbSNP
rs1454176049 3772 dbSNP
rs1159769659 3773 dbSNP
rs1382323091 3774 dbSNP
rs933600472 3775 dbSNP
rs1420472810 3780 dbSNP
rs1158681650 3781 dbSNP
rs1350644756 3785 dbSNP
rs933580550 3786 dbSNP
rs1468761390 3787 dbSNP
rs923492597 3788 dbSNP
rs974910326 3789 dbSNP
rs1447505926 3790 dbSNP
rs943483256 3791 dbSNP
rs914734200 3793 dbSNP
rs1250859226 3802 dbSNP
rs570998457 3802 dbSNP
rs1323082521 3803 dbSNP
rs1216565365 3805 dbSNP
rs1468316097 3811 dbSNP
rs1179862720 3815 dbSNP
rs955963334 3817 dbSNP
rs1031362401 3818 dbSNP
rs546220757 3819 dbSNP
rs1295823949 3828 dbSNP
rs1407350520 3829 dbSNP
rs1215859730 3830 dbSNP
rs1364832362 3831 dbSNP
rs1187993584 3832 dbSNP
rs1374524979 3833 dbSNP
rs1274803072 3839 dbSNP
rs1440848953 3839 dbSNP
rs1022805815 3841 dbSNP
rs898373637 3844 dbSNP
rs1017161706 3846 dbSNP
rs886495609 3854 dbSNP
rs528052258 3855 dbSNP
rs1329811732 3861 dbSNP
rs1465419261 3865 dbSNP
rs560908190 3866 dbSNP
rs902104020 3867 dbSNP
rs1473798287 3869 dbSNP
rs1186135427 3870 dbSNP
rs780266100 3875 dbSNP
rs1039336916 3883 dbSNP
rs1431541532 3888 dbSNP
rs1172472728 3894 dbSNP
rs943597646 3897 dbSNP
rs1424486456 3898 dbSNP
rs1409368099 3903 dbSNP
rs1334739527 3904 dbSNP
rs1360430454 3905 dbSNP
rs1190554674 3911 dbSNP
rs914767713 3912 dbSNP
rs990708624 3914 dbSNP
rs1454709790 3925 dbSNP
rs934438907 3927 dbSNP
rs144103215 3933 dbSNP
rs1195768259 3935 dbSNP
rs1005988748 3936 dbSNP
rs530789315 3937 dbSNP
rs1196581827 3946 dbSNP
rs1457133415 3952 dbSNP
rs981140617 3952 dbSNP
rs971073663 3954 dbSNP
rs1196105013 3957 dbSNP
rs1371194585 3969 dbSNP
rs1206128793 3971 dbSNP
rs560378008 3973 dbSNP
rs1173140474 3974 dbSNP
rs1427121387 3981 dbSNP
rs1432330122 3985 dbSNP
rs563385166 3990 dbSNP
rs991389427 3994 dbSNP
rs1315746318 3995 dbSNP
rs545180688 4001 dbSNP
rs962591209 4005 dbSNP
rs1227084166 4008 dbSNP
rs1016782499 4018 dbSNP
rs1373900257 4029 dbSNP
rs1004429222 4030 dbSNP
rs1446561251 4036 dbSNP
rs1374459807 4037 dbSNP
rs1300136571 4039 dbSNP
rs1464674125 4040 dbSNP
rs1274822839 4042 dbSNP
rs950832020 4043 dbSNP
rs1026782722 4044 dbSNP
rs997593845 4046 dbSNP
rs1452565985 4047 dbSNP
rs901881536 4055 dbSNP
rs1436640011 4056 dbSNP
rs1380416538 4061 dbSNP
rs1039032013 4062 dbSNP
rs1420962201 4063 dbSNP
rs1156466931 4068 dbSNP
rs1382013000 4074 dbSNP
rs1373632101 4083 dbSNP
rs1007842224 4084 dbSNP
rs893348208 4089 dbSNP
rs1250904056 4091 dbSNP
rs1054634428 4092 dbSNP
rs1241217046 4099 dbSNP
rs934792411 4106 dbSNP
rs924798204 4107 dbSNP
rs1210644359 4123 dbSNP
rs1236518081 4127 dbSNP
rs1466943641 4131 dbSNP
rs1192985271 4134 dbSNP
rs1211037865 4135 dbSNP
rs1349377887 4136 dbSNP
rs1284541699 4141 dbSNP
rs62169525 4142 dbSNP
rs1045498245 4143 dbSNP
rs1362878775 4145 dbSNP
rs1458148944 4154 dbSNP
rs1397192673 4157 dbSNP
rs1460185971 4163 dbSNP
rs1325856365 4165 dbSNP
rs1317912088 4168 dbSNP
rs1309690838 4172 dbSNP
rs1394641233 4174 dbSNP
rs1393222313 4176 dbSNP
rs1378784887 4179 dbSNP
rs1305027877 4181 dbSNP
rs1313683257 4183 dbSNP
rs1245845399 4184 dbSNP
rs1295321994 4186 dbSNP
rs1332441654 4188 dbSNP
rs1416738893 4191 dbSNP
rs1358653572 4192 dbSNP
rs1156796208 4195 dbSNP
rs1452881035 4198 dbSNP
rs1364303678 4201 dbSNP
rs1161089025 4202 dbSNP
rs1421807507 4204 dbSNP
rs1415151789 4209 dbSNP
rs1256415486 4212 dbSNP
rs1188171102 4221 dbSNP
rs1486379046 4224 dbSNP
rs1260333290 4228 dbSNP
rs1464036210 4235 dbSNP
rs1215253575 4243 dbSNP
rs1395917847 4246 dbSNP
rs764431034 4247 dbSNP
rs759211762 4251 dbSNP
rs1243122819 4252 dbSNP
rs1232469385 4256 dbSNP
rs1278670937 4256 dbSNP
rs1309035040 4258 dbSNP
rs1321459298 4259 dbSNP
rs1212360803 4266 dbSNP
rs1254970281 4269 dbSNP
rs1294162339 4270 dbSNP
rs1235309295 4273 dbSNP
rs578168862 4276 dbSNP
rs1297733146 4277 dbSNP
rs1382832120 4282 dbSNP
rs1385639543 4283 dbSNP
rs1290523682 4289 dbSNP
rs1456225591 4297 dbSNP
rs1485080639 4305 dbSNP
rs1298998408 4311 dbSNP
rs1416834590 4317 dbSNP
rs1165211374 4325 dbSNP
rs1475945654 4328 dbSNP
rs1421004466 4330 dbSNP
rs1235873075 4336 dbSNP
rs1277654565 4343 dbSNP
rs1346474910 4346 dbSNP
rs1191911737 4356 dbSNP
rs1243436101 4368 dbSNP
rs1487072443 4370 dbSNP
rs1185075034 4371 dbSNP
rs1428564079 4371 dbSNP
rs1264521665 4375 dbSNP
rs1261654608 4378 dbSNP
rs1208529407 4380 dbSNP
rs1488368744 4381 dbSNP
rs1176076065 4383 dbSNP
rs1274131644 4383 dbSNP
rs1434161504 4384 dbSNP
rs545314704 4385 dbSNP
rs1288015268 4386 dbSNP
rs1316352809 4386 dbSNP
rs1277779120 4389 dbSNP
rs1301128246 4390 dbSNP
rs1369634686 4391 dbSNP
rs1240186601 4399 dbSNP
rs1285919133 4402 dbSNP
rs541510162 4403 dbSNP
rs1228291213 4406 dbSNP
rs1314704350 4406 dbSNP
rs372844793 4407 dbSNP
rs1297664787 4408 dbSNP
rs1384947083 4413 dbSNP
rs1251624171 4419 dbSNP
rs1453904572 4423 dbSNP
rs1393462211 4426 dbSNP
rs1326399413 4428 dbSNP
rs574097940 4431 dbSNP
rs1397726141 4432 dbSNP
rs577768202 4433 dbSNP
rs537347378 4440 dbSNP
rs1393554650 4442 dbSNP
rs1446901698 4442 dbSNP
rs1374239365 4446 dbSNP
rs1197382425 4447 dbSNP
rs1454271632 4448 dbSNP
rs1370532668 4455 dbSNP
rs1254164469 4462 dbSNP
rs1195952183 4464 dbSNP
rs1335942521 4469 dbSNP
rs202195763 4469 dbSNP
rs1215900162 4474 dbSNP
rs1271836121 4477 dbSNP
rs1272604757 4479 dbSNP
rs1234744365 4480 dbSNP
rs991088316 4482 dbSNP
rs1468645266 4484 dbSNP
rs1176858543 4485 dbSNP
rs1418793345 4488 dbSNP
rs71413604 4489 dbSNP
rs1341580738 4490 dbSNP
rs1393439630 4490 dbSNP
rs1218428333 4491 dbSNP
rs1232618656 4496 dbSNP
rs1370218876 4497 dbSNP
rs1304027118 4498 dbSNP
rs570324872 4499 dbSNP
rs1303099032 4501 dbSNP
rs1374316452 4502 dbSNP
rs866638339 4503 dbSNP
rs962620889 4503 dbSNP
rs71413603 4504 dbSNP
rs909749992 4508 dbSNP
rs1215717916 4509 dbSNP
rs1275659524 4511 dbSNP
rs1436179993 4512 dbSNP
rs1203820880 4513 dbSNP
rs1258502048 4515 dbSNP
rs867658648 4521 dbSNP
rs71430092 4522 dbSNP
rs1416944841 4525 dbSNP
rs982642698 4526 dbSNP
rs1169602838 4528 dbSNP
rs1417250077 4529 dbSNP
rs951324854 4529 dbSNP
rs1173658407 4530 dbSNP
rs1398176154 4532 dbSNP
rs1311869157 4533 dbSNP
rs1170360865 4537 dbSNP
rs1355247076 4542 dbSNP
rs1433543869 4547 dbSNP
rs1396255216 4548 dbSNP
rs1176037174 4549 dbSNP
rs1337950380 4552 dbSNP
rs1214481816 4556 dbSNP
rs1438252191 4557 dbSNP
rs1350103858 4560 dbSNP
rs1029494760 4562 dbSNP
rs1232608824 4564 dbSNP
rs1182804658 4565 dbSNP
rs558107850 4576 dbSNP
rs1156290740 4578 dbSNP
rs1240299178 4580 dbSNP
rs1254310896 4585 dbSNP
rs1210308923 4587 dbSNP
rs539625920 4588 dbSNP
rs1396406531 4597 dbSNP
rs1172657050 4601 dbSNP
rs1280981702 4601 dbSNP
rs1236327094 4607 dbSNP
rs556348426 4608 dbSNP
rs1320756125 4609 dbSNP
rs750476564 4611 dbSNP
rs1325044763 4612 dbSNP
rs1435060468 4615 dbSNP
rs1304775101 4617 dbSNP
rs1278803183 4620 dbSNP
rs1373317923 4626 dbSNP
rs1442640518 4629 dbSNP
rs1337216645 4630 dbSNP
rs1331758691 4631 dbSNP
rs141274149 4632 dbSNP
rs1207110190 4633 dbSNP
rs1351603258 4633 dbSNP
rs1281976782 4634 dbSNP
rs997621971 4635 dbSNP
rs1413670394 4636 dbSNP
rs1375472151 4637 dbSNP
rs1431112609 4638 dbSNP
rs1452032915 4638 dbSNP
rs1156414933 4639 dbSNP
rs1470995677 4639 dbSNP
rs546308358 4639 dbSNP
rs1327202836 4640 dbSNP
rs966102587 4640 dbSNP
rs1397242041 4641 dbSNP
rs528136913 4646 dbSNP
rs74855627 4653 dbSNP
rs1241499777 4654 dbSNP
rs1300747630 4654 dbSNP
rs1336425860 4654 dbSNP
rs70992181 4654 dbSNP
rs72223269 4654 dbSNP
rs867016787 4654 dbSNP
rs878902949 4654 dbSNP
rs1017629285 4655 dbSNP
rs1179250631 4655 dbSNP
rs1418338628 4655 dbSNP
rs1491457462 4656 dbSNP
rs1472471620 4657 dbSNP
rs1007540158 4658 dbSNP
rs893398016 4658 dbSNP
rs887523364 4663 dbSNP
rs1471343846 4664 dbSNP
rs1048047239 4667 dbSNP
rs1420459271 4668 dbSNP
rs757878933 4671 dbSNP
rs1055151386 4672 dbSNP
rs752106509 4673 dbSNP
rs929146514 4674 dbSNP
rs901638505 4682 dbSNP
rs1040270286 4684 dbSNP
rs1327103214 4688 dbSNP
rs191842811 4689 dbSNP
rs911232518 4690 dbSNP
rs548962924 4692 dbSNP
rs1294969808 4697 dbSNP
rs1045863608 4699 dbSNP
rs1244034954 4708 dbSNP
rs1251767795 4712 dbSNP
rs1481345991 4713 dbSNP
rs1193502988 4715 dbSNP
rs985411294 4729 dbSNP
rs1485828822 4731 dbSNP
rs1445265639 4746 dbSNP
rs775524462 4746 dbSNP
rs947480441 4748 dbSNP
rs530754435 4750 dbSNP
rs1164724108 4765 dbSNP
rs1374102170 4769 dbSNP
rs1047081 4776 dbSNP
rs1463598392 4778 dbSNP
rs1166283527 4780 dbSNP
rs1370020916 4788 dbSNP
rs1415666743 4789 dbSNP
rs949818127 4794 dbSNP
rs1224173262 4806 dbSNP
rs537201850 4813 dbSNP
rs914658204 4813 dbSNP
rs1273372289 4814 dbSNP
rs1347935433 4820 dbSNP
rs1212641152 4823 dbSNP
rs1277693180 4826 dbSNP
rs1352529686 4826 dbSNP
rs1181577459 4836 dbSNP
rs989420776 4838 dbSNP
rs1291084686 4848 dbSNP
rs1232241706 4849 dbSNP
rs1389682632 4851 dbSNP
rs1055389369 4852 dbSNP
rs909541323 4875 dbSNP
rs956242785 4883 dbSNP
rs983143686 4891 dbSNP
rs563584038 4892 dbSNP
rs1363814702 4893 dbSNP
rs188578492 4896 dbSNP
rs114710451 4905 dbSNP
rs1022667270 4910 dbSNP
rs59216363 4915 dbSNP
rs1005873677 4922 dbSNP
rs1345160428 4922 dbSNP
rs763759235 4931 dbSNP
rs1277759436 4932 dbSNP
rs1026070627 4933 dbSNP
rs1311305572 4934 dbSNP
rs1402828259 4947 dbSNP
rs1487040009 4957 dbSNP
rs541546889 4959 dbSNP
rs993613258 4960 dbSNP
rs901695153 4968 dbSNP
rs1423138532 4974 dbSNP
rs1164482534 4988 dbSNP
rs1160064954 4993 dbSNP
rs1432889862 4993 dbSNP
rs1475694358 4993 dbSNP
rs1346800274 4994 dbSNP
rs1451299091 5000 dbSNP
rs1319849056 5008 dbSNP
rs986208536 5010 dbSNP
rs1300707025 5012 dbSNP
rs1442989728 5012 dbSNP
rs1366246780 5019 dbSNP
rs1040154147 5024 dbSNP
rs1191653857 5028 dbSNP
rs1319137035 5033 dbSNP
rs1475110189 5042 dbSNP
rs1226871750 5043 dbSNP
rs1241480884 5047 dbSNP
rs1469352872 5049 dbSNP
rs1007457187 5050 dbSNP
rs1245098974 5054 dbSNP
rs1216352947 5074 dbSNP
rs1488186333 5080 dbSNP
rs889011538 5085 dbSNP
rs1178021495 5091 dbSNP
rs1448536536 5092 dbSNP
rs1471492418 5094 dbSNP
rs1158075403 5099 dbSNP
rs957642576 5109 dbSNP
rs1032999309 5111 dbSNP
rs1323781419 5115 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000392857.5 | 3UTR | CCAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000392857.5 | 3UTR | CCAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAAAGACACAUGCACACGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000392857.5 | 3UTR | CCAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000392857.5 | 3UTR | CCAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000392857.5 | 3UTR | CCAUCCCAUUACUGGGUAUAUACCCAAAGGACUAUAAAUCAUGCUGCUAUAAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.737 1.0e-4 0.832 2.7e-6 20 Click to see details
GSE21032 Prostate cancer 0.284 4.6e-3 0.245 1.3e-2 83 Click to see details
GSE21687 Ependynoma primary tumors 0.254 2.1e-2 0.222 3.9e-2 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.439 2.6e-2 -0.406 3.8e-2 20 Click to see details
GSE17498 Multiple myeloma 0.285 3.7e-2 0.206 1.0e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.353 4.9e-2 -0.232 1.4e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.431 7.1e-2 -0.451 6.1e-2 13 Click to see details
GSE19536 Breast cancer 0.132 9.5e-2 0.086 2.0e-1 100 Click to see details
GSE17306 Multiple myeloma 0.189 9.7e-2 0.118 2.1e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.236 9.7e-2 0.044 4.1e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.135 1.0e-1 -0.067 2.7e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.122 1.4e-1 0.091 2.1e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.217 1.5e-1 0.070 3.7e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.217 1.5e-1 -0.260 1.1e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.307 1.7e-1 0.497 5.0e-2 12 Click to see details
GSE27834 Pluripotent stem cells -0.241 1.8e-1 -0.365 8.2e-2 16 Click to see details
GSE28544 Breast cancer 0.171 2.1e-1 0.511 5.4e-3 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.163 2.2e-1 0.365 3.6e-2 25 Click to see details
GSE38226 Liver fibrosis -0.068 3.8e-1 -0.111 3.2e-1 21 Click to see details
GSE21849 B cell lymphoma -0.023 4.5e-1 0.007 4.9e-1 29 Click to see details
GSE21849 B cell lymphoma -0.023 4.5e-1 0.007 4.9e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.169 0.06 -0.219 0.02 84 Click to see details
KICH -0.298 0.07 -0.182 0.19 25 Click to see details
KIRP -0.235 0.1 -0.251 0.08 32 Click to see details
PCPG -0.942 0.11 -0.500 0.33 3 Click to see details
THCA -0.136 0.15 -0.220 0.05 59 Click to see details
PAAD 0.645 0.18 0.800 0.1 4 Click to see details
LUSC 0.133 0.21 0.161 0.17 38 Click to see details
LIHC -0.112 0.22 -0.071 0.31 49 Click to see details
UCEC 0.178 0.23 0.061 0.4 19 Click to see details
ESCA -0.219 0.26 -0.255 0.22 11 Click to see details
CHOL 0.248 0.26 0.467 0.1 9 Click to see details
STAD -0.112 0.27 -0.150 0.21 32 Click to see details
KIRC 0.072 0.28 0.064 0.3 68 Click to see details
CESC -0.541 0.32 -0.500 0.33 3 Click to see details
BLCA -0.09 0.36 -0.030 0.45 18 Click to see details
PRAD -0.046 0.38 0.071 0.31 50 Click to see details
COAD -0.099 0.41 -0.452 0.13 8 Click to see details
HNSC -0.016 0.46 -0.067 0.34 42 Click to see details
LUAD 0.031 0.46 0.119 0.36 12 Click to see details
LUAD 0.031 0.46 0.119 0.36 12 Click to see details
LUAD 0.031 0.46 0.119 0.36 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD