miRTarBase - #MIRT496019 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CD180   
Synonyms LY64, Ly78, RP105
Description CD180 molecule
Transcript NM_005582   
Expression
Putative miRNA Targets on CD180
3'UTR of CD180
(miRNA target sites are highlighted)
>CD180|NM_005582|3'UTR
   1 TGCTGAAGGTTTCCAGAGAAAGCAAATAAGTGTGCTTAGCAAAATTGCTCTAAGTGAAAGAACTGTCATCTGCTGGTGAC
  81 CAGACCAGACTTTTCAGATTGCTTCCTGGAACTGGGCAGGGACTCACTGTGCTTTTCTGAGCTTCTTACTCCTGTGAGTC
 161 CCAGAGCTAAAGAACCTTCTAGGCAAGTACACCGAATGACTCAGTCCAGAGGGTCAGATGCTGCTGTGAGAGGCACAGAG
 241 CCCTTTCCGCATGTGGAAGAGTGGGAGGAAGCAGAGGGAGGGACTGGGCAGGGACTGCCGGCCCCGGAGTCTCCCACAGG
 321 GAGGCCATTCCCCTTCTACTCACCGACATCCCTCCCAGCACCACACACCCCGCCCCTGAAAGGAGATCATCAGCCCCCAC
 401 AATTTGTCAGAGCTGAAGCCAGCCCACTACCCACCCCCACTACAGCATTGTGCTTGGGTCTGGGTTCTCAGTAATGTAGC
 481 CATTTGAGAAACTTACTTGGGGACAAAGTCTCAATCCTTATTTTAAATGAAAAAAGAAAAGAAAAGCATAATAAATTTAA
 561 AAGAAAAGGCTGAGAAATGAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:|  :| |  ||||||| 
Target 5' tcCAGAGGGTCAGATGCTGCTg 3'
205 - 226 152.00 -15.00
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :|||::| || ||||| | 
Target 5' aaaGAACTGTCATCTGCTGGTg 3'
57 - 78 135.00 -10.20
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||:| | || ||| |||| 
Target 5' agaAAGCAAATAAGTG-TGCTt 3'
17 - 37 115.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30141762 26 COSMIC
COSN30676758 33 COSMIC
COSN31522135 37 COSMIC
COSN30515447 39 COSMIC
COSN30492625 47 COSMIC
COSN28766159 59 COSMIC
COSN30496166 65 COSMIC
COSN28822367 160 COSMIC
COSN6925514 181 COSMIC
COSN24073734 362 COSMIC
COSN21313180 397 COSMIC
COSN29928147 600 COSMIC
COSN29903093 908 COSMIC
COSN23220152 1777 COSMIC
COSN7951229 1835 COSMIC
COSN28068704 1872 COSMIC
COSN4851509 1873 COSMIC
COSN4851508 1875 COSMIC
COSN21564541 1947 COSMIC
COSN8228477 2057 COSMIC
COSN15843573 2289 COSMIC
COSN5809975 2581 COSMIC
COSN26824196 3066 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs891798277 9 dbSNP
rs764261269 13 dbSNP
rs1191784818 15 dbSNP
rs763243563 16 dbSNP
rs1422928583 22 dbSNP
rs1378465239 23 dbSNP
rs140321429 25 dbSNP
rs5744527 26 dbSNP
rs760121114 32 dbSNP
rs776941829 37 dbSNP
rs5744528 41 dbSNP
rs1290825836 45 dbSNP
rs747294050 45 dbSNP
rs1166425215 48 dbSNP
rs773597415 51 dbSNP
rs904464382 58 dbSNP
rs2230525 59 dbSNP
rs1316239301 64 dbSNP
rs943191205 68 dbSNP
rs1342349031 69 dbSNP
rs1234435709 71 dbSNP
rs1379186216 74 dbSNP
rs575426264 75 dbSNP
rs1421118266 76 dbSNP
rs911724723 78 dbSNP
rs1293279602 81 dbSNP
rs746429444 84 dbSNP
rs1304098897 93 dbSNP
rs1333107711 99 dbSNP
rs556865552 102 dbSNP
rs1261699567 113 dbSNP
rs1350867330 114 dbSNP
rs1204187304 116 dbSNP
rs58890858 119 dbSNP
rs34803053 137 dbSNP
rs778906167 148 dbSNP
rs1017269462 149 dbSNP
rs182074198 154 dbSNP
rs1188537270 160 dbSNP
rs538796184 179 dbSNP
rs1430863002 183 dbSNP
rs771003235 190 dbSNP
rs749470933 193 dbSNP
rs980769431 194 dbSNP
rs1428458080 204 dbSNP
rs190682990 210 dbSNP
rs1377340529 212 dbSNP
rs142133637 225 dbSNP
rs1007200083 226 dbSNP
rs1024933123 240 dbSNP
rs890090671 242 dbSNP
rs564562758 248 dbSNP
rs368264252 249 dbSNP
rs1308064975 256 dbSNP
rs1205597862 262 dbSNP
rs1316761960 265 dbSNP
rs1237857710 275 dbSNP
rs1803440 276 dbSNP
rs1210933604 278 dbSNP
rs1484619226 279 dbSNP
rs1424115985 285 dbSNP
rs1031659726 292 dbSNP
rs5744529 293 dbSNP
rs904535841 299 dbSNP
rs1037970131 300 dbSNP
rs1415878959 302 dbSNP
rs749517827 303 dbSNP
rs1017490160 305 dbSNP
rs1007894238 306 dbSNP
rs1173021270 306 dbSNP
rs577689374 307 dbSNP
rs1052068312 308 dbSNP
rs1463971846 310 dbSNP
rs1299299363 323 dbSNP
rs1373020031 324 dbSNP
rs145954328 332 dbSNP
rs773425848 344 dbSNP
rs569698567 345 dbSNP
rs1372665488 346 dbSNP
rs1234592504 351 dbSNP
rs988141072 367 dbSNP
rs1309998839 368 dbSNP
rs1411281827 370 dbSNP
rs941663993 371 dbSNP
rs550916015 372 dbSNP
rs1461885820 374 dbSNP
rs979574115 387 dbSNP
rs1254670818 392 dbSNP
rs1454823048 398 dbSNP
rs1351017480 403 dbSNP
rs1193307028 419 dbSNP
rs964159267 425 dbSNP
rs1430425645 426 dbSNP
rs1171694087 428 dbSNP
rs1354424777 430 dbSNP
rs1460940974 431 dbSNP
rs144495046 438 dbSNP
rs949019705 446 dbSNP
rs917412120 448 dbSNP
rs985873286 456 dbSNP
rs779775030 459 dbSNP
rs565584853 467 dbSNP
rs1306789317 469 dbSNP
rs1183086455 486 dbSNP
rs1473706481 491 dbSNP
rs1216726970 496 dbSNP
rs1274808011 497 dbSNP
rs1468793989 498 dbSNP
rs1213275247 500 dbSNP
rs1251414701 505 dbSNP
rs956211389 521 dbSNP
rs954469884 526 dbSNP
rs1249295053 530 dbSNP
rs1031731760 532 dbSNP
rs1419019643 536 dbSNP
rs1427189071 536 dbSNP
rs978851505 536 dbSNP
rs1176442731 540 dbSNP
rs1324771100 547 dbSNP
rs1488751895 547 dbSNP
rs1347718226 551 dbSNP
rs184993398 552 dbSNP
rs1218738076 553 dbSNP
rs1288869818 554 dbSNP
rs1333432035 556 dbSNP
rs758339708 558 dbSNP
rs1268223018 563 dbSNP
rs1016148027 568 dbSNP
rs1487360077 572 dbSNP
rs1229798832 596 dbSNP
rs528539763 597 dbSNP
rs1398050558 599 dbSNP
rs1295105467 606 dbSNP
rs1335200717 608 dbSNP
rs755814029 615 dbSNP
rs1232409253 627 dbSNP
rs5744530 630 dbSNP
rs890390279 633 dbSNP
rs1030222640 634 dbSNP
rs1391229054 639 dbSNP
rs993259607 640 dbSNP
rs1044906025 641 dbSNP
rs543144740 643 dbSNP
rs1487384741 650 dbSNP
rs769825434 650 dbSNP
rs1460345513 651 dbSNP
rs1258880052 653 dbSNP
rs896565869 654 dbSNP
rs575667951 672 dbSNP
rs1163152422 673 dbSNP
rs897668696 678 dbSNP
rs1410623606 683 dbSNP
rs1037374093 684 dbSNP
rs764777524 685 dbSNP
rs1052872960 687 dbSNP
rs1458985353 688 dbSNP
rs1314207264 701 dbSNP
rs1355956316 707 dbSNP
rs1414109805 730 dbSNP
rs1282147324 731 dbSNP
rs1375344944 736 dbSNP
rs1224528249 739 dbSNP
rs147599838 748 dbSNP
rs935307743 752 dbSNP
rs761442588 754 dbSNP
rs1281159670 766 dbSNP
rs904849048 768 dbSNP
rs1180804341 772 dbSNP
rs1433625945 775 dbSNP
rs1186128460 791 dbSNP
rs1234945784 793 dbSNP
rs1045157378 801 dbSNP
rs925545683 805 dbSNP
rs1043929483 812 dbSNP
rs1406736316 813 dbSNP
rs559358849 814 dbSNP
rs1417506430 815 dbSNP
rs1269205077 819 dbSNP
rs1375526774 820 dbSNP
rs193178276 822 dbSNP
rs139736495 827 dbSNP
rs1356044313 831 dbSNP
rs16896377 833 dbSNP
rs763816939 834 dbSNP
rs1374890245 836 dbSNP
rs986928666 854 dbSNP
rs1248064213 868 dbSNP
rs552890421 876 dbSNP
rs1347315064 877 dbSNP
rs1199219617 880 dbSNP
rs775919850 884 dbSNP
rs1438930592 892 dbSNP
rs1204205219 893 dbSNP
rs4700174 896 dbSNP
rs1259846334 897 dbSNP
rs760022372 907 dbSNP
rs1313082036 913 dbSNP
rs1170714069 915 dbSNP
rs774868251 919 dbSNP
rs566956175 920 dbSNP
rs111977927 924 dbSNP
rs1397927159 925 dbSNP
rs1443357972 926 dbSNP
rs1326884910 932 dbSNP
rs749344422 946 dbSNP
rs986512824 947 dbSNP
rs1272023776 953 dbSNP
rs189440421 955 dbSNP
rs114597185 963 dbSNP
rs1013386478 964 dbSNP
rs1470155514 965 dbSNP
rs1215153907 966 dbSNP
rs1315480693 970 dbSNP
rs993375665 975 dbSNP
rs1450718393 977 dbSNP
rs1196073725 979 dbSNP
rs961850877 990 dbSNP
rs1213275689 995 dbSNP
rs1016084575 996 dbSNP
rs1158143882 999 dbSNP
rs1005956409 1010 dbSNP
rs904965025 1012 dbSNP
rs879796252 1027 dbSNP
rs1421173433 1032 dbSNP
rs1462852650 1034 dbSNP
rs1453694446 1036 dbSNP
rs1013641904 1041 dbSNP
rs1390764397 1046 dbSNP
rs1189924642 1049 dbSNP
rs551413381 1053 dbSNP
rs1260443326 1055 dbSNP
rs1327170985 1057 dbSNP
rs1057364469 1063 dbSNP
rs1276918005 1068 dbSNP
rs375674538 1069 dbSNP
rs1234244424 1070 dbSNP
rs924767760 1070 dbSNP
rs538901009 1073 dbSNP
rs1355141656 1075 dbSNP
rs1207708701 1081 dbSNP
rs1043690855 1085 dbSNP
rs1043278293 1096 dbSNP
rs1192809358 1106 dbSNP
rs947596236 1107 dbSNP
rs571865502 1110 dbSNP
rs1258099850 1118 dbSNP
rs1232614879 1120 dbSNP
rs911468869 1122 dbSNP
rs376974414 1126 dbSNP
rs547347760 1128 dbSNP
rs1231262106 1131 dbSNP
rs1456581064 1133 dbSNP
rs1160575729 1134 dbSNP
rs1385733746 1136 dbSNP
rs576169945 1137 dbSNP
rs528781707 1138 dbSNP
rs954830777 1139 dbSNP
rs1404671957 1140 dbSNP
rs1310823499 1141 dbSNP
rs1292996102 1145 dbSNP
rs940421122 1154 dbSNP
rs1242130722 1156 dbSNP
rs923313112 1176 dbSNP
rs1262161858 1180 dbSNP
rs144839684 1185 dbSNP
rs961963111 1186 dbSNP
rs149395728 1191 dbSNP
rs1023519070 1196 dbSNP
rs1187684804 1199 dbSNP
rs78347415 1217 dbSNP
rs750348418 1224 dbSNP
rs1421889620 1227 dbSNP
rs1184212837 1231 dbSNP
rs969263395 1238 dbSNP
rs1023771879 1239 dbSNP
rs1439345732 1242 dbSNP
rs563642437 1245 dbSNP
rs1013340360 1252 dbSNP
rs545475712 1257 dbSNP
rs77443861 1258 dbSNP
rs1485510731 1259 dbSNP
rs1302822680 1262 dbSNP
rs559105537 1263 dbSNP
rs1400472766 1268 dbSNP
rs1393455775 1278 dbSNP
rs1052136639 1280 dbSNP
rs779984576 1281 dbSNP
rs1308183290 1308 dbSNP
rs1275816858 1309 dbSNP
rs999096358 1312 dbSNP
rs1207855440 1315 dbSNP
rs1306447481 1319 dbSNP
rs1338050125 1330 dbSNP
rs903462636 1333 dbSNP
rs757314356 1334 dbSNP
rs947506642 1336 dbSNP
rs1342473621 1338 dbSNP
rs71626488 1338 dbSNP
rs1197287068 1347 dbSNP
rs1050934931 1351 dbSNP
rs933440409 1353 dbSNP
rs1177082908 1357 dbSNP
rs1291739124 1360 dbSNP
rs750156069 1363 dbSNP
rs923262169 1363 dbSNP
rs934164015 1378 dbSNP
rs1376375464 1398 dbSNP
rs184108975 1399 dbSNP
rs540793091 1400 dbSNP
rs138900675 1404 dbSNP
rs1400109036 1409 dbSNP
rs78871774 1413 dbSNP
rs909105964 1422 dbSNP
rs984732908 1425 dbSNP
rs969588584 1436 dbSNP
rs1309648151 1437 dbSNP
rs1023509231 1443 dbSNP
rs1395745053 1444 dbSNP
rs769875585 1447 dbSNP
rs1310313061 1450 dbSNP
rs763578299 1453 dbSNP
rs1457200817 1456 dbSNP
rs760363720 1456 dbSNP
rs1363341836 1458 dbSNP
rs73104005 1459 dbSNP
rs1190625054 1469 dbSNP
rs999161204 1474 dbSNP
rs903527951 1476 dbSNP
rs1171800042 1477 dbSNP
rs1472725997 1482 dbSNP
rs916513438 1487 dbSNP
rs191873751 1491 dbSNP
rs767882463 1501 dbSNP
rs60756388 1510 dbSNP
rs1011868630 1515 dbSNP
rs529492072 1524 dbSNP
rs1030871874 1528 dbSNP
rs889274928 1530 dbSNP
rs1383841893 1533 dbSNP
rs1278808731 1540 dbSNP
rs978319520 1545 dbSNP
rs1216514118 1549 dbSNP
rs1274824156 1550 dbSNP
rs1322483334 1559 dbSNP
rs1221195939 1568 dbSNP
rs372937172 1575 dbSNP
rs1050644821 1582 dbSNP
rs933387909 1586 dbSNP
rs1210506066 1588 dbSNP
rs186785936 1589 dbSNP
rs1271368169 1591 dbSNP
rs1232851392 1600 dbSNP
rs1190444953 1607 dbSNP
rs1419041309 1608 dbSNP
rs1405592296 1610 dbSNP
rs1022299677 1621 dbSNP
rs1347591591 1624 dbSNP
rs1351374988 1627 dbSNP
rs1298295933 1638 dbSNP
rs1289955443 1640 dbSNP
rs1339687308 1644 dbSNP
rs115637395 1648 dbSNP
rs1294896015 1648 dbSNP
rs1379691827 1661 dbSNP
rs1036419230 1665 dbSNP
rs1227938348 1670 dbSNP
rs1335089382 1671 dbSNP
rs535457412 1672 dbSNP
rs1407027415 1681 dbSNP
rs1217370381 1685 dbSNP
rs182332066 1690 dbSNP
rs1487558045 1694 dbSNP
rs909218416 1695 dbSNP
rs1238401754 1704 dbSNP
rs1457413684 1705 dbSNP
rs985111588 1708 dbSNP
rs1413783876 1717 dbSNP
rs1160644530 1719 dbSNP
rs1411112559 1730 dbSNP
rs1420513261 1736 dbSNP
rs771393706 1741 dbSNP
rs1468987373 1756 dbSNP
rs1359415880 1759 dbSNP
rs1417770664 1760 dbSNP
rs1314713528 1768 dbSNP
rs1359493104 1770 dbSNP
rs571905840 1780 dbSNP
rs998472478 1792 dbSNP
rs1241157447 1794 dbSNP
rs1308624724 1794 dbSNP
rs1375728841 1794 dbSNP
rs375008029 1794 dbSNP
rs1442368800 1795 dbSNP
rs1232669808 1797 dbSNP
rs1200130970 1799 dbSNP
rs1458809674 1807 dbSNP
rs1178929917 1812 dbSNP
rs111562744 1813 dbSNP
rs1491541881 1813 dbSNP
rs200668571 1813 dbSNP
rs202026353 1813 dbSNP
rs749198086 1813 dbSNP
rs1037236089 1821 dbSNP
rs1331879501 1823 dbSNP
rs879751857 1823 dbSNP
rs1251180652 1824 dbSNP
rs992017751 1827 dbSNP
rs150636974 1831 dbSNP
rs193007387 1833 dbSNP
rs550049345 1833 dbSNP
rs1218046779 1834 dbSNP
rs796948244 1834 dbSNP
rs1275535581 1835 dbSNP
rs540596566 1835 dbSNP
rs947772015 1835 dbSNP
rs916271604 1839 dbSNP
rs1456187476 1840 dbSNP
rs977837660 1842 dbSNP
rs1246789955 1846 dbSNP
rs1168292816 1848 dbSNP
rs755916245 1848 dbSNP
rs756878147 1848 dbSNP
rs1330066132 1854 dbSNP
rs1324276395 1859 dbSNP
rs1465985933 1859 dbSNP
rs371908787 1859 dbSNP
rs565619007 1859 dbSNP
rs939314911 1861 dbSNP
rs1434914193 1867 dbSNP
rs967701006 1868 dbSNP
rs535202488 1873 dbSNP
rs923817445 1878 dbSNP
rs1349609137 1879 dbSNP
rs1021992648 1880 dbSNP
rs10037350 1881 dbSNP
rs889399428 1883 dbSNP
rs1315611744 1886 dbSNP
rs112418300 1889 dbSNP
rs1435258855 1895 dbSNP
rs1390382097 1901 dbSNP
rs1289956839 1905 dbSNP
rs1450591753 1906 dbSNP
rs112054917 1912 dbSNP
rs563699834 1914 dbSNP
rs1399770179 1918 dbSNP
rs1478112549 1919 dbSNP
rs551615384 1922 dbSNP
rs902028460 1925 dbSNP
rs748339470 1926 dbSNP
rs533264285 1927 dbSNP
rs940818619 1932 dbSNP
rs1164099220 1933 dbSNP
rs1390067162 1934 dbSNP
rs1403636649 1940 dbSNP
rs1300140530 1941 dbSNP
rs1393863269 1943 dbSNP
rs1399937938 1944 dbSNP
rs1193077279 1947 dbSNP
rs1465347600 1949 dbSNP
rs887769634 1950 dbSNP
rs559390238 1953 dbSNP
rs552513084 1954 dbSNP
rs1213846451 1959 dbSNP
rs540827930 1962 dbSNP
rs1284469567 1963 dbSNP
rs904963475 1965 dbSNP
rs1279030568 1970 dbSNP
rs947948754 1974 dbSNP
rs1207506147 1976 dbSNP
rs1287541950 1983 dbSNP
rs916478823 1985 dbSNP
rs573460248 1986 dbSNP
rs1260734468 1989 dbSNP
rs939126966 1992 dbSNP
rs1302665313 1994 dbSNP
rs961658682 1995 dbSNP
rs561874001 1997 dbSNP
rs533005652 1998 dbSNP
rs141549587 1999 dbSNP
rs1429545435 2002 dbSNP
rs967852282 2013 dbSNP
rs1044564984 2014 dbSNP
rs1296942572 2016 dbSNP
rs914872964 2033 dbSNP
rs985118717 2040 dbSNP
rs1335254704 2042 dbSNP
rs189140601 2046 dbSNP
rs1339441153 2047 dbSNP
rs1056139379 2049 dbSNP
rs938974299 2055 dbSNP
rs1353856579 2058 dbSNP
rs1239296891 2060 dbSNP
rs1283746615 2062 dbSNP
rs11740538 2074 dbSNP
rs1450661255 2080 dbSNP
rs1255222293 2081 dbSNP
rs34722794 2082 dbSNP
rs572194208 2087 dbSNP
rs1180811579 2088 dbSNP
rs966180156 2089 dbSNP
rs143612567 2093 dbSNP
rs1156966950 2103 dbSNP
rs946624173 2114 dbSNP
rs915101234 2124 dbSNP
rs1004912890 2126 dbSNP
rs113696175 2130 dbSNP
rs1449982536 2131 dbSNP
rs1332995971 2132 dbSNP
rs183293863 2136 dbSNP
rs191768798 2137 dbSNP
rs1012222055 2152 dbSNP
rs369007741 2169 dbSNP
rs961645396 2172 dbSNP
rs1056391697 2177 dbSNP
rs148873310 2179 dbSNP
rs1200728134 2183 dbSNP
rs145580578 2184 dbSNP
rs1176797073 2196 dbSNP
rs1005829648 2206 dbSNP
rs1434242033 2229 dbSNP
rs149692370 2230 dbSNP
rs1176033720 2232 dbSNP
rs952936642 2242 dbSNP
rs185965195 2244 dbSNP
rs757257712 2245 dbSNP
rs1171855831 2253 dbSNP
rs1379435046 2264 dbSNP
rs1400500368 2266 dbSNP
rs1294669812 2274 dbSNP
rs1295941853 2280 dbSNP
rs1412551233 2289 dbSNP
rs749296439 2292 dbSNP
rs1343600647 2299 dbSNP
rs1042267765 2300 dbSNP
rs1013054177 2312 dbSNP
rs1317456740 2316 dbSNP
rs946559605 2322 dbSNP
rs894896372 2323 dbSNP
rs1312684656 2329 dbSNP
rs1267274606 2331 dbSNP
rs1462915755 2332 dbSNP
rs565842096 2338 dbSNP
rs1056590920 2345 dbSNP
rs1356842460 2353 dbSNP
rs1265823362 2356 dbSNP
rs1479095629 2362 dbSNP
rs914968170 2368 dbSNP
rs1194752761 2379 dbSNP
rs547476602 2384 dbSNP
rs1167943642 2386 dbSNP
rs1409525993 2392 dbSNP
rs985621716 2393 dbSNP
rs1003225705 2395 dbSNP
rs1351086304 2398 dbSNP
rs529098763 2406 dbSNP
rs1292459139 2410 dbSNP
rs1363562125 2412 dbSNP
rs1401778066 2413 dbSNP
rs182508091 2425 dbSNP
rs1278608269 2426 dbSNP
rs1213006935 2430 dbSNP
rs139666295 2430 dbSNP
rs372855928 2430 dbSNP
rs1315052259 2435 dbSNP
rs561701207 2440 dbSNP
rs1474363136 2446 dbSNP
rs1256496531 2449 dbSNP
rs867594879 2452 dbSNP
rs755611037 2458 dbSNP
rs1218071899 2464 dbSNP
rs966297077 2474 dbSNP
rs1015030278 2481 dbSNP
rs190277011 2482 dbSNP
rs184930161 2486 dbSNP
rs1481565395 2488 dbSNP
rs180920539 2494 dbSNP
rs1415456743 2503 dbSNP
rs1027698108 2506 dbSNP
rs1012782573 2508 dbSNP
rs895138737 2516 dbSNP
rs1249607759 2518 dbSNP
rs1203735527 2521 dbSNP
rs1298790793 2536 dbSNP
rs1359850570 2541 dbSNP
rs1428340069 2543 dbSNP
rs1304378571 2556 dbSNP
rs1380088350 2558 dbSNP
rs190283125 2558 dbSNP
rs1321730833 2574 dbSNP
rs549588887 2580 dbSNP
rs893717472 2580 dbSNP
rs1003442374 2581 dbSNP
rs1231029358 2596 dbSNP
rs557897162 2600 dbSNP
rs545687947 2601 dbSNP
rs751915366 2604 dbSNP
rs1212600969 2609 dbSNP
rs946536185 2613 dbSNP
rs766783241 2622 dbSNP
rs1293039308 2624 dbSNP
rs1238421949 2626 dbSNP
rs1392393057 2629 dbSNP
rs1182665142 2635 dbSNP
rs1376162177 2636 dbSNP
rs1240707493 2637 dbSNP
rs1046988418 2640 dbSNP
rs1049489717 2644 dbSNP
rs1442137524 2645 dbSNP
rs763389480 2648 dbSNP
rs922260085 2651 dbSNP
rs574181642 2657 dbSNP
rs1167233771 2658 dbSNP
rs555941769 2669 dbSNP
rs537217489 2673 dbSNP
rs908581823 2674 dbSNP
rs140944380 2679 dbSNP
rs146455822 2690 dbSNP
rs1359596180 2696 dbSNP
rs1447533459 2697 dbSNP
rs952946376 2699 dbSNP
rs1023181099 2704 dbSNP
rs765324667 2705 dbSNP
rs1349085758 2712 dbSNP
rs1035852137 2716 dbSNP
rs6869921 2722 dbSNP
rs76900386 2723 dbSNP
rs746953110 2725 dbSNP
rs1488783059 2728 dbSNP
rs990905597 2729 dbSNP
rs1458819642 2733 dbSNP
rs553843339 2735 dbSNP
rs780123567 2746 dbSNP
rs1020612281 2747 dbSNP
rs535589476 2749 dbSNP
rs893727286 2750 dbSNP
rs1035121232 2767 dbSNP
rs1211331058 2779 dbSNP
rs1413649171 2781 dbSNP
rs1333688668 2782 dbSNP
rs1402641786 2792 dbSNP
rs1466346954 2793 dbSNP
rs529330192 2800 dbSNP
rs1049609284 2803 dbSNP
rs1240751031 2811 dbSNP
rs1439178894 2812 dbSNP
rs187470474 2825 dbSNP
rs1319046039 2831 dbSNP
rs1305340383 2833 dbSNP
rs6890674 2834 dbSNP
rs1372415786 2835 dbSNP
rs1327983991 2836 dbSNP
rs1020829470 2843 dbSNP
rs531359286 2844 dbSNP
rs1011280343 2849 dbSNP
rs1198959416 2855 dbSNP
rs564416080 2858 dbSNP
rs893633168 2865 dbSNP
rs1271642414 2871 dbSNP
rs1438878664 2883 dbSNP
rs61027241 2884 dbSNP
rs1040880797 2892 dbSNP
rs932402272 2894 dbSNP
rs182263512 2899 dbSNP
rs1040787399 2912 dbSNP
rs984122402 2918 dbSNP
rs1478266315 2922 dbSNP
rs1158153976 2926 dbSNP
rs1167593951 2928 dbSNP
rs1394638695 2942 dbSNP
rs372280555 2943 dbSNP
rs1324290767 2944 dbSNP
rs908253630 2945 dbSNP
rs1396874053 2949 dbSNP
rs1191201060 2955 dbSNP
rs1349754200 2962 dbSNP
rs916177058 2980 dbSNP
rs992182790 2984 dbSNP
rs1341566948 2993 dbSNP
rs80204023 3016 dbSNP
rs1269176739 3017 dbSNP
rs930918177 3023 dbSNP
rs1248121597 3029 dbSNP
rs1337075487 3032 dbSNP
rs1036309806 3037 dbSNP
rs1289984796 3041 dbSNP
rs1490161419 3042 dbSNP
rs1220248504 3044 dbSNP
rs756959276 3047 dbSNP
rs977612109 3051 dbSNP
rs1488520346 3053 dbSNP
rs920753229 3054 dbSNP
rs1192247238 3057 dbSNP
rs1371487752 3062 dbSNP
rs1206477973 3092 dbSNP
rs1484708128 3100 dbSNP
rs1259304143 3105 dbSNP
rs1163899174 3112 dbSNP
rs1384761232 3113 dbSNP
rs1215586466 3117 dbSNP
rs1349220054 3124 dbSNP
rs1361759398 3124 dbSNP
rs1399740280 3126 dbSNP
rs1316683898 3143 dbSNP
rs1324260078 3159 dbSNP
rs117510707 3166 dbSNP
rs1284269163 3168 dbSNP
rs1020623442 3170 dbSNP
rs143953810 3171 dbSNP
rs35078063 3180 dbSNP
rs893444363 3181 dbSNP
rs1204270637 3191 dbSNP
rs749197903 3194 dbSNP
rs139114585 3202 dbSNP
rs1027927294 3211 dbSNP
rs997206513 3212 dbSNP
rs1242586892 3213 dbSNP
rs1442807302 3215 dbSNP
rs1160564073 3220 dbSNP
rs1381401473 3222 dbSNP
rs1453688413 3223 dbSNP
rs1296421233 3230 dbSNP
rs901081769 3232 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected, 4-thiouridine, RNase T1 ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauACACGACGAu 5'
                      | ||||||| 
Target 5' ---------gccUAUGCUGCUg 3'
1 - 13
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000256447.4 | 3UTR | GCCUAUGCUGCUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.248 2.4e-2 -0.173 8.6e-2 64 Click to see details
GSE38226 Liver fibrosis 0.351 5.9e-2 0.208 1.8e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.36 5.9e-2 0.402 3.9e-2 20 Click to see details
GSE14794 Lymphoblastoid cells 0.163 6.2e-2 0.165 6.0e-2 90 Click to see details
GSE19536 Breast cancer -0.134 9.2e-2 -0.066 2.6e-1 100 Click to see details
GSE21849 B cell lymphoma 0.241 1.0e-1 0.301 5.6e-2 29 Click to see details
GSE19783 ER- ER- breast cancer -0.137 1.1e-1 -0.127 1.3e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.234 1.3e-1 -0.022 4.6e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.176 1.7e-1 -0.035 4.2e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.227 1.7e-1 0.430 2.9e-2 20 Click to see details
GSE28544 Breast cancer -0.17 2.1e-1 -0.351 4.6e-2 24 Click to see details
GSE27834 Pluripotent stem cells 0.122 3.3e-1 0.218 2.1e-1 16 Click to see details
GSE21032 Prostate cancer 0.048 3.3e-1 0.026 4.1e-1 83 Click to see details
GSE19350 CNS germ cell tumors -0.132 3.4e-1 -0.147 3.2e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.079 3.5e-1 0.025 4.5e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.101 3.7e-1 -0.099 3.7e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.069 3.7e-1 -0.216 1.6e-1 24 Click to see details
GSE17498 Multiple myeloma 0.027 4.3e-1 0.138 2.0e-1 40 Click to see details
GSE17306 Multiple myeloma 0.01 4.7e-1 0.086 2.8e-1 49 Click to see details
GSE17306 Multiple myeloma 0.01 4.7e-1 0.086 2.8e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.489 0 0.423 0 68 Click to see details
KICH 0.604 0 0.576 0 25 Click to see details
STAD 0.337 0.03 0.339 0.03 32 Click to see details
BLCA 0.415 0.04 0.368 0.07 18 Click to see details
THCA 0.173 0.1 0.206 0.06 59 Click to see details
KIRP 0.219 0.11 0.160 0.19 32 Click to see details
HNSC -0.172 0.14 -0.209 0.09 42 Click to see details
PRAD -0.143 0.16 -0.088 0.27 50 Click to see details
LIHC 0.142 0.17 0.121 0.2 49 Click to see details
PAAD 0.522 0.24 0.400 0.3 4 Click to see details
BRCA -0.072 0.26 -0.096 0.19 84 Click to see details
CESC -0.635 0.28 -0.500 0.33 3 Click to see details
LUAD 0.158 0.31 0.056 0.43 12 Click to see details
UCEC 0.119 0.31 0.232 0.17 19 Click to see details
ESCA -0.165 0.31 -0.036 0.46 11 Click to see details
PCPG -0.332 0.39 -0.500 0.33 3 Click to see details
LUSC 0.03 0.43 0.090 0.3 38 Click to see details
COAD 0.037 0.47 -0.143 0.37 8 Click to see details
CHOL 0.021 0.48 -0.067 0.43 9 Click to see details
CHOL 0.021 0.48 -0.067 0.43 9 Click to see details
CHOL 0.021 0.48 -0.067 0.43 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*