miRTarBase - #MIRT495146 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNRF1   
Synonyms NIN283
Description zinc and ring finger 1
Transcript NM_032268   
Expression
Putative miRNA Targets on ZNRF1
3'UTR of ZNRF1
(miRNA target sites are highlighted)
>ZNRF1|NM_032268|3'UTR
   1 CCTGCGGGCTTGCTTGCTGACTCCTCTCAAAGGGACAGAGCGCCCCTGCTCCAGGGAGGAGGCTCACCGGACCCTGGGGC
  81 AGAGCTGAGCTTGGGACACCAGCGGGAACAGGGCACCCCTTCTGCACTGACTTCCAGATCATGGTTCTCCCTTCCTCCCT
 161 GAGGACACCAAATTGGATGAGAGCAAGTTTGAGAGAAGAATGAATCAACTGCTATCCTTCCCCTCACCCCTCAGCCCAGG
 241 AGGGAAAGGGCATTTTCTTTTTCATCTTTGAAAGGCATTGTGGGTCTGTCTTTAAAGTGTTTACAAAAAAAAATTATATA
 321 AAAAAAAAGTCTAGTGTCGACTGGTGTTTTCCCTCGTGATGTTTACAGCTTGCTGTTTGCTGCCCAGCCATAACCCACTC
 401 AGTGACAGACGAACACAGCTAAGGCCTCGCTGCCAGCCTTCTGACGGCGGGCGAGCACACGGTCTCTTCCCCTGCCCCAA
 481 CTGGCCCTCTCCACCACCAACTTCTCTACTTTGGGTTTGTTTGGTTTTTTCCCTCTATTTTTCTGGCTGGTTTTTTGCTC
 561 TTTTCTCCCCTTGAGACCCTAATATCTTGACTTCATTGCCAAAAAACAACCCATTGAGAACTTTCTTCCTACTGATCCCA
 641 TCTCTTTTCCCTTCTTTCCTCCTGGTTCCGGTCAGTTCAGAGGATTTAACAATCACAAGTGTCCTGCAAAAATGCCTGAA
 721 CATTATTCTTAGGCCCTCGTGGATTTTTTTTTTCAGAAAACTTAAACAAAAAAAGACTTACTAAGAAATATGTACAGCTA
 801 CCCCTGTTTTCAGGCACTATGTTTGAGAACATTTTAGCCATTGATGTTCACACGTGGCATCAGCCCATGCAAGATAGGTT
 881 TCTGTATTTATATATTAAAATACAAAAAAAAACTTATAAAATGTTTAAAAAAATGTTCAAAGCTTGGGAGAAAAGCTTTC
 961 TTCATTAGTCAAGGTGTTTTGATATGGTATTAAAATGTCTAATAAAAGATGGCACTGCGTGATTTTATTTTAATGAAGTG
1041 TTATACAATCAAGAAATGGGGGCAAGGGCCTGCCCCCCACTCCCTCACCTACCTCCTTAGCATTCCTTCAGGCTGCTACT
1121 CGGGGCTCCAGGTGTGTGAATTGGTCCTCAGATAGTCAGGCCTGGGTGGAGGGAGTGGCAAGTCAGGCGTGCCTCCTACA
1201 AGCTTCCTAACCTCTTAAGCATCATGGAACCAGTCAGCCCTCTGTGGAGTCATTGTGCTGGACCTCTGAAAAGATCTGCA
1281 GGGGCCAAGATGTTGCAGCCACCGGAGGCTGCAAGGATGTGGGTTCTTCCAGGTGTGGGCCCAGCCCCCCTCCTTCCAGC
1361 CTTTGCTCCCCATCCCACGTTCCACTCGCCCTGCCTGTTGTTCAGTTTGCGTCTCAGTGCTGACTCACGGGCATGCTTCA
1441 TTGAGGCCCAGGAAGAGGCCCTGGTTTGGGGCTGTGCCAGCTCAGAGCCCTTGAACCAGAACCAACTGCTCAGGCTCACA
1521 AAAGTTGGCAAAATGCGGGCTGGGCAGGCAGCTCGGGGCAGGGAGCAGCAGTGCAGGCCTGGCCTGTGTCCCCGTGCCCA
1601 GCGGGCTCCCGGAGCAGCATTCCAGAGCCTCCTGCAGAGCCAGCGAAGGAAAGCTCTAGAGGGAGACGACTCCACCGCCT
1681 CTCTGCTCTGACCCTTCTCAGGCCCGCCTGATGTGCTGGACCATCCCCCTGCTGCCACGGCCCCTGGCTCCGCAGTCACC
1761 CTCCATCAGATGCTTCCAGAAGCACCTACTCTGTGCAAGGGCATTCACAACAGGCCAGTGGGCAAACGTGAGCCAGGGCC
1841 AGCGGAGAAACACTAAAGAAGACTCGGTGGTTCAGAGCCTGGGTCTCAGCGCGGGACCCGTCTGGGGTGAAGACCTTGGG
1921 GCTGTTGTGAGTCGGTGGCAGGAACGTGGGCTCTAGACTGTGCATTCAGGCTCTCCTACTTGGCAGAATGATCTTGGGGA
2001 AACGACTTCATCTGAACTTCAGATATTTCACATGTGAAGCGGGGACAAAACCATGCAGCTCAGAGGTCCCTGTGGGGGCT
2081 GGGGGAGCTGCCCTGCAGGTCTTGGCACATGCACAGCAGGCTCCCCATAGCTTTGTCACCACAAAGGGCACTGTTCTATT
2161 CACAGCACCTCCTGCTTCTGCCTGGCAACTGTGTCTCCCTGTGCTATATTTAATTCCACCAGCAAAGCTGGCGAGGCAGG
2241 GCCCAGCCCTGAAGGAGATCTCCTTGCCTGACCCCTGGACCTGGAAATGGAGGCTTCATGTGCCCGCCTTGGCGGCTTAA
2321 GCCTGCTGCTTTGGCAGTGCCATGGGTGAGCCGAGCAGCTGTGAGGTGGGTGGGGCAGGGCTGTAGCCCACGCCGGGTGC
2401 TATTCCAGGCTCTAGGGGCTGGTGCTCATCCCCACCCCCAGCGACTTCCGTCCTACCTGGCATGCTGCAGCCCTCTGCCG
2481 GCTGTGGTGTCCTCTGAATTTGGACCCAGGTTGCCTGCTCTTGTTGTGGGGGTGGGATTGGGGCTGTCTGTGTTTCCCAG
2561 GTGGAGCTCATGTTTGTGATCCTCTATCTGGACAGCTCTCCAGAATCCTGTGTTGCCCCTGTTCTGCCTTTCTGGGATGG
2641 GAGAGAAGGTGAGGGAGCCGGCGAGCAGGTTCTACCCTCTCTGCTAAGGGCCTAGCACACTTTGATGAGGTTCCTGGACG
2721 TGAGACCCTCACAAAGACCAACCATTCCTCTAATAGCCATTTAACGGTACTGCAGTTCATGGGAAAATGTCCTCATTCTT
2801 AGGAGATAGATGCTGGATTATATAGGTGAATGCCTTCAAGAAATGTGTAATTTAATTCCAAATAGTTCCCCCCAAAATAC
2881 ACAAAGCAAATAAGGCCAAAATGTTCATTGTTGAATCTGCAGTGGCTGGTATTTCAGTGAACAGTGTACTTGTTCTTTCA
2961 ACTTTTCTGTATGTTTGGAATTTTTCTTAATAAAAGATTGTGGGAAATGGTCATTTGCTGAGCGCCTCCTAGTTGCCAGG
3041 CACTGGAGGGCGCATCAAAGAAGAGTCCTACCCAGGAGGGAGAGCGCAGCTGCTGCAGGATTCTCGCCTGGAAGAGTGGG
3121 TGGCTGGCTGGCTGGCTGGAAGGGGAGGGGCGAGAGGGCTGTCTCGGTGATGAGCACACGCGTGCTGGGGTGGTTTGGGG
3201 AGAGGGCTGAGATTTGTCACCAGTGAGCCCTTGGCACGGTCTCTGCTCCCCACCAGGGCAGCACGGGACAGAAACGTCAC
3281 GGAGGAGTAGCCTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguAAUAC--ACGACGAu 5'
                   ||| |  ||||||| 
Target 5' cttggcggcTTAAGCCTGCTGCTt 3'
2308 - 2331 147.00 -12.70
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            ||: ::: |:| ||||||  
Target 5' taCAGCTTGCTGTTTGCTGCcc 3'
364 - 385 136.00 -12.80
3
miRNA  3' guGUUUGGUA-AUACACGACGau 5'
            :::|||||     ||||||  
Target 5' gcTGGACCATCCCCCTGCTGCca 3'
1715 - 1737 128.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN22293336 27 COSMIC
COSN27833631 111 COSMIC
COSN27163337 156 COSMIC
COSN25485295 635 COSMIC
COSN16534961 638 COSMIC
COSN9442234 640 COSMIC
COSN24397286 818 COSMIC
COSN24387250 1183 COSMIC
COSN31524511 1231 COSMIC
COSN20796993 1265 COSMIC
COSN31527572 1368 COSMIC
COSN26641696 1442 COSMIC
COSN30554802 1475 COSMIC
COSN31563861 1475 COSMIC
COSN31608801 1476 COSMIC
COSN30587375 1490 COSMIC
COSN31597497 1490 COSMIC
COSN31565205 1493 COSMIC
COSN31603070 1517 COSMIC
COSN31523747 1524 COSMIC
COSN31513072 1557 COSMIC
COSN28821460 1562 COSMIC
COSN28763325 1611 COSMIC
COSN31564586 1654 COSMIC
COSN31584003 1768 COSMIC
COSN20113085 1915 COSMIC
COSN30175666 1936 COSMIC
COSN30540358 1954 COSMIC
COSN31531492 2074 COSMIC
COSN31592926 2074 COSMIC
COSN15600356 2238 COSMIC
COSN16128397 2283 COSMIC
COSN6094217 2459 COSMIC
COSN24018373 2912 COSMIC
COSN26576844 2980 COSMIC
COSN31565209 2995 COSMIC
COSN21029807 3022 COSMIC
COSN26635089 3032 COSMIC
COSN19335993 3145 COSMIC
COSN25059860 3388 COSMIC
COSN6094218 3554 COSMIC
COSN20113086 3656 COSMIC
COSN20093163 3821 COSMIC
COSN32058024 3861 COSMIC
COSN27540080 4386 COSMIC
COSN20113088 4392 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1403884304 2 dbSNP
rs1278293325 3 dbSNP
rs374922840 4 dbSNP
rs745787665 5 dbSNP
rs755942523 7 dbSNP
rs780074949 8 dbSNP
rs748990838 9 dbSNP
rs1420313389 10 dbSNP
rs369367044 13 dbSNP
rs1474354734 17 dbSNP
rs1284766079 20 dbSNP
rs1188337468 23 dbSNP
rs1321003257 24 dbSNP
rs1037470788 27 dbSNP
rs773539294 40 dbSNP
rs371861242 41 dbSNP
rs375237658 42 dbSNP
rs776794702 43 dbSNP
rs759693737 44 dbSNP
rs1212307324 47 dbSNP
rs377573668 48 dbSNP
rs1202420890 51 dbSNP
rs369855759 52 dbSNP
rs1278145876 57 dbSNP
rs541882267 58 dbSNP
rs898940690 65 dbSNP
rs1357727977 69 dbSNP
rs1357919385 73 dbSNP
rs1447561239 73 dbSNP
rs1234372505 74 dbSNP
rs943479830 75 dbSNP
rs1408304805 79 dbSNP
rs1399389539 81 dbSNP
rs995922255 90 dbSNP
rs1029106029 94 dbSNP
rs890121475 97 dbSNP
rs1009603559 99 dbSNP
rs555418731 102 dbSNP
rs1031265275 110 dbSNP
rs572032716 111 dbSNP
rs1234260637 113 dbSNP
rs541338477 123 dbSNP
rs1022450937 124 dbSNP
rs1456914111 128 dbSNP
rs1043058079 129 dbSNP
rs1261520675 135 dbSNP
rs1483007717 137 dbSNP
rs1291759810 142 dbSNP
rs1228116997 152 dbSNP
rs1374283293 158 dbSNP
rs969905826 162 dbSNP
rs564423736 165 dbSNP
rs1440350343 167 dbSNP
rs776176038 170 dbSNP
rs1259637201 181 dbSNP
rs927993265 181 dbSNP
rs188286109 182 dbSNP
rs543278289 186 dbSNP
rs563467651 187 dbSNP
rs1417058429 194 dbSNP
rs907809694 195 dbSNP
rs1160909534 204 dbSNP
rs533618388 211 dbSNP
rs1033684438 212 dbSNP
rs959444833 215 dbSNP
rs940588466 219 dbSNP
rs868194662 240 dbSNP
rs1355629639 245 dbSNP
rs1175088208 246 dbSNP
rs529383448 247 dbSNP
rs370790796 248 dbSNP
rs369122494 249 dbSNP
rs1016710043 251 dbSNP
rs1470171620 257 dbSNP
rs1264230971 259 dbSNP
rs898987659 265 dbSNP
rs931759476 267 dbSNP
rs547325319 271 dbSNP
rs1415968256 273 dbSNP
rs972652672 276 dbSNP
rs1349084659 284 dbSNP
rs77869940 285 dbSNP
rs142427288 287 dbSNP
rs1304182985 291 dbSNP
rs1443206523 293 dbSNP
rs1030646812 294 dbSNP
rs1292848607 295 dbSNP
rs1431443246 297 dbSNP
rs1346740762 304 dbSNP
rs892743920 322 dbSNP
rs1011149861 324 dbSNP
rs1022505040 337 dbSNP
rs969580656 338 dbSNP
rs985127815 339 dbSNP
rs1174925797 341 dbSNP
rs1282605744 354 dbSNP
rs1348642700 357 dbSNP
rs192842861 360 dbSNP
rs781075693 361 dbSNP
rs1486519396 363 dbSNP
rs1244183637 365 dbSNP
rs1214928208 366 dbSNP
rs1353174030 376 dbSNP
rs1479574351 383 dbSNP
rs150954418 392 dbSNP
rs961047434 393 dbSNP
rs982765285 396 dbSNP
rs908532214 397 dbSNP
rs1215073471 398 dbSNP
rs1042608085 399 dbSNP
rs1434788877 401 dbSNP
rs537729093 410 dbSNP
rs773116473 413 dbSNP
rs796571991 419 dbSNP
rs1432528888 420 dbSNP
rs748129551 422 dbSNP
rs1055047413 423 dbSNP
rs1306106255 426 dbSNP
rs1444921432 426 dbSNP
rs895175885 427 dbSNP
rs1422278275 428 dbSNP
rs1367296074 435 dbSNP
rs550916070 447 dbSNP
rs931837594 453 dbSNP
rs1050653959 467 dbSNP
rs1213286256 469 dbSNP
rs756065785 473 dbSNP
rs1371890452 474 dbSNP
rs911661581 476 dbSNP
rs1228248918 485 dbSNP
rs1272485961 487 dbSNP
rs944417624 488 dbSNP
rs1276248094 489 dbSNP
rs1305704005 490 dbSNP
rs116557163 493 dbSNP
rs1294975401 500 dbSNP
rs185338937 505 dbSNP
rs1401075079 515 dbSNP
rs892128422 517 dbSNP
rs777500663 519 dbSNP
rs1356740029 527 dbSNP
rs1251702960 532 dbSNP
rs538629227 544 dbSNP
rs1011202055 545 dbSNP
rs1043984791 548 dbSNP
rs762794477 549 dbSNP
rs1255772671 552 dbSNP
rs1196403238 556 dbSNP
rs905411041 557 dbSNP
rs1256277279 558 dbSNP
rs1254491335 563 dbSNP
rs1002390036 567 dbSNP
rs1035575359 570 dbSNP
rs1242351148 573 dbSNP
rs985413035 578 dbSNP
rs1187410644 584 dbSNP
rs960801646 585 dbSNP
rs1374008794 587 dbSNP
rs1412162914 590 dbSNP
rs1465508949 591 dbSNP
rs749037730 592 dbSNP
rs957052445 597 dbSNP
rs989867572 605 dbSNP
rs555457450 610 dbSNP
rs912989361 616 dbSNP
rs1421179477 621 dbSNP
rs1236423077 623 dbSNP
rs989925 624 dbSNP
rs376504589 628 dbSNP
rs920535150 630 dbSNP
rs369416196 638 dbSNP
rs953392274 639 dbSNP
rs534648510 640 dbSNP
rs986003292 652 dbSNP
rs1261134641 654 dbSNP
rs911698750 656 dbSNP
rs1364117326 662 dbSNP
rs1055333706 664 dbSNP
rs1441043309 665 dbSNP
rs1372296504 666 dbSNP
rs1216294775 669 dbSNP
rs368608435 671 dbSNP
rs773937964 688 dbSNP
rs1385628351 689 dbSNP
rs535487238 691 dbSNP
rs897238936 692 dbSNP
rs1378706326 698 dbSNP
rs1211598073 702 dbSNP
rs1255015263 706 dbSNP
rs1196625971 708 dbSNP
rs1451024559 710 dbSNP
rs1262096489 711 dbSNP
rs1274757710 717 dbSNP
rs149653867 720 dbSNP
rs1029907243 722 dbSNP
rs1207668543 722 dbSNP
rs890984320 724 dbSNP
rs555145573 725 dbSNP
rs111265902 735 dbSNP
rs112442142 740 dbSNP
rs1187674465 744 dbSNP
rs1358804795 757 dbSNP
rs771751160 765 dbSNP
rs1435615432 768 dbSNP
rs1427350192 776 dbSNP
rs1413695899 783 dbSNP
rs905462802 784 dbSNP
rs543664977 789 dbSNP
rs1002851038 790 dbSNP
rs1019985046 803 dbSNP
rs967531878 819 dbSNP
rs1167570823 829 dbSNP
rs981238998 838 dbSNP
rs371947725 839 dbSNP
rs776119271 841 dbSNP
rs373202619 843 dbSNP
rs1486479520 847 dbSNP
rs1275827470 850 dbSNP
rs1344879794 850 dbSNP
rs928111267 850 dbSNP
rs960874391 852 dbSNP
rs991008438 862 dbSNP
rs1004295865 863 dbSNP
rs1316453801 868 dbSNP
rs916833308 869 dbSNP
rs941330855 903 dbSNP
rs1361118136 908 dbSNP
rs1332229306 914 dbSNP
rs1413998245 919 dbSNP
rs1347086640 922 dbSNP
rs1038769120 926 dbSNP
rs1476836446 935 dbSNP
rs1422635423 937 dbSNP
rs1188411141 939 dbSNP
rs1473539245 944 dbSNP
rs376356780 949 dbSNP
rs1235415373 950 dbSNP
rs1431568898 952 dbSNP
rs573731296 953 dbSNP
rs1302271895 962 dbSNP
rs1354758100 966 dbSNP
rs930031749 976 dbSNP
rs1208744632 986 dbSNP
rs1015635846 989 dbSNP
rs370783234 996 dbSNP
rs374108067 997 dbSNP
rs1234318419 1001 dbSNP
rs890932965 1002 dbSNP
rs962735799 1005 dbSNP
rs995538176 1006 dbSNP
rs756209235 1014 dbSNP
rs1231330188 1017 dbSNP
rs1028721816 1024 dbSNP
rs537569183 1035 dbSNP
rs953347315 1038 dbSNP
rs986445794 1042 dbSNP
rs1011541635 1045 dbSNP
rs147777708 1055 dbSNP
rs189197552 1058 dbSNP
rs987937581 1061 dbSNP
rs547070061 1062 dbSNP
rs1238124164 1064 dbSNP
rs1223007565 1069 dbSNP
rs1323844126 1070 dbSNP
rs1288252784 1071 dbSNP
rs1227943112 1072 dbSNP
rs1351685809 1073 dbSNP
rs761217184 1077 dbSNP
rs551389605 1078 dbSNP
rs1035463768 1081 dbSNP
rs979145468 1087 dbSNP
rs141405429 1095 dbSNP
rs1347899174 1098 dbSNP
rs376977987 1100 dbSNP
rs1163884077 1104 dbSNP
rs1400869873 1106 dbSNP
rs370293056 1107 dbSNP
rs567768149 1113 dbSNP
rs1157117831 1120 dbSNP
rs940202226 1130 dbSNP
rs1037136181 1133 dbSNP
rs962929233 1134 dbSNP
rs536899185 1140 dbSNP
rs995981707 1146 dbSNP
rs1363422074 1147 dbSNP
rs1221298349 1150 dbSNP
rs763203936 1154 dbSNP
rs1490432226 1155 dbSNP
rs1353040574 1156 dbSNP
rs1289046600 1157 dbSNP
rs764559056 1159 dbSNP
rs751205946 1160 dbSNP
rs1051590129 1161 dbSNP
rs1341597403 1169 dbSNP
rs764730257 1170 dbSNP
rs1486097253 1171 dbSNP
rs1431229326 1172 dbSNP
rs1168536355 1175 dbSNP
rs1290066522 1175 dbSNP
rs767167228 1176 dbSNP
rs1217668710 1181 dbSNP
rs1262693919 1183 dbSNP
rs1408293902 1184 dbSNP
rs547209756 1192 dbSNP
rs1204631531 1193 dbSNP
rs1256872623 1200 dbSNP
rs1177617401 1201 dbSNP
rs1008189570 1203 dbSNP
rs942798325 1204 dbSNP
rs1445180841 1207 dbSNP
rs376059968 1213 dbSNP
rs892999338 1214 dbSNP
rs1383189426 1215 dbSNP
rs1301741229 1216 dbSNP
rs1212343399 1219 dbSNP
rs1443757703 1222 dbSNP
rs1159453626 1227 dbSNP
rs1346591205 1228 dbSNP
rs1011896735 1230 dbSNP
rs965922243 1231 dbSNP
rs1451092015 1232 dbSNP
rs1219216858 1235 dbSNP
rs1287792166 1236 dbSNP
rs1406109199 1246 dbSNP
rs1455081794 1248 dbSNP
rs1313513705 1250 dbSNP
rs1382570249 1251 dbSNP
rs1398938083 1257 dbSNP
rs987993000 1258 dbSNP
rs1224676185 1260 dbSNP
rs779836145 1261 dbSNP
rs557889045 1265 dbSNP
rs114092681 1266 dbSNP
rs1464127876 1268 dbSNP
rs1238529323 1270 dbSNP
rs1020782614 1271 dbSNP
rs1256686883 1274 dbSNP
rs1462680497 1278 dbSNP
rs1205530477 1279 dbSNP
rs1241183353 1281 dbSNP
rs1460756382 1284 dbSNP
rs1270253670 1295 dbSNP
rs967853760 1301 dbSNP
rs534674802 1305 dbSNP
rs1477581097 1311 dbSNP
rs147006605 1320 dbSNP
rs1257150936 1326 dbSNP
rs1416959835 1331 dbSNP
rs776988005 1333 dbSNP
rs1429425880 1335 dbSNP
rs1470656137 1337 dbSNP
rs1482299660 1338 dbSNP
rs902825675 1341 dbSNP
rs1335392049 1343 dbSNP
rs1272150689 1344 dbSNP
rs1405991737 1355 dbSNP
rs1443483341 1358 dbSNP
rs1300284780 1360 dbSNP
rs1002545513 1361 dbSNP
rs937678555 1363 dbSNP
rs1217815473 1365 dbSNP
rs1035368845 1370 dbSNP
rs138222810 1380 dbSNP
rs1393972022 1399 dbSNP
rs1377806405 1401 dbSNP
rs1331511166 1410 dbSNP
rs918183492 1412 dbSNP
rs1023739078 1416 dbSNP
rs1168933012 1419 dbSNP
rs1465412697 1424 dbSNP
rs1175511679 1438 dbSNP
rs1167169446 1439 dbSNP
rs540127697 1440 dbSNP
rs1255485428 1442 dbSNP
rs35844434 1443 dbSNP
rs553698192 1445 dbSNP
rs536947554 1456 dbSNP
rs1326626899 1457 dbSNP
rs111852866 1466 dbSNP
rs1197991888 1466 dbSNP
rs78479436 1466 dbSNP
rs77677435 1467 dbSNP
rs898657727 1479 dbSNP
rs1025911989 1480 dbSNP
rs1309273839 1481 dbSNP
rs1442537042 1481 dbSNP
rs78142157 1482 dbSNP
rs569217801 1483 dbSNP
rs1379699258 1487 dbSNP
rs1302208382 1488 dbSNP
rs1391890182 1490 dbSNP
rs1368218319 1492 dbSNP
rs1295663585 1493 dbSNP
rs1050273391 1500 dbSNP
rs889842212 1501 dbSNP
rs1008658114 1506 dbSNP
rs1280346302 1515 dbSNP
rs1041044546 1518 dbSNP
rs573842432 1522 dbSNP
rs1452169896 1523 dbSNP
rs901786417 1526 dbSNP
rs912609139 1528 dbSNP
rs942745882 1550 dbSNP
rs1487932683 1551 dbSNP
rs1009474898 1558 dbSNP
rs758449252 1568 dbSNP
rs75898757 1572 dbSNP
rs1438733612 1573 dbSNP
rs1238888142 1576 dbSNP
rs565486008 1583 dbSNP
rs947259693 1584 dbSNP
rs1033855987 1591 dbSNP
rs572881373 1607 dbSNP
rs959126295 1608 dbSNP
rs751668055 1610 dbSNP
rs78267590 1611 dbSNP
rs1158086592 1614 dbSNP
rs1056721665 1615 dbSNP
rs1379332513 1619 dbSNP
rs1196423754 1620 dbSNP
rs1432366526 1621 dbSNP
rs545065421 1623 dbSNP
rs972954634 1624 dbSNP
rs372230745 1632 dbSNP
rs1284598360 1639 dbSNP
rs1012606670 1642 dbSNP
rs1015978303 1643 dbSNP
rs530889502 1646 dbSNP
rs920138647 1649 dbSNP
rs1231760332 1651 dbSNP
rs1345272578 1653 dbSNP
rs1279302401 1658 dbSNP
rs778276676 1660 dbSNP
rs761702393 1662 dbSNP
rs1415132145 1666 dbSNP
rs995690477 1673 dbSNP
rs1170735516 1674 dbSNP
rs1026280723 1677 dbSNP
rs777697226 1681 dbSNP
rs1187872186 1686 dbSNP
rs544279388 1686 dbSNP
rs951661009 1686 dbSNP
rs1442589883 1687 dbSNP
rs1443607299 1692 dbSNP
rs1275976982 1693 dbSNP
rs1199235307 1694 dbSNP
rs561667345 1712 dbSNP
rs541855384 1713 dbSNP
rs1220882274 1714 dbSNP
rs1316242980 1720 dbSNP
rs1325320219 1738 dbSNP
rs1449086767 1744 dbSNP
rs1049892263 1747 dbSNP
rs554696845 1748 dbSNP
rs1332286826 1753 dbSNP
rs1400974716 1756 dbSNP
rs911314040 1761 dbSNP
rs944119193 1771 dbSNP
rs1019615351 1774 dbSNP
rs749099174 1775 dbSNP
rs891793586 1784 dbSNP
rs535924382 1790 dbSNP
rs1009527270 1793 dbSNP
rs530316621 1799 dbSNP
rs1473609579 1808 dbSNP
rs1340588916 1810 dbSNP
rs903737750 1811 dbSNP
rs1001120953 1821 dbSNP
rs947174888 1825 dbSNP
rs977274893 1828 dbSNP
rs181847654 1831 dbSNP
rs1272814118 1832 dbSNP
rs1229045356 1833 dbSNP
rs757070716 1837 dbSNP
rs959411214 1840 dbSNP
rs1282460335 1849 dbSNP
rs1245362692 1858 dbSNP
rs1377802531 1860 dbSNP
rs1013279267 1862 dbSNP
rs938593724 1863 dbSNP
rs371326162 1870 dbSNP
rs961028774 1871 dbSNP
rs948406445 1879 dbSNP
rs972338477 1880 dbSNP
rs1406678361 1882 dbSNP
rs1411229823 1896 dbSNP
rs920183702 1899 dbSNP
rs1037372506 1900 dbSNP
rs952968547 1901 dbSNP
rs1374718907 1904 dbSNP
rs144174567 1905 dbSNP
rs34340776 1905 dbSNP
rs993684863 1905 dbSNP
rs567034097 1906 dbSNP
rs1475668509 1913 dbSNP
rs1163975566 1915 dbSNP
rs1232598105 1916 dbSNP
rs1415343912 1920 dbSNP
rs779136095 1921 dbSNP
rs1047211834 1924 dbSNP
rs1222071201 1925 dbSNP
rs1289830023 1925 dbSNP
rs1326145972 1925 dbSNP
rs1383695065 1929 dbSNP
rs1354494946 1932 dbSNP
rs778600306 1935 dbSNP
rs528201704 1943 dbSNP
rs1237800329 1947 dbSNP
rs1319645658 1948 dbSNP
rs551447210 1953 dbSNP
rs1372537058 1960 dbSNP
rs1275183247 1962 dbSNP
rs1327540890 1963 dbSNP
rs745559390 1964 dbSNP
rs1008457296 1965 dbSNP
rs571249473 1967 dbSNP
rs986056244 1981 dbSNP
rs911382276 1982 dbSNP
rs964001337 1994 dbSNP
rs1407916859 1995 dbSNP
rs1337362310 2004 dbSNP
rs1234184897 2015 dbSNP
rs771873863 2016 dbSNP
rs1484971541 2020 dbSNP
rs1198948732 2021 dbSNP
rs867522605 2022 dbSNP
rs996859226 2031 dbSNP
rs1041148430 2035 dbSNP
rs1262460318 2036 dbSNP
rs185095255 2038 dbSNP
rs1316218896 2039 dbSNP
rs1279222863 2046 dbSNP
rs913283052 2046 dbSNP
rs1220918069 2054 dbSNP
rs946041195 2055 dbSNP
rs1043051781 2064 dbSNP
rs199605180 2065 dbSNP
rs968828542 2065 dbSNP
rs1400156606 2074 dbSNP
rs1452398226 2075 dbSNP
rs924454935 2075 dbSNP
rs977933304 2075 dbSNP
rs1359276914 2077 dbSNP
rs1177420363 2078 dbSNP
rs35102885 2078 dbSNP
rs903789063 2079 dbSNP
rs960156768 2080 dbSNP
rs1478248500 2081 dbSNP
rs750463193 2085 dbSNP
rs1185054556 2088 dbSNP
rs992679382 2088 dbSNP
rs936587155 2089 dbSNP
rs948354743 2095 dbSNP
rs973678441 2100 dbSNP
rs534268758 2101 dbSNP
rs1037319067 2102 dbSNP
rs1262230866 2116 dbSNP
rs920280743 2126 dbSNP
rs188248159 2134 dbSNP
rs1375706015 2147 dbSNP
rs1055401234 2159 dbSNP
rs1381367923 2161 dbSNP
rs1362869289 2162 dbSNP
rs887262029 2166 dbSNP
rs1159816254 2169 dbSNP
rs1384996538 2171 dbSNP
rs554022530 2172 dbSNP
rs894973536 2177 dbSNP
rs1008403558 2178 dbSNP
rs1466449907 2179 dbSNP
rs180939034 2180 dbSNP
rs1024686725 2181 dbSNP
rs1357822043 2205 dbSNP
rs567578821 2206 dbSNP
rs536114099 2208 dbSNP
rs149084933 2210 dbSNP
rs1026631851 2212 dbSNP
rs1242425843 2217 dbSNP
rs953106257 2218 dbSNP
rs1261428856 2220 dbSNP
rs375689918 2227 dbSNP
rs186243071 2231 dbSNP
rs1321955504 2234 dbSNP
rs1314200140 2238 dbSNP
rs965539686 2240 dbSNP
rs1032190577 2241 dbSNP
rs976886395 2244 dbSNP
rs1486575108 2245 dbSNP
rs1336616912 2246 dbSNP
rs544382161 2248 dbSNP
rs766608233 2250 dbSNP
rs946091864 2251 dbSNP
rs559057469 2255 dbSNP
rs73615834 2261 dbSNP
rs925967294 2262 dbSNP
rs1296825793 2267 dbSNP
rs936622065 2277 dbSNP
rs1369288267 2279 dbSNP
rs969944583 2280 dbSNP
rs1442820364 2282 dbSNP
rs973759798 2283 dbSNP
rs1183493027 2284 dbSNP
rs920247312 2290 dbSNP
rs928984494 2293 dbSNP
rs1248070099 2306 dbSNP
rs1055050456 2308 dbSNP
rs554060767 2311 dbSNP
rs762207064 2324 dbSNP
rs879633369 2328 dbSNP
rs895030375 2331 dbSNP
rs1041231858 2334 dbSNP
rs1358107205 2340 dbSNP
rs949234295 2346 dbSNP
rs554380274 2349 dbSNP
rs766420869 2350 dbSNP
rs1043714433 2351 dbSNP
rs1391154922 2355 dbSNP
rs904499320 2359 dbSNP
rs896932180 2360 dbSNP
rs1423040512 2361 dbSNP
rs993866217 2365 dbSNP
rs1307962902 2384 dbSNP
rs773644560 2386 dbSNP
rs888117579 2394 dbSNP
rs1362015653 2397 dbSNP
rs1006929248 2401 dbSNP
rs1018538787 2402 dbSNP
rs1232191840 2404 dbSNP
rs1282494735 2405 dbSNP
rs8059093 2421 dbSNP
rs575848016 2422 dbSNP
rs1286027229 2424 dbSNP
rs1218188109 2425 dbSNP
rs1347982449 2426 dbSNP
rs1250585803 2428 dbSNP
rs374974744 2430 dbSNP
rs1332027304 2433 dbSNP
rs1197242704 2435 dbSNP
rs1014329726 2438 dbSNP
rs976938621 2439 dbSNP
rs746475031 2445 dbSNP
rs969880836 2454 dbSNP
rs1020448778 2457 dbSNP
rs75843977 2461 dbSNP
rs1027990257 2463 dbSNP
rs1431087711 2464 dbSNP
rs950380624 2465 dbSNP
rs983515457 2466 dbSNP
rs978864382 2471 dbSNP
rs1444771450 2474 dbSNP
rs372087608 2479 dbSNP
rs375339073 2481 dbSNP
rs768245689 2483 dbSNP
rs1463852269 2489 dbSNP
rs1332389729 2491 dbSNP
rs560669987 2492 dbSNP
rs991869330 2493 dbSNP
rs533604289 2494 dbSNP
rs949285280 2499 dbSNP
rs1323339462 2501 dbSNP
rs78114023 2502 dbSNP
rs1219787483 2506 dbSNP
rs1433235817 2506 dbSNP
rs1294750484 2507 dbSNP
rs1305619408 2508 dbSNP
rs918412410 2511 dbSNP
rs751578247 2512 dbSNP
rs1467770206 2513 dbSNP
rs1048146406 2514 dbSNP
rs1474229703 2517 dbSNP
rs1371928639 2525 dbSNP
rs552484633 2531 dbSNP
rs1187674921 2538 dbSNP
rs932823423 2540 dbSNP
rs1043274309 2541 dbSNP
rs1202372620 2548 dbSNP
rs1461142425 2549 dbSNP
rs1488514500 2549 dbSNP
rs888160258 2550 dbSNP
rs1006572940 2553 dbSNP
rs571353099 2555 dbSNP
rs536547727 2557 dbSNP
rs530499705 2559 dbSNP
rs1312824447 2564 dbSNP
rs1451893336 2565 dbSNP
rs1053525029 2566 dbSNP
rs764090391 2572 dbSNP
rs753764206 2573 dbSNP
rs998427168 2586 dbSNP
rs1430758680 2590 dbSNP
rs143154041 2591 dbSNP
rs1445891299 2592 dbSNP
rs1417546409 2595 dbSNP
rs1460106848 2598 dbSNP
rs1023026745 2602 dbSNP
rs372256019 2603 dbSNP
rs995089141 2610 dbSNP
rs1207107148 2612 dbSNP
rs1027524501 2614 dbSNP
rs1350594046 2616 dbSNP
rs950691404 2620 dbSNP
rs1430099057 2622 dbSNP
rs1287121812 2626 dbSNP
rs1000735636 2633 dbSNP
rs1377594150 2634 dbSNP
rs1018608413 2641 dbSNP
rs1439723524 2642 dbSNP
rs1334991962 2645 dbSNP
rs1323806785 2652 dbSNP
rs1426225427 2658 dbSNP
rs965713408 2664 dbSNP
rs974467012 2667 dbSNP
rs921682283 2673 dbSNP
rs1033108799 2676 dbSNP
rs1468916749 2678 dbSNP
rs1232719099 2687 dbSNP
rs1216205161 2691 dbSNP
rs796084213 2691 dbSNP
rs369096785 2698 dbSNP
rs1333855388 2699 dbSNP
rs1286220601 2702 dbSNP
rs991528172 2704 dbSNP
rs917234179 2707 dbSNP
rs1222072315 2714 dbSNP
rs567117803 2716 dbSNP
rs981992609 2717 dbSNP
rs918464908 2720 dbSNP
rs1406326309 2724 dbSNP
rs1321880182 2728 dbSNP
rs979328588 2733 dbSNP
rs1301942813 2735 dbSNP
rs1214479517 2738 dbSNP
rs929835624 2739 dbSNP
rs1400061322 2741 dbSNP
rs1239814381 2746 dbSNP
rs1346519081 2746 dbSNP
rs1048677893 2752 dbSNP
rs909652487 2753 dbSNP
rs942427832 2754 dbSNP
rs1194989300 2755 dbSNP
rs757055974 2756 dbSNP
rs1474421223 2764 dbSNP
rs547307162 2765 dbSNP
rs1044427055 2767 dbSNP
rs1213489270 2769 dbSNP
rs1316276141 2772 dbSNP
rs750264812 2773 dbSNP
rs758059075 2779 dbSNP
rs997809623 2794 dbSNP
rs1400280445 2796 dbSNP
rs1049352356 2798 dbSNP
rs1041998998 2804 dbSNP
rs11647917 2806 dbSNP
rs1363373080 2815 dbSNP
rs746511805 2818 dbSNP
rs1401821385 2820 dbSNP
rs1000386991 2829 dbSNP
rs1033576095 2830 dbSNP
rs1471142799 2831 dbSNP
rs1427717789 2834 dbSNP
rs958846336 2836 dbSNP
rs1175960281 2837 dbSNP
rs1013409705 2838 dbSNP
rs1184892560 2840 dbSNP
rs544431987 2841 dbSNP
rs1485476748 2842 dbSNP
rs1005178092 2848 dbSNP
rs1205531910 2852 dbSNP
rs1024300294 2854 dbSNP
rs1018891245 2858 dbSNP
rs971373836 2861 dbSNP
rs768319382 2866 dbSNP
rs1298718751 2867 dbSNP
rs536818035 2868 dbSNP
rs566427273 2870 dbSNP
rs995849640 2872 dbSNP
rs918517217 2874 dbSNP
rs1213454010 2875 dbSNP
rs1412708312 2876 dbSNP
rs1382935961 2878 dbSNP
rs1028695810 2886 dbSNP
rs1455110090 2887 dbSNP
rs968197843 2889 dbSNP
rs1336492988 2892 dbSNP
rs1462653536 2900 dbSNP
rs1356643531 2901 dbSNP
rs951352758 2903 dbSNP
rs983996588 2908 dbSNP
rs926099629 2912 dbSNP
rs956252737 2913 dbSNP
rs909695900 2921 dbSNP
rs1442702764 2922 dbSNP
rs1242260016 2924 dbSNP
rs917509098 2931 dbSNP
rs77172128 2932 dbSNP
rs927339776 2939 dbSNP
rs1280235027 2940 dbSNP
rs975161025 2941 dbSNP
rs1484936891 2944 dbSNP
rs930710543 2945 dbSNP
rs1049158162 2946 dbSNP
rs1238362057 2948 dbSNP
rs886247084 2960 dbSNP
rs748553320 2973 dbSNP
rs1004722049 2988 dbSNP
rs1410332336 2989 dbSNP
rs1296667004 2990 dbSNP
rs770360725 2995 dbSNP
rs1429359824 2996 dbSNP
rs189907119 3005 dbSNP
rs755362008 3006 dbSNP
rs1173014878 3008 dbSNP
rs1165580279 3012 dbSNP
rs1422611824 3015 dbSNP
rs542206414 3017 dbSNP
rs996131554 3026 dbSNP
rs1420649503 3027 dbSNP
rs1176212112 3028 dbSNP
rs1490412840 3029 dbSNP
rs1335975720 3039 dbSNP
rs1041379143 3044 dbSNP
rs903458081 3045 dbSNP
rs1219647791 3047 dbSNP
rs936236647 3048 dbSNP
rs967767131 3052 dbSNP
rs1054662755 3053 dbSNP
rs548938519 3054 dbSNP
rs772813997 3055 dbSNP
rs1378556998 3057 dbSNP
rs1024352790 3061 dbSNP
rs537926833 3062 dbSNP
rs1305238548 3065 dbSNP
rs1403147056 3066 dbSNP
rs763318113 3069 dbSNP
rs993480171 3077 dbSNP
rs1030754193 3078 dbSNP
rs1346366688 3079 dbSNP
rs771126043 3080 dbSNP
rs561109760 3082 dbSNP
rs1279829710 3084 dbSNP
rs1437597852 3086 dbSNP
rs1202775970 3095 dbSNP
rs951361762 3096 dbSNP
rs1196891954 3102 dbSNP
rs1490043633 3106 dbSNP
rs554954370 3107 dbSNP
rs574836460 3108 dbSNP
rs558818049 3112 dbSNP
rs1228140856 3115 dbSNP
rs1016810512 3116 dbSNP
rs980351381 3120 dbSNP
rs1221976494 3121 dbSNP
rs774625148 3122 dbSNP
rs1452553399 3125 dbSNP
rs1174228589 3126 dbSNP
rs964226478 3132 dbSNP
rs540625401 3133 dbSNP
rs922362871 3134 dbSNP
rs560804799 3135 dbSNP
rs1382729012 3158 dbSNP
rs1319866323 3159 dbSNP
rs1470098775 3160 dbSNP
rs577595566 3165 dbSNP
rs977113264 3168 dbSNP
rs985239122 3172 dbSNP
rs546404251 3179 dbSNP
rs562911545 3182 dbSNP
rs936306020 3192 dbSNP
rs767547083 3194 dbSNP
rs1426266077 3196 dbSNP
rs1040227004 3198 dbSNP
rs901698267 3202 dbSNP
rs894693489 3203 dbSNP
rs1265400182 3205 dbSNP
rs1201932907 3208 dbSNP
rs1344618927 3209 dbSNP
rs948904453 3212 dbSNP
rs1229677566 3215 dbSNP
rs1324803696 3218 dbSNP
rs1296779386 3221 dbSNP
rs1453364550 3223 dbSNP
rs1045854246 3227 dbSNP
rs903479810 3231 dbSNP
rs1413501567 3232 dbSNP
rs1000546545 3236 dbSNP
rs1169324464 3240 dbSNP
rs917771938 3242 dbSNP
rs1460020028 3244 dbSNP
rs907322489 3245 dbSNP
rs993531173 3246 dbSNP
rs1445770126 3247 dbSNP
rs1026351558 3253 dbSNP
rs1469864347 3255 dbSNP
rs1442257677 3257 dbSNP
rs1200990457 3258 dbSNP
rs892214809 3260 dbSNP
rs1337520485 3261 dbSNP
rs887774596 3265 dbSNP
rs1475008113 3268 dbSNP
rs1246544660 3270 dbSNP
rs1006185501 3271 dbSNP
rs1024415037 3274 dbSNP
rs1165961352 3276 dbSNP
rs1336196862 3281 dbSNP
rs971552242 3283 dbSNP
rs1407872606 3286 dbSNP
rs1465853877 3290 dbSNP
rs1324776748 3291 dbSNP
rs980299582 3298 dbSNP
rs1387607959 3299 dbSNP
rs1388014732 3302 dbSNP
rs1323581189 3304 dbSNP
rs34287921 3307 dbSNP
rs369859345 3313 dbSNP
rs1034608836 3320 dbSNP
rs952106587 3330 dbSNP
rs984800166 3331 dbSNP
rs752847708 3340 dbSNP
rs1251104443 3348 dbSNP
rs1223284462 3351 dbSNP
rs1429193680 3353 dbSNP
rs148314688 3355 dbSNP
rs1361729432 3360 dbSNP
rs963931702 3369 dbSNP
rs1319013696 3376 dbSNP
rs761617231 3379 dbSNP
rs1351053213 3382 dbSNP
rs1271500283 3387 dbSNP
rs975266159 3394 dbSNP
rs1029487907 3395 dbSNP
rs923069017 3398 dbSNP
rs1261067336 3404 dbSNP
rs1446388768 3405 dbSNP
rs955141279 3408 dbSNP
rs762748383 3411 dbSNP
rs1363247183 3414 dbSNP
rs1322134747 3416 dbSNP
rs1405308333 3420 dbSNP
rs931807499 3431 dbSNP
rs1471840940 3434 dbSNP
rs1411466327 3435 dbSNP
rs1200498969 3437 dbSNP
rs879685011 3446 dbSNP
rs1245066966 3454 dbSNP
rs1220654064 3460 dbSNP
rs1447545734 3461 dbSNP
rs1286026057 3462 dbSNP
rs1478023629 3465 dbSNP
rs924345354 3467 dbSNP
rs957269908 3468 dbSNP
rs989804551 3475 dbSNP
rs936625374 3476 dbSNP
rs1292444290 3483 dbSNP
rs1459078399 3485 dbSNP
rs1346280188 3486 dbSNP
rs1163370876 3491 dbSNP
rs916168536 3493 dbSNP
rs1455966204 3497 dbSNP
rs1195405423 3503 dbSNP
rs1388454251 3504 dbSNP
rs892160454 3505 dbSNP
rs948956866 3506 dbSNP
rs1045908189 3508 dbSNP
rs1300574548 3510 dbSNP
rs928802507 3514 dbSNP
rs929434123 3515 dbSNP
rs1464268558 3516 dbSNP
rs1263531047 3520 dbSNP
rs1024699112 3521 dbSNP
rs1048282980 3523 dbSNP
rs887836493 3525 dbSNP
rs1363534520 3526 dbSNP
rs1006651280 3527 dbSNP
rs1272428986 3543 dbSNP
rs1001717501 3547 dbSNP
rs1034964834 3550 dbSNP
rs560555616 3553 dbSNP
rs1357610900 3554 dbSNP
rs1175682279 3555 dbSNP
rs765224792 3556 dbSNP
rs1014911349 3557 dbSNP
rs1245740746 3558 dbSNP
rs962050023 3561 dbSNP
rs1186520424 3564 dbSNP
rs1448802303 3567 dbSNP
rs1243471032 3568 dbSNP
rs568765460 3574 dbSNP
rs1348600828 3577 dbSNP
rs923360076 3578 dbSNP
rs141470936 3579 dbSNP
rs1308682770 3580 dbSNP
rs955194258 3589 dbSNP
rs1288084325 3599 dbSNP
rs537907275 3604 dbSNP
rs998665683 3605 dbSNP
rs1316403046 3606 dbSNP
rs1398133472 3607 dbSNP
rs1377510295 3609 dbSNP
rs1186987507 3611 dbSNP
rs566466018 3612 dbSNP
rs1166815857 3615 dbSNP
rs1428978140 3618 dbSNP
rs758334544 3619 dbSNP
rs936588935 3622 dbSNP
rs62059205 3623 dbSNP
rs1255225583 3629 dbSNP
rs1187790438 3630 dbSNP
rs913546736 3631 dbSNP
rs1248938444 3635 dbSNP
rs915567228 3638 dbSNP
rs970319650 3641 dbSNP
rs146291825 3642 dbSNP
rs568916558 3646 dbSNP
rs904942916 3649 dbSNP
rs398058377 3653 dbSNP
rs61067896 3653 dbSNP
rs538337920 3654 dbSNP
rs1404759983 3669 dbSNP
rs929486651 3672 dbSNP
rs887969470 3674 dbSNP
rs1366350270 3675 dbSNP
rs1295151416 3676 dbSNP
rs751305519 3677 dbSNP
rs1006443502 3678 dbSNP
rs1015201781 3681 dbSNP
rs1396878022 3682 dbSNP
rs1306544577 3687 dbSNP
rs554810398 3693 dbSNP
rs1181084645 3694 dbSNP
rs754680707 3695 dbSNP
rs1270417375 3697 dbSNP
rs1212091434 3700 dbSNP
rs1487803328 3701 dbSNP
rs1240165887 3710 dbSNP
rs1265184042 3710 dbSNP
rs909311170 3714 dbSNP
rs376455786 3715 dbSNP
rs1228024361 3728 dbSNP
rs1346171305 3729 dbSNP
rs1303532254 3738 dbSNP
rs1384970204 3739 dbSNP
rs1289424599 3748 dbSNP
rs997512081 3748 dbSNP
rs1039478011 3749 dbSNP
rs1386270500 3754 dbSNP
rs1310013926 3760 dbSNP
rs900500875 3772 dbSNP
rs997477953 3779 dbSNP
rs1354366451 3780 dbSNP
rs1480566167 3781 dbSNP
rs1051016307 3783 dbSNP
rs953426938 3784 dbSNP
rs1196166192 3785 dbSNP
rs1254081024 3790 dbSNP
rs1432129888 3798 dbSNP
rs1206295958 3805 dbSNP
rs1484106642 3805 dbSNP
rs1466480243 3806 dbSNP
rs891019289 3808 dbSNP
rs999114552 3821 dbSNP
rs534218292 3822 dbSNP
rs369838936 3824 dbSNP
rs1179992645 3825 dbSNP
rs15819 3829 dbSNP
rs1454252848 3836 dbSNP
rs1011319250 3842 dbSNP
rs577633792 3846 dbSNP
rs1296202020 3848 dbSNP
rs1362691425 3859 dbSNP
rs1437194581 3859 dbSNP
rs1319667939 3860 dbSNP
rs1043503 3861 dbSNP
rs969701016 3862 dbSNP
rs1466870884 3866 dbSNP
rs778398425 3870 dbSNP
rs1394633179 3871 dbSNP
rs138197750 3878 dbSNP
rs1035919783 3881 dbSNP
rs1370311781 3884 dbSNP
rs749652654 3888 dbSNP
rs1451907997 3905 dbSNP
rs1299103685 3920 dbSNP
rs1246535663 3921 dbSNP
rs937759834 3922 dbSNP
rs142792023 3923 dbSNP
rs1233718336 3927 dbSNP
rs1199015761 3928 dbSNP
rs532553193 3929 dbSNP
rs1250499020 3940 dbSNP
rs542406582 3953 dbSNP
rs984053239 3954 dbSNP
rs1230453918 3960 dbSNP
rs1200103689 3963 dbSNP
rs1340008374 3969 dbSNP
rs1296831503 3970 dbSNP
rs1043509 3972 dbSNP
rs1342098516 3975 dbSNP
rs1331783524 3983 dbSNP
rs1205534094 3985 dbSNP
rs1396536089 3987 dbSNP
rs1169973427 3990 dbSNP
rs1467628951 3992 dbSNP
rs942148300 3996 dbSNP
rs1388834424 4003 dbSNP
rs529726754 4009 dbSNP
rs974857576 4013 dbSNP
rs1434213508 4017 dbSNP
rs1239582949 4029 dbSNP
rs1036568344 4030 dbSNP
rs1442082621 4031 dbSNP
rs1251283519 4034 dbSNP
rs774538968 4035 dbSNP
rs115712503 4040 dbSNP
rs1030326317 4049 dbSNP
rs1246702349 4052 dbSNP
rs1358135178 4065 dbSNP
rs1467427237 4073 dbSNP
rs1051744630 4075 dbSNP
rs891071780 4077 dbSNP
rs1243565299 4079 dbSNP
rs866034165 4093 dbSNP
rs1335954073 4099 dbSNP
rs146152232 4101 dbSNP
rs934583444 4104 dbSNP
rs1053397301 4105 dbSNP
rs1309525043 4115 dbSNP
rs1393928658 4116 dbSNP
rs1369473833 4121 dbSNP
rs892969351 4124 dbSNP
rs1434412114 4127 dbSNP
rs1406474176 4128 dbSNP
rs1416348681 4130 dbSNP
rs1295302804 4131 dbSNP
rs1369663382 4133 dbSNP
rs1011788550 4153 dbSNP
rs1412941601 4158 dbSNP
rs1022680008 4173 dbSNP
rs181419004 4178 dbSNP
rs905593604 4185 dbSNP
rs1222159182 4186 dbSNP
rs1294629674 4190 dbSNP
rs957862667 4191 dbSNP
rs1287695216 4194 dbSNP
rs1002514868 4201 dbSNP
rs1315808960 4204 dbSNP
rs987924923 4206 dbSNP
rs759709322 4211 dbSNP
rs1258299706 4213 dbSNP
rs1333617813 4219 dbSNP
rs1226196019 4224 dbSNP
rs1349272603 4232 dbSNP
rs1283392570 4235 dbSNP
rs1218768901 4238 dbSNP
rs1437756654 4239 dbSNP
rs1352091152 4247 dbSNP
rs532454511 4248 dbSNP
rs982020648 4250 dbSNP
rs1489117601 4253 dbSNP
rs1186424613 4254 dbSNP
rs926261375 4256 dbSNP
rs937691302 4258 dbSNP
rs1471748437 4261 dbSNP
rs1411283887 4263 dbSNP
rs1479077922 4267 dbSNP
rs552138267 4268 dbSNP
rs1198161009 4271 dbSNP
rs1465127945 4272 dbSNP
rs754010863 4277 dbSNP
rs772371748 4278 dbSNP
rs983847346 4279 dbSNP
rs1278943590 4282 dbSNP
rs909617233 4282 dbSNP
rs939827920 4282 dbSNP
rs1364945174 4284 dbSNP
rs1273572752 4286 dbSNP
rs569127710 4297 dbSNP
rs1436392668 4299 dbSNP
rs1366301748 4300 dbSNP
rs1323006823 4301 dbSNP
rs1456014706 4306 dbSNP
rs1194759289 4307 dbSNP
rs537683382 4311 dbSNP
rs775366225 4312 dbSNP
rs1177136613 4313 dbSNP
rs542578753 4314 dbSNP
rs1403763554 4316 dbSNP
rs963585761 4319 dbSNP
rs898027085 4321 dbSNP
rs933530794 4322 dbSNP
rs1186409375 4326 dbSNP
rs1371897969 4328 dbSNP
rs140200858 4329 dbSNP
rs1052035773 4334 dbSNP
rs185784478 4336 dbSNP
rs1237678613 4337 dbSNP
rs922030286 4340 dbSNP
rs933373723 4341 dbSNP
rs534257479 4342 dbSNP
rs987499500 4343 dbSNP
rs554223791 4344 dbSNP
rs1338231548 4355 dbSNP
rs923959107 4363 dbSNP
rs1433336403 4364 dbSNP
rs1032376365 4367 dbSNP
rs934614842 4372 dbSNP
rs893879611 4375 dbSNP
rs1450482450 4376 dbSNP
rs761940560 4384 dbSNP
rs57462002 4389 dbSNP
rs796212399 4389 dbSNP
rs1278539515 4392 dbSNP
rs1053047786 4395 dbSNP
rs970545627 4400 dbSNP
rs1391924966 4402 dbSNP
rs1166703951 4407 dbSNP
rs1448634480 4408 dbSNP
rs1414255885 4418 dbSNP
rs1183180043 4421 dbSNP
rs893011254 4426 dbSNP
rs1236581002 4427 dbSNP
rs947256445 4428 dbSNP
rs570818702 4429 dbSNP
rs1483786198 4435 dbSNP
rs560683624 4436 dbSNP
rs981969639 4436 dbSNP
rs1226844054 4438 dbSNP
rs1354461848 4442 dbSNP
rs1230198839 4443 dbSNP
rs1226229158 4446 dbSNP
rs1034015314 4447 dbSNP
rs1291467005 4451 dbSNP
rs1410500540 4453 dbSNP
rs1044189144 4454 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacaCGACGAu 5'
                         || ||| 
Target 5' ------------uugGCGGCUu 3'
1 - 10
Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000335325.4 | 3UTR | UUGGCGGCUUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.274 2.9e-3 -0.188 3.1e-2 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.438 2.7e-2 -0.448 2.4e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.202 3.7e-2 -0.176 6.0e-2 79 Click to see details
GSE32688 Pancreatic cancer 0.308 4.3e-2 0.177 1.7e-1 32 Click to see details
GSE17306 Multiple myeloma 0.224 6.1e-2 0.297 1.9e-2 49 Click to see details
GSE21032 Prostate cancer -0.142 1.0e-1 -0.156 8.0e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.359 1.1e-1 -0.154 3.1e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.151 1.2e-1 -0.189 6.7e-2 64 Click to see details
GSE28544 Breast cancer -0.224 1.5e-1 -0.591 1.2e-3 24 Click to see details
GSE21849 B cell lymphoma -0.179 1.8e-1 0.286 6.6e-2 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.18 1.9e-1 -0.261 1.0e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.066 2.7e-1 0.034 3.8e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.124 3.0e-1 -0.119 3.1e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.104 3.1e-1 0.258 1.1e-1 25 Click to see details
GSE38226 Liver fibrosis 0.113 3.1e-1 0.197 2.0e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.054 4.3e-1 -0.063 4.2e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.006 4.9e-1 0.088 3.4e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.001 5.0e-1 -0.115 3.4e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.001 5.0e-1 -0.115 3.4e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.951 0.02 -0.800 0.1 4 Click to see details
KIRC -0.179 0.07 -0.184 0.07 68 Click to see details
KICH 0.296 0.08 0.166 0.21 25 Click to see details
THCA 0.169 0.1 0.199 0.07 59 Click to see details
UCEC -0.263 0.14 -0.225 0.18 19 Click to see details
HNSC 0.122 0.22 0.109 0.25 42 Click to see details
PRAD 0.108 0.23 0.121 0.2 50 Click to see details
CESC -0.711 0.25 -0.500 0.33 3 Click to see details
PCPG -0.481 0.34 -0.500 0.33 3 Click to see details
CHOL 0.15 0.35 0.183 0.32 9 Click to see details
LUAD -0.123 0.35 -0.203 0.26 12 Click to see details
KIRP -0.065 0.36 -0.012 0.47 32 Click to see details
STAD 0.056 0.38 0.026 0.44 32 Click to see details
BRCA -0.033 0.38 -0.009 0.47 84 Click to see details
LUSC 0.041 0.4 0.055 0.37 38 Click to see details
COAD 0.082 0.42 0.214 0.31 8 Click to see details
ESCA -0.061 0.43 -0.255 0.22 11 Click to see details
BLCA -0.025 0.46 -0.086 0.37 18 Click to see details
LIHC 0.013 0.46 -0.055 0.35 49 Click to see details
LIHC 0.013 0.46 -0.055 0.35 49 Click to see details
LIHC 0.013 0.46 -0.055 0.35 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1