miRTarBase - #MIRT482370 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AGO2   
Synonyms CASC7, EIF2C2, LINC00980, PPD, Q10
Description argonaute 2, RISC catalytic component
Transcript NM_001164623   
Other Transcripts NM_012154   
Expression
Putative miRNA Targets on AGO2
3'UTR of AGO2
(miRNA target sites are highlighted)
>AGO2|NM_001164623|3'UTR
   1 CATGTTTTAGTGTTTAGCGATTGTGTACCGAGTGGGATTCACGAGACCAGCTACACTCAGACCAACAGATGGCCAGCCCT
  81 TCCGTGACAGCCAGCATCGAACATGAGACGTCATTGATTTTATTAGATTCTCCGTTTTCCAGAATGCCTTCCGTCCCAGA
 161 TTTCAAACTTGGATTTTGAACTGCAGACCTGTATGAGAACCCAATGTCATAGGAAATATGGTTTGCTAAAATCTATAAGC
 241 TGCTTATTAAAACAGAGTCCCGTGTGTCCTAAAAATCTCCTAAAACCAGTCTATGAACTCAGGGCTTTAAAACATTTTTA
 321 ATTTATTTGGTCATTCAATTTACTTGTTTTTAATACATGATTCTCTATGAAATTGATGGGCTCAAACTAGCTGTGAATCT
 401 TCTGAGAGTGAAAGCAACACAAAACACAAGTGTGGTTTTAAAGCCTTGAACATTCTGATGTTGTCACTAAAGTTGATTTC
 481 CAGGCGATGCTCGTGTGCCCCTGGCGTGGCTCACCCAAGTTCCTCGACTGAGGGCCGGTGGCCATGCAGAGGCGTCCGCA
 561 GGTGCCGTGTTCTGCCAGCACCGCCCTTCACCCGGCCTGAACTAAGGAGCAGTGGCAGAAGGTGGGCCCCGTGTGTTTAC
 641 AGCATTTCCAGGTCCAGAGAGGTTGGCAGACAAGTGCCATTTTAATAAAAAATGTATTTAAAAAAAGAAAAAAGACAATA
 721 TACTGACAGTCTAATCATCAGATTTGTCCTATAGGACTGTGACATTTATTTTCCAAAGTTTTTAAAGAATACGGGTCTGT
 801 GGTGATAAATACAGTACAATCCTTTTTCACTGTTATGTCTTTAATGTAAGAGAAGAATATATATATCTGGTTTGCAGTAT
 881 TAATGTGATAGATAGATGCTGTTTTTTCATTTTATTGACTATGGGGTGCTTCTGTGATCTGTTTGGCATATCAAGAGTGT
 961 TTTGGAGCCTGGAGATGGGACCGCCTCTCAGTTCTTAGTGCTTAAGGACAGGAATATGCAATTGACTTAATGTGACAGCA
1041 ACCCGCTTCCCCCGTGGAGACTGTGCAGCGTGTACCCATGGGAGGGACGGATGTGCCCTCCGCGCCGCTCGCCACCCTCC
1121 CTGCCGCCTCATCCCCGTGTGTCACTCACTCAGCTGATGAAGCACAAGTGGAAATTATTTATTCTTGCATTGCTGGGAAA
1201 CATTGATGTGTGGGGACTCACTCCTCTCCGTGTGCTCTTTTGTCAGATGACTTCCATAGATCTATGCACTGAGATTCGTA
1281 GAAAGCTGTTGGTGGTGGCTCTGCTGGGCGTGAGGCCGTCGGTCACAGCGAAGGAGCTTGCCTGGCCCTGGGAGGCCCAA
1361 GGATAGCAGGGCCAGCAGAGGGCATGGGCCGTTCTTCTGGGGTTTGCATTTGGGGCCCCAGACTTGGGTTTGCCAATCTA
1441 GAAACTGTTGCACTAAGAGTGACACCACGGACGATTTTGAAGGCTAACAACAGACAACTCTGTTTGTGCTGAGTGGGCTT
1521 TTTGTCTCTGTACACAGTTTTAGTAAGACTCAAATCCATGTTCCGTGTAGAGGCGTCAGGAAGGAGGCGAGCCTCCCCTA
1601 GTGCTGCTGTGCGCTCCGTAGGTCCCCTCTTCCTGCTGCTGTTCCCTCCCCGGCCCTGCGCGACACTTACCTCGGCACTG
1681 TGGTGGGGTGGGGTGCCAAAGGAGCTGCCTCCTGCTCAGCGGCACCCCCCCCCCCACCTTTGTGCTCAGCTGCTTTGGAG
1761 GCAGCAGGAGGGGCAGCAAGCCGCAGGTCGGGGGTCTCCCGATACCTCGCCTGGATATTGGCGGCAATGACAAAGGGATG
1841 ACTATTATTTGTGAAGATGTGTACTCAGAGTGGTGTGTGTGTGTGTGCATGCGTGTGTCCCTGTGTGTGAGTGTCTTATT
1921 AATGGCATTAGTCTCTTCTGGCTGTATTTTTTTTTAATCTTTTTAAATGACAGAAGCTCCCACTCTAAGAAATGGCAGTT
2001 CCTTTTGTTTTAGTGGCAAGTGGCACTTTCTCCTGTTTTCAGAAGGATACAGACATGCTCGTAGCTTAAATTAATGGATG
2081 CATTCAAGCTAAGGAGGGAATCTTGTGACTAATAACTTTTCAAATCTGAAATTAGATTAGTTTCCAGCCATTTTTACAAT
2161 CATCTGGAACCATGTGTCTCAAAGGTGTGTTTCTTCCACCTGCGTCAGGCTGTCTGGGGGATGGCGGTTCTTGTTTAACA
2241 TGCAGATTTGTGGGCCTGCTGCCACCTCCTGCGTGCGGTACTTCAGGGATGGCCAGGGCATCTGTGTCTAAGCGATGGCC
2321 TGCAGCCCTGGGCTCCCTGGGGTCTGAGGACCCAGCTCTGGTGGCACCCAGCAGGGAGGAGGTGCTTCCTGAGCAGATGC
2401 CTGAGACAGACTGGGCTGGCAGAAAAGTAGGACTACAATTTTTGTTTTTTTTAATCATTTTGAAGGAAAACTTTCATTTT
2481 TAGTGGGCCAGAGTACTTCGAAAAGGGTACTTTTTTATAGCCCTATGCTTGTTTTATAAAACTTTTAATACTAAAAACAT
2561 TAATAGACCAAACATCTCCAGCTGGGTCAGCTGCACACCTTTGTACATGTCTGATGATTCAGAGTTTAAATGGCTGTAGT
2641 TACAATTTCTCAGGTAAACAATTGTTTTCTCAAATTTTTACCAATCCCTGCATTATTAGGATAAATTTTGAGACAGTGTA
2721 AAAACCTCAAAGTACAGTAGGGTAAGTCCCAGCCCTGTTCACGTGAAAGCCAGAGGTGGCCCTTCCCCGGCATCTGATCG
2801 TCTGATCATGTGGGTGCCTGGGGCCTTGCCACCCTTCCCTGTCCACTGCTGCCCCCCTGGGCCTGTCAAGATTTGAGGGG
2881 TGCCCACTCGCTGGCTTTGTCCCCATCCCACTGTTAAGTAAGGTGTGCCTTGCTTTAAGCAAACTGAATGTGAAAATTAT
2961 GTGTAGAAGTCTGGGTTTGTTTAAAAGAAAAACTGGGATTTTATCTCATCTCTTTAAAAGAGGTCTCCCAATTCGATTTC
3041 TGTACTGGGACTCTTCCTGGTGTGTTTTTACATGTTCACTTTTTAAAAACATTGATGTACTCCCATCCTTTTACCACTAC
3121 CCTATCACATTTGACAAGTTCTTGCTGTAATGACGACGCAATTAACGAACACCAGGGGAGCGGTGGAAAGCTGCCCTCGT
3201 GTGTGAGCCCTTCGGTGACGCAAAGCCACCGTCCTGTTGTTTTGTGTGTCCTAAGCTCAGATTTTCCTGGTTTGGATAAA
3281 TTTTGTAAAACTGGGCATAGCTGTACTTTTAGAAAGGGATCGTTTTCCTTAAGTTTTGGTTTTCTCTGGTTCAAGCAGTC
3361 TTTACATGCAGCCTTTTGATTGCACATCAGGGTCTCCCTTTTCTTTTCCAGATGATGTTGCTTTTCGGTGGTGGTCTCAC
3441 ACTCCTTTGAATGAATGTTTGCACTCTAGAACCACAAACGATGCGTGACCATTGTACAGCTTGCCCAAGAGGGAACTGTT
3521 GGAAGCAGGCAGTGACCTCCACGCTGTTTGTTTGAGGCTGACCTAAACTGCTATCACTAATGTTTACCCCCGTGACGGAG
3601 TGCCCATTAGAACAGATCATGTCAGTTCAGTTCCTGTAGTGGGGTTAGTAGGTGGGGGGTTTTATTGTTGTTGTTATTTG
3681 TTACTTTTATTGCTGTTAAATGCAAATATTGCTATTTATTTTTTCCTTTCTGCTCTGGTTTGGTTTGGCCGACACAGATA
3761 TTCCAGTGCATGTGGTACCTAATGGATATGATAGAAATTATTTCCCCAACTTTTATAAATTGCCTAATGTTTACCTTCAA
3841 GTTTGCTGGATGATTTATTTTTGAAAGCCACAAATGTGATTTTTCTGGATGAATTGTTTTTCTTATATATGCAGCAATGT
3921 AATTTTACATTGATCTGCGGGGTGGTTTAAATTTTATTTTTACAAGGCAGTTTTTCAGTCAAATTATATATTTGATACAA
4001 TACGCTAGGATAGACCGGCCACACGTCAGGCAGCCGGGACACCGGAGTGTCCCCAGGAGGCCTTTGGGGCTGGGGTGGCC
4081 CGTGGCTTGTTCCCTGCGCCTCTGGGAACTGGATGAGTCCTTCGGCGGGACTGTGACCCGCTGGACAGTTAAAAGGATTT
4161 TTCATGGGCATTTTCCTACACATAAGGCAGTTCCATTAGGAGGAGCTTTAGAAGTCGACATAATCCAGACAGTGGACAAT
4241 CCCAGTGGCCCAGACAAGCCATACGACATTTTCCTGTGACCTCTCTCTGACCCATCTCTCACGCTCATGAGAAAAGGAAT
4321 GTACAATAAATAGAAACAGAAACTTCCTCAGTGCTCATGCGCCTCACTTGCAGAACGTGAGTATTTCATTTATGTTTGAA
4401 GCCCTTCCCCAAAGTGACCGAGGAGTTGCACTCTAGCTGCCGTGCCAGCAGTCTCGTCTGCTGTGACGCTTCTCGGTGCG
4481 GATGCAGTGCACCTGTGACTTTGTCATGGGGGTGCCCCTGTTACACACACACACGCTGACTCTTTTTTATGAGGAAAATC
4561 TTCGACTCAAAATAATTGCACTGATTTTTTGACAACTTCTTTTTACGATGTCCCACTTCGCATCTGCTGTACTTGTTTGA
4641 GATGATTGTAAATAGATTTGTGGTAGGAGAAGTGACATGAATGCAACACGTGGCTCTGTTGTGGAGACACTGCCTCGTAT
4721 TCAGTATTATGTGTTAAAGTTGTGTGGACTTAACTCTGTTCCGCCCTTTAGCTTCGTGTCTGTTGACCATTTATGAAGGA
4801 CAAGTTCGCCTCATTTTCTTTTTCTTCTGAAGGGAAGTTCTAGATCGGTTACTAGGAGAACATGGTCTCTTGGTGCCTGA
4881 TGATTTAGTCCTAAGCAGACTCGTTGCAGTCTTGTGAACACTGTTGTGGTCTGTTTGATTCCTCGTCGCTTACCGTGGCT
4961 CTCCAAAGCATGGTCTTTGAGTTCCACCCAGCCTGGGACAGTCCAGACGGGAGGCATCTGCTCCGCCTGCTACTAGGACG
5041 CAAGGGCCTCCTTGCATCTCTGTGGTCAGAGTCATCTTAAAGCCATGAGGTTACTGTCGTGTCAAAGCTGTCATTTGTGC
5121 CCGTTATTTTGCTGGAGTAGCAGCGTGTGCTGTAGCCCCCGTGTGTCACTCTGTGGTCAGGCTACCCTGTGTCACACCCA
5201 GCAAGAAGTTTTTCAGCCCCAGACCAGTCTGTGTGTGTGTCCGAGTCACACCAGTGCCATTACGGTGCCCTCGCTTATGC
5281 TTCTTTCAGTATGTTTTGCCATGTTATTGTCTAAAGTGAATGTATTGGCTTAGCCAAATCACTACAGAAGGTGGTTCCTA
5361 AATACCTTTTAGTTTAAAAAAAAATGCAGATAAAGGCTACCTCTGAATTCTCAATAGATTCATCATGTTTGCTCTTAAGT
5441 GTAGCTGTCCACACTGAAAACAGCCAATATGTTGCCTGAATAAACTGAATTGTGAACATCTATCTGTTCAGTTCTGGCTT
5521 GAAAATGTGTGTGCCATACTGTGACCCACGGGCAGCCCCTCCTCCTCTACTGTGTCAGGTGGACCAGGGTCACCTCTGTT
5601 CTGCGCAGCTTTGAGATTCTAGGATTCTACGGCCGGCACGAATGGCATGGGAGGGTTCTCTGCACGGGACGGCATAACGG
5681 CATGCCATCCTTCAGGCTGGCAGGAGCCTGCGCAGGTGTGGCAAAATCTTGAAACAGCCTGTGTCCTGCCTGGCTTTTCA
5761 CTTTCCTATTTAATATAAGAAAGCACTTTTTTTTCTGCTTTACCTACAAATGGGTTGAAAATGGCCTCCTCTGTCCTCTC
5841 CTCTCTTTTATACACTCTGTAAAATCACAAAGGTGCTTCAACACCGACTGTCATGCAAATAATACATTTAAAATAGTTGC
5921 ATGGTTTCAAAGACAATGCAGACGTAATTGGCCTTTGACTTTGGGACCTCGGGTTACTCTCACTCCCTACTGCAAAACAA
6001 ACTAAGGGTTGAAAGCAAAGCATTCTGTTCAAATCCAGGGCCCTTTGTTTGAAAAGAACACAGGGCCCACAGCTGGTGTT
6081 TTGAAGTAGAAGTTCCCACTAGTGGCGCAGTGGACCGTCTGATGCAGACTTGCAGGAAGTCGGTCCTGGGAGGCTCTGAA
6161 CACCCCTCCCTGTGATTAACCACTTTGCTGTCAGAAATGTCATTTTCCCATACACTGTGCTGTGGGCCCGGGGCCTCCTT
6241 CGCTTCTTTCTTTGGGTTCCATATGTTGCCCGATCTTGAGGTTAGCGCTCGCCCCAATTTCTCCATGAGTTTACTCTGAG
6321 TTGACAGGCGATGATCTGACAGTTGGAGGTGTCTGGGTGTTTGGAGGTGGCCCCGTTCTCATGTTGGCTGCTCATCAGAC
6401 ATTGAGTTTGGCCCCGGCGGTTCTACTACGTCACTACCTGGAAGCAATTGCCTTTAACACTCTGCTGTTTGGGGTTTCGA
6481 TGCTTTTTATGCTGCGTTGCGTGCTTTCATTCCGGAAGAGCTAAGTGTCCTTTGCAGTCTCTCTGAGAATGTTTTGTAAT
6561 TCTGCCGCCACGCTGTTCTGTGCGGACCGACCTCAAGAGGCTTGGGCCCCCGTGGGTGTCCCACTGCCTGCCGGCCCAGG
6641 GTACAGGCTGCTTGGGTCCGCTGGGCTGGCCTTGGGCTGTCAGAATCTGGTCCAGGGTGTTTCGAGGGGACACTGCACAG
6721 CCGCTCGCCCCTCGACTCAGTCATGGGAGCTGCAGCACGCAGATCCACCGCAAGCTTCCTGCACGCGCATCTCCGGAATG
6801 CTGCGCTGGGCCCTCCCACCATCTTCGCGTTTGTGAGAATTTACTCAGAAGTGAGAGAACTGAAGATTCCTGGTGCTTTT
6881 GTTAACACGTTTCTATCTTATTGGTTGGTGTGGAAATGTTAGATGTGTTGTTAGGTTTTTAAATGCTGTGGGTGGTATGA
6961 TTAAAGGGTTAAGTCCTCACCTCAGCCCCCAGCCCCCTTTTGGGGGGTAGGAAGAGGCTGAGTTATCTCCTATTTAAAAC
7041 CTCCTTGGATTTAAGTAGTTCAGAGTTAAAGCTAAAACACCAAATATTAACTCTTTCCCCCAAGTGTCTCCAGGAACTGG
7121 ACGTTGGGGCCATTCTTATTCAGTTCTTTCTGTAGCTCCAAGGTCCTTAAAATGAGTGAGTTGATCCCAAGAACACCCCA
7201 CAGCACCAACCAGCAGGGCACAGTGCAAGCGACTTCATAGATCGGGGTGCTCGTGTAGGGGTCCGGGGCTCCTTTGAACT
7281 CTGGGAGTTGTGTGCGCAGTCTTGGGTGGGAGACGGCAGGTCCCTCTGTCCCAAGAAGCTGGTGGTGCCAAGGCCTTCCT
7361 CTGTCTCCATCAGTGCCAGCCTGATCGCGTTCTGGAAGACCCAGTCTCAGACTCTGTGCCTTTAAAGTCCGGTCCTCAGT
7441 GTCCTTTCAGAATCATGTTGGGGCTGCGTTTCTCTGGGGAACTAAGCCTGTGCCATTCCACAAGGCAGGCGTGGACCTCC
7521 AGCCTTGGAAGCTTTCTTTCCGCTCCTCAGCCCCTGACTTGTAAACTGTGATGCCATGCAGTCTGGAGCCGCGGGGGACG
7601 CACTCGGTCTCATTGCGGAAAACACTTGGTTCCAGTCGTGTGGTTTCTCCCATACCCTGACCAAGTCCACCTCTGCCAGG
7681 ATTGCAGGAGATTGGTGCAAGACCCATCTCTTATGCATTGACCATGACCATCAGCAAAGCCTGGTGGTCTTGTTCTCATA
7761 GTCACTCGAGAAGAATATTTATTGTAATGGAAGTAGATTTTTTAAAAAAGGAATTGGAATCATGTCTTTGTAGAATGTGT
7841 GTGTGTGAAGTCCTCAGCTGTAAGGTGCTATTCAGTCCTGTGACCCTTATTTTGGAATGCTCTTCATTACTGTTGCTCTG
7921 TTTTGTGACTTCCTGGGAAACCGCTTACTTTGGTGTGGTGTCACCTTGAGCTGTGCACATAGGACACCAGTTTTGACTTA
8001 ACCTAACAGGCAGTTTTTATCTCTAGCTTTTTCAAGCCAGGTATTGAGCAGTTTCTTGGCCAATGGCCTGAGAAACCACC
8081 TGTCCCTGTCAAGGGGTGATTTTATTGGTTTTAAGTGGGGAAGTAATCCCATGTACTTATTTCTTAAATACCTAGGAAGT
8161 TCTTCTTGGTGGCTCCTCTTGGCCCTCCCCTCTTTCTCCCCCAACCCACCATCCTGCAAGGCAAGGAATGGCCTCTCCCT
8241 CCACAGAGGCAACGGCTGCAGAGGGAGCACTGTGGCTGCCATCCCAGTTCCTCTTCAAAGCCAAACAGACACGCGTGACT
8321 CAAATCCTACAGTATGGAGGGTGGCGTTGCATTGAAATTCCAGGCCTGAGTTTGATAGTGGATTTTAATGTAGTTGTTAA
8401 AGGTATGAATTCATGTTTTATAACTGTAGAGGCAAGCAAGTTTTTATTTTTTAAAAAGTTTTGAGAGAATAATTTATAAG
8481 TTTCTGTGCAGCAAAGTGGCTAATTACTCATTAAATACAGGAAAAGAATGTAGTATCTAAATCCAGCTTTTTCTTACCTC
8561 TGGTACACTTCAGATTACTTACCTAATACATATTGAGGGCTTTTAACCCTTAGTTTTATCAATTTTTCTAGTTTTATTTT
8641 ATTTTTATAAAATAATTGAAAAAGAACCAAAAATGAATTCAGAAGTTCCATAGATGGATTTTTGCCCCTTCTTAATTTTC
8721 TCCCACAATGAAAACATTTTAGAAGACATTTTGAATCAAAATGTATTATGACCATTGAAAGTTCTCTATTTTCTAAGAAG
8801 CTGAGCAGCTCCAAGGGCCTCGTTTCAGGTGGTACTCTATGTATTGTCTGTGGGCTTGTTTCTACCTGTACAGTGGAACC
8881 ATGTGACCATGTCTTGTGCTTGCAATATAGAAACCATGCAGTGCTGTTTTGTGAATTGGCAGTTTCTGTATAAACTCTTA
8961 TTTATATACATTGGCCTCTCTGTATGATTTTCCATTTGCTACATGAATTGTAAAATTAATTATAAAATTATAGTACCTGC
9041 TAAATACAATTCTGAGGCTTCATGTCATTGTCTTTAGTTGAATACCATGCTGTGTGTCTTGAAGATGTCCACGCTTGCAT
9121 GATGCTAGGTGGCAATGCCACTTTAAATTAAGCCTTAATCAGATGTTAAATTTGTGAGTTTCAGAGTATGCAAAAATATT
9201 AGGCAGAGTGAGTGTAAACTGTTCAGATCAAGATGCTGTATCATAATTCAAGTTATTTTTTTCTGGAGTTAAAGGGAAGC
9281 ATTCAGTGATACACCTCTCTCTCTCTCTCTCTCTCTCCCCCTCTCCCCCCTCCCCCTCCCTCTCTCTGTCTCTGTCTCTG
9361 TCTCTCTCTCTCTCTCTTGTCTAGCTTGGCTATGGCCATAGCTTGATGAAAATGGACCATTGTGCATTTCTGTGACAGTC
9441 AAAAAGACCTGTTCTAAAAGTCTTGCGACTTTTTCAGGGTTTTTTTTTTTTTTCATGTTTCTTTTTTTTTTTCCCCTCCA
9521 GTCTGAGATTTCTGTGTGGCTGATGGAGAGTGTGATTTGGGCGTAGGTCTTATTTGCAAACCTGCTCATGTTCTAAGCTT
9601 TCTTCAGGTAGTACCACCTGTCATCGCTTCTGCATATGATTTAAATGGATTTTTGTTTTTATAAAAGTATCATAAATTTA
9681 GAGATAAAATGGAGGGGACCCAGCTTTCTTTACAATGTGGATCTACCTCAGTTAAACAGTTGGGTGCTATTACTAAGTCT
9761 GTCAAATTAAATTGGAAAAAGTAACCAAACAGTGAGATACAACTCCACATGAAACTTGAAATTGTAATTTCCGTTTATTT
9841 AATGATATTTTTATTTATTTGTGCCTTTTATGTTGAACCCCAATGCATTGAAAAAATTCAGTATGAAACAGTACATATTT
9921 TATTTATATTACAGGTGGGAGAAAAGTCCAATTGGTCATGGAATTTGATAGACTTTTCCCCAGCCAACTGCTACAGTGTA
10001 TTATAATCCCGACTGCCCCCCTGTGAAAAGAAAAAAAAAAATGTCCAAGAGCAAATTTAACATTTTACAAACAATAAAGT
10081 CCAAACTCCTCTATGCACATATTTATAGCTTATCACTTCATTTTCTGTGCCAGTGAAGGGGTGGCCAGAAAAAAAATCCC
10161 AAGTACCCTCATCATTGCTTTTCTAGCCATTCATGCCCCCTCTTCCTCTGGCACATTTTCTAAGAGTTTATTTCATAAGC
10241 AGCAAACGGACTGTTGTCGATTTCATCTCTCCTGACCTACCTGGTGGAGGTGCTAATGGCCATGGACAGAAAGGGGCGAG
10321 CCAGAGCTCGTGGCTTTGTGGAGGCAGAGGCCTGCATTCAGCAGCGGCCCTGTGTGCCTGTAAGTTAGGAAGGCTTTCTG
10401 ACAGGTAAGAAAATGAGATAGGTTGATGACTTACCATGCTTTTATATTTGGCAGTTTACAATTCTAGACTTTTCCTACTA
10481 TGGCGATCTTTTTTTACTTAATTCTTTGGAGGTAACAATATTTTGGAGTCTTAAGAATTTGATTTTATACCAATAAGAAA
10561 TAAAAATTAGGGATCTTTCCTGTAGTATATAGTTTTACTATTTTAAAGAGATCTCTGAATTTTACAAGAGAACCAACATT
10641 CCTTAATGGCAGAACTTTGAAAGTTGATTTGGGAGGCTTTTTGCTGCAGGATCTCAAAAATAGAGAGAGAGATGATTCTA
10721 CTTAAATGTTTTTAATTTTCTAACTTCCATCAGGTTGATACTTAAGCTCTATTTTGTAAAGAGTAAATCATCCTTTAGTA
10801 TGCTGCATAAGATGATCAGCATTCTTGCACTTTCTCAGTAATAAGACGTGCCGGGCAATTGGCTCCCCAGGACGCATTGT
10881 GTTTTTAACCTAACGAGAGGACTTTGGGGCAGGTGATTAAATTTATATAGGTACCTCAAGAAAAAGAACCTGAATATGCT
10961 GCATTTTCTTTCTTTAGCTTTTACATGTAGCATTTTGTTTTGCTTTTGTTATTTTTGTTTTGATATATGCTTTTTGGACC
11041 CCAATAGACTGTTGAAAGAAATTTAAAAATTACTCTTGTAGGGATATAGTATCCTTAAAAAATAAAAATTTAAAAAAATT
11121 TAAAAAAATTGCTGCAATATCTGGCTCGAAGGTTGCCCTATATTAGAATAATACTTTAGCCAAATACACCTGAGGAGGCA
11201 GACACTGTGTTTATAAGCAGACAATAATGTTCTGAATCCTTCCTGTTCATGCTGCTTTCTTAATTCATTTCTCCATGTCA
11281 TCAAGAGGTTGGATAACTTATTTCTAAGCTCAAGGTTAAAAATCATGTCACCTTTTTTTTTTTCCCCCAACACAGACCTC
11361 AGAAAAATTGCGATTGAGGAAGTAGCATGATCCTAAATGTGTTGCTGAAATCAGGCAGCCCGAGCCTCTGGTCTCTCCAG
11441 AGAGCCCGTCTTCACATTTCTCTATTCCTCAGCACTCACCCGAAACTGAACAGATGGGGAGTGGTCTTGATTGTCAAGAT
11521 AAAACTGGTGAAGAAAGCTAAATGCTGAGAAACTGAGCATCTATTGTCGTGTTTAAGCTTAGCTGGGTCCTTTCTAGTTT
11601 GTTTTTACAGCTTACTAGGTGAAGTAGTTTGCACTATTTTTGCAATAAATTCATGGAAAACCTAACAGTTACTTGTTTTG
11681 TTTCTTACTGTGTGTATATAAACTAATACTAAAAGTTTGGCATAGTGTTTTTTCACCTCCTTACATAACCCCTAACATGC
11761 ACAGAATGCTGTAAATCTGATAAAATATGATGTGAATGATATTTTATAAAGTTATTTTGTATGGTGTCAATTTTGTTTTG
11841 CCTCATAGTATGTCAGCAAAAAATTAAATAAAAGTCCTCCTATTTACAGCTGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||||||   ||||||:| 
Target 5' tagAAACCATGCAGTGCTGTTt 3'
8908 - 8929 155.00 -19.10
2
miRNA  3' guGUUUGGUA----AUACACGACGAu 5'
            |:|:|| |    || |||||||| 
Target 5' ggCGAGCC-TCCCCTA-GTGCTGCTg 3'
1586 - 1609 152.00 -19.90
3
miRNA  3' guGUUUGGUAA-UAC----ACGACGAu 5'
            ::||:| ||  ||    ||||||| 
Target 5' tcTGAATCCTTCCTGTTCATGCTGCTt 3'
11231 - 11257 150.00 -10.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26645264 1 COSMIC
COSN14328306 18 COSMIC
COSN30717284 20 COSMIC
COSN30494782 21 COSMIC
COSN30159041 28 COSMIC
COSN30483909 29 COSMIC
COSN2531070 36 COSMIC
COSN14328303 42 COSMIC
COSN31502887 51 COSMIC
COSN31500683 58 COSMIC
COSN1360805 83 COSMIC
COSN30128453 84 COSMIC
COSN30167149 91 COSMIC
COSN30130607 94 COSMIC
COSN31591746 99 COSMIC
COSN30483372 121 COSMIC
COSN24401796 133 COSMIC
COSN30137202 134 COSMIC
COSN20076462 152 COSMIC
COSN26538361 287 COSMIC
COSN195113 404 COSMIC
COSN30539121 473 COSMIC
COSN6916495 505 COSMIC
COSN31523117 513 COSMIC
COSN31488014 566 COSMIC
COSN31533843 724 COSMIC
COSN29463576 797 COSMIC
COSN17885781 822 COSMIC
COSN19659216 855 COSMIC
COSN20711935 867 COSMIC
COSN21780826 921 COSMIC
COSN7667787 1103 COSMIC
COSN398516 1136 COSMIC
COSN22274132 1151 COSMIC
COSN22272168 1184 COSMIC
COSN6916494 1639 COSMIC
COSN27523217 1956 COSMIC
COSN9257519 2174 COSMIC
COSN21955326 2269 COSMIC
COSN26760322 2387 COSMIC
COSN17939721 2444 COSMIC
COSN23700151 2444 COSMIC
COSN27521477 2444 COSMIC
COSN7667786 2453 COSMIC
COSN29715028 2678 COSMIC
COSN8072686 2693 COSMIC
COSN16130317 2787 COSMIC
COSN20326662 2890 COSMIC
COSN21540055 2981 COSMIC
COSN16457617 3155 COSMIC
COSN24652665 3173 COSMIC
COSN7667785 3394 COSMIC
COSN5109741 3772 COSMIC
COSN21113704 3840 COSMIC
COSN7667784 3909 COSMIC
COSN15725782 3969 COSMIC
COSN2266152 4431 COSMIC
COSN8575581 4609 COSMIC
COSN8072683 4834 COSMIC
COSN28963511 5096 COSMIC
COSN6916490 5315 COSMIC
COSN6916489 5337 COSMIC
COSN29760514 5376 COSMIC
COSN29200796 5460 COSMIC
COSN6916488 5509 COSMIC
COSN28246081 5595 COSMIC
COSN17060741 5783 COSMIC
COSN9257518 5933 COSMIC
COSN30271978 6759 COSMIC
COSN22620967 7688 COSMIC
COSN26673137 7836 COSMIC
COSN16688120 7899 COSMIC
COSN19444977 8035 COSMIC
COSN24188061 8175 COSMIC
COSN9458899 8312 COSMIC
COSN29397677 8834 COSMIC
COSN2266149 8845 COSMIC
COSN2266148 9135 COSMIC
COSN2530827 9294 COSMIC
COSN23712140 9316 COSMIC
COSN22901728 9328 COSMIC
COSN23779505 9360 COSMIC
COSN27252179 9360 COSMIC
COSN8072682 9501 COSMIC
COSN206045 9512 COSMIC
COSN20271471 9818 COSMIC
COSN22303934 9819 COSMIC
COSN17351698 9897 COSMIC
COSN27217612 10031 COSMIC
COSN9604437 10259 COSMIC
COSN9604436 10392 COSMIC
COSN8072681 10433 COSMIC
COSN8853688 10469 COSMIC
COSN17590281 10666 COSMIC
COSN9257517 11097 COSMIC
COSN19723169 11122 COSMIC
COSN22370823 11128 COSMIC
COSN14764896 11167 COSMIC
COSN15052776 11563 COSMIC
COSN20742137 11762 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765442219 2 dbSNP
rs759660452 3 dbSNP
rs750483625 6 dbSNP
rs776741788 9 dbSNP
rs1251073077 10 dbSNP
rs766327481 11 dbSNP
rs761265483 17 dbSNP
rs1223128708 18 dbSNP
rs968692466 19 dbSNP
rs773531367 21 dbSNP
rs1272273991 22 dbSNP
rs372345435 28 dbSNP
rs113429085 30 dbSNP
rs762259884 31 dbSNP
rs774201009 35 dbSNP
rs1319781052 36 dbSNP
rs768405043 38 dbSNP
rs1362725388 39 dbSNP
rs35849440 42 dbSNP
rs1395568568 43 dbSNP
rs1290011356 45 dbSNP
rs769138024 48 dbSNP
rs1285977460 54 dbSNP
rs1268604381 55 dbSNP
rs1473160218 56 dbSNP
rs896124257 69 dbSNP
rs564896980 71 dbSNP
rs1003336374 83 dbSNP
rs548885351 84 dbSNP
rs1470093201 91 dbSNP
rs1163870839 98 dbSNP
rs1352383360 99 dbSNP
rs543182078 110 dbSNP
rs1236427439 116 dbSNP
rs1036706016 130 dbSNP
rs1364700600 131 dbSNP
rs1023984736 133 dbSNP
rs940584066 134 dbSNP
rs1333871173 141 dbSNP
rs780609199 146 dbSNP
rs888341206 147 dbSNP
rs576072209 152 dbSNP
rs897919164 153 dbSNP
rs1483572819 159 dbSNP
rs931786371 162 dbSNP
rs753429296 164 dbSNP
rs921379742 165 dbSNP
rs111226002 166 dbSNP
rs554334860 169 dbSNP
rs1248900318 172 dbSNP
rs1420496560 180 dbSNP
rs944869104 181 dbSNP
rs910750834 186 dbSNP
rs986686549 187 dbSNP
rs1156866084 193 dbSNP
rs975469017 204 dbSNP
rs1163151309 219 dbSNP
rs965779696 230 dbSNP
rs1463753470 243 dbSNP
rs915473181 246 dbSNP
rs1060832 255 dbSNP
rs760430434 261 dbSNP
rs2944776 262 dbSNP
rs957010377 266 dbSNP
rs1193490914 267 dbSNP
rs1034747693 269 dbSNP
rs79784544 272 dbSNP
rs77693158 273 dbSNP
rs79874313 275 dbSNP
rs149250466 279 dbSNP
rs1487726843 287 dbSNP
rs1313763852 291 dbSNP
rs534982325 293 dbSNP
rs1283274549 294 dbSNP
rs981796171 301 dbSNP
rs771684615 304 dbSNP
rs969095935 310 dbSNP
rs969515122 320 dbSNP
rs1201497213 332 dbSNP
rs779427604 338 dbSNP
rs1212485394 351 dbSNP
rs1183024654 359 dbSNP
rs1248732610 363 dbSNP
rs1430468598 365 dbSNP
rs1013312425 367 dbSNP
rs1277892635 372 dbSNP
rs1217377823 390 dbSNP
rs1177039362 393 dbSNP
rs1005794720 399 dbSNP
rs952694393 402 dbSNP
rs1335408638 409 dbSNP
rs1362059335 419 dbSNP
rs896149157 440 dbSNP
rs1383556731 447 dbSNP
rs1326190004 455 dbSNP
rs1025948293 458 dbSNP
rs1265425856 465 dbSNP
rs1321952577 466 dbSNP
rs1036063353 480 dbSNP
rs1004954256 485 dbSNP
rs1363852506 487 dbSNP
rs1486926147 488 dbSNP
rs570537188 492 dbSNP
rs552526191 493 dbSNP
rs1199825690 497 dbSNP
rs1431162238 502 dbSNP
rs1479382349 505 dbSNP
rs576127793 517 dbSNP
rs570153310 518 dbSNP
rs548348892 519 dbSNP
rs1340041000 525 dbSNP
rs1405187200 526 dbSNP
rs1296575756 527 dbSNP
rs1285525128 531 dbSNP
rs1344081478 534 dbSNP
rs34079636 535 dbSNP
rs1009010271 537 dbSNP
rs921742303 545 dbSNP
rs796222520 553 dbSNP
rs1050651489 554 dbSNP
rs946841361 557 dbSNP
rs944099700 558 dbSNP
rs529925072 566 dbSNP
rs559581249 567 dbSNP
rs956901598 568 dbSNP
rs547764143 570 dbSNP
rs1489810102 572 dbSNP
rs1198573372 581 dbSNP
rs1260667833 582 dbSNP
rs532426355 583 dbSNP
rs1420836525 584 dbSNP
rs981722839 585 dbSNP
rs1362719405 586 dbSNP
rs1424884286 593 dbSNP
rs1485737029 594 dbSNP
rs1236345563 604 dbSNP
rs1404778808 608 dbSNP
rs969148384 609 dbSNP
rs1376119643 612 dbSNP
rs925566495 616 dbSNP
rs1222571280 622 dbSNP
rs1306312054 626 dbSNP
rs979624888 630 dbSNP
rs916307670 631 dbSNP
rs1289928848 632 dbSNP
rs564762399 642 dbSNP
rs748641562 644 dbSNP
rs1220502474 648 dbSNP
rs1273450694 661 dbSNP
rs952614176 662 dbSNP
rs1217855465 669 dbSNP
rs1025578305 679 dbSNP
rs969546365 684 dbSNP
rs1249200915 690 dbSNP
rs1315820258 692 dbSNP
rs543422862 694 dbSNP
rs1423645271 696 dbSNP
rs1235331883 713 dbSNP
rs367684319 716 dbSNP
rs1171487155 717 dbSNP
rs1356656172 719 dbSNP
rs1014163700 721 dbSNP
rs867041693 722 dbSNP
rs960526477 725 dbSNP
rs965270868 727 dbSNP
rs1302284463 728 dbSNP
rs1383587526 729 dbSNP
rs1454601731 733 dbSNP
rs1313047474 736 dbSNP
rs1358909433 739 dbSNP
rs1446472464 747 dbSNP
rs1015070613 753 dbSNP
rs1309104848 766 dbSNP
rs568380561 773 dbSNP
rs1461732333 779 dbSNP
rs1008895915 783 dbSNP
rs889215265 792 dbSNP
rs1332617762 793 dbSNP
rs781774231 794 dbSNP
rs1186803926 795 dbSNP
rs1422092305 796 dbSNP
rs1049027817 804 dbSNP
rs1408613777 810 dbSNP
rs996057478 836 dbSNP
rs1421898533 846 dbSNP
rs1011095000 850 dbSNP
rs2977461 855 dbSNP
rs1334713722 858 dbSNP
rs1382199248 861 dbSNP
rs1272183800 867 dbSNP
rs747390236 867 dbSNP
rs1040239160 869 dbSNP
rs944534225 879 dbSNP
rs912670347 889 dbSNP
rs1052934433 897 dbSNP
rs1277368152 898 dbSNP
rs1179540427 901 dbSNP
rs935346561 910 dbSNP
rs925263056 917 dbSNP
rs754136353 921 dbSNP
rs1233445353 923 dbSNP
rs947676674 925 dbSNP
rs1197910404 926 dbSNP
rs1456303425 928 dbSNP
rs764271706 935 dbSNP
rs561047613 937 dbSNP
rs969646888 939 dbSNP
rs916828416 950 dbSNP
rs1274768550 953 dbSNP
rs1235391303 958 dbSNP
rs1430442991 959 dbSNP
rs897278125 964 dbSNP
rs992363600 980 dbSNP
rs961148239 982 dbSNP
rs1405396381 983 dbSNP
rs1312277227 992 dbSNP
rs1226741182 998 dbSNP
rs1375600167 1001 dbSNP
rs984254271 1002 dbSNP
rs1430287858 1007 dbSNP
rs1014691036 1011 dbSNP
rs1345978554 1014 dbSNP
rs983585169 1015 dbSNP
rs951697560 1021 dbSNP
rs542303834 1041 dbSNP
rs1027292656 1044 dbSNP
rs1223814239 1045 dbSNP
rs574737612 1053 dbSNP
rs1444863410 1054 dbSNP
rs1215515627 1059 dbSNP
rs1270042451 1066 dbSNP
rs1490953682 1069 dbSNP
rs918447540 1070 dbSNP
rs972560126 1073 dbSNP
rs900457022 1084 dbSNP
rs965324181 1088 dbSNP
rs1389981383 1093 dbSNP
rs1419318188 1095 dbSNP
rs1019257691 1100 dbSNP
rs3735798 1101 dbSNP
rs541357351 1102 dbSNP
rs577132150 1103 dbSNP
rs138361776 1104 dbSNP
rs935379178 1106 dbSNP
rs1380342840 1107 dbSNP
rs903871267 1110 dbSNP
rs1043747067 1111 dbSNP
rs1348003727 1118 dbSNP
rs1238931299 1123 dbSNP
rs948039838 1125 dbSNP
rs893870364 1126 dbSNP
rs1267117839 1127 dbSNP
rs1438843475 1136 dbSNP
rs537453600 1137 dbSNP
rs1254669535 1139 dbSNP
rs1184680165 1147 dbSNP
rs1231247236 1149 dbSNP
rs916868150 1151 dbSNP
rs1031167082 1152 dbSNP
rs992792075 1166 dbSNP
rs1439207268 1189 dbSNP
rs939555317 1192 dbSNP
rs150538108 1203 dbSNP
rs1387262216 1208 dbSNP
rs371223056 1211 dbSNP
rs1422980391 1215 dbSNP
rs1161183497 1221 dbSNP
rs1389816176 1222 dbSNP
rs555088781 1229 dbSNP
rs906800593 1229 dbSNP
rs983209883 1233 dbSNP
rs1445333516 1236 dbSNP
rs951806944 1237 dbSNP
rs1027401442 1245 dbSNP
rs1243340400 1259 dbSNP
rs765329929 1264 dbSNP
rs947764987 1275 dbSNP
rs1318846675 1277 dbSNP
rs536743314 1278 dbSNP
rs1286767168 1292 dbSNP
rs1271568410 1304 dbSNP
rs1240080822 1307 dbSNP
rs1375246387 1309 dbSNP
rs1457729566 1309 dbSNP
rs189207261 1310 dbSNP
rs3735797 1317 dbSNP
rs532313035 1320 dbSNP
rs1169446111 1321 dbSNP
rs1018874787 1325 dbSNP
rs1454983252 1326 dbSNP
rs972568317 1328 dbSNP
rs766324177 1329 dbSNP
rs187234470 1330 dbSNP
rs1031888440 1337 dbSNP
rs1157466431 1341 dbSNP
rs549763757 1348 dbSNP
rs1417790031 1350 dbSNP
rs1327368334 1355 dbSNP
rs527890116 1357 dbSNP
rs1268821158 1371 dbSNP
rs985749532 1376 dbSNP
rs1432428157 1378 dbSNP
rs1204924551 1379 dbSNP
rs1265074551 1380 dbSNP
rs1213043339 1381 dbSNP
rs775165643 1388 dbSNP
rs1264957498 1390 dbSNP
rs531376575 1391 dbSNP
rs1043777418 1392 dbSNP
rs1489360288 1394 dbSNP
rs953972304 1400 dbSNP
rs1430549073 1402 dbSNP
rs373978422 1406 dbSNP
rs1421231757 1408 dbSNP
rs1216071649 1410 dbSNP
rs989495775 1414 dbSNP
rs958151675 1417 dbSNP
rs1031012329 1420 dbSNP
rs1464149123 1422 dbSNP
rs3735796 1423 dbSNP
rs181943995 1425 dbSNP
rs562494171 1436 dbSNP
rs865901678 1450 dbSNP
rs1025194176 1456 dbSNP
rs1012936154 1468 dbSNP
rs1312006920 1469 dbSNP
rs939567354 1472 dbSNP
rs1285802614 1473 dbSNP
rs908113774 1483 dbSNP
rs1232565671 1490 dbSNP
rs895397170 1491 dbSNP
rs1048569191 1495 dbSNP
rs3735795 1496 dbSNP
rs759146145 1501 dbSNP
rs920369240 1507 dbSNP
rs1297189545 1508 dbSNP
rs1036757376 1510 dbSNP
rs974462360 1511 dbSNP
rs1431400199 1514 dbSNP
rs943862969 1517 dbSNP
rs1363933280 1532 dbSNP
rs1455019378 1532 dbSNP
rs1376714103 1536 dbSNP
rs1173125863 1545 dbSNP
rs765043829 1548 dbSNP
rs985295713 1555 dbSNP
rs117863999 1559 dbSNP
rs559778667 1562 dbSNP
rs1366021921 1564 dbSNP
rs541246162 1565 dbSNP
rs1478024185 1568 dbSNP
rs748866465 1574 dbSNP
rs1238212615 1575 dbSNP
rs1285641674 1583 dbSNP
rs2977460 1586 dbSNP
rs189425876 1587 dbSNP
rs957993021 1588 dbSNP
rs1270786751 1589 dbSNP
rs1487432458 1594 dbSNP
rs1031531217 1608 dbSNP
rs1201550103 1609 dbSNP
rs1250575252 1611 dbSNP
rs776320297 1612 dbSNP
rs1176261134 1613 dbSNP
rs1379258021 1616 dbSNP
rs559215118 1617 dbSNP
rs1254630422 1618 dbSNP
rs970772769 1629 dbSNP
rs1025603080 1636 dbSNP
rs768262847 1646 dbSNP
rs1319012518 1648 dbSNP
rs968493874 1651 dbSNP
rs1012408414 1652 dbSNP
rs1022353514 1661 dbSNP
rs769047991 1662 dbSNP
rs1248462986 1669 dbSNP
rs959897631 1670 dbSNP
rs1319743795 1672 dbSNP
rs543750514 1673 dbSNP
rs1012245978 1674 dbSNP
rs866888683 1688 dbSNP
rs995597580 1693 dbSNP
rs75539227 1695 dbSNP
rs1036684122 1706 dbSNP
rs530457820 1709 dbSNP
rs1185124955 1720 dbSNP
rs1412039604 1721 dbSNP
rs1400065994 1724 dbSNP
rs1056899128 1725 dbSNP
rs1171592690 1725 dbSNP
rs1491069381 1725 dbSNP
rs1003545817 1726 dbSNP
rs759153879 1726 dbSNP
rs554983246 1727 dbSNP
rs890878706 1728 dbSNP
rs1047996896 1729 dbSNP
rs536778721 1730 dbSNP
rs920738810 1731 dbSNP
rs1038806352 1732 dbSNP
rs943078892 1733 dbSNP
rs923973052 1734 dbSNP
rs78254118 1735 dbSNP
rs1277546478 1736 dbSNP
rs1313714484 1736 dbSNP
rs1358727908 1736 dbSNP
rs201665905 1736 dbSNP
rs770619392 1736 dbSNP
rs1220417959 1737 dbSNP
rs1416437502 1737 dbSNP
rs554281203 1737 dbSNP
rs955719096 1753 dbSNP
rs1216138270 1756 dbSNP
rs1265790746 1757 dbSNP
rs1487540052 1758 dbSNP
rs1441910876 1759 dbSNP
rs538839919 1769 dbSNP
rs1193418234 1771 dbSNP
rs1254751067 1773 dbSNP
rs1201043310 1780 dbSNP
rs924543652 1782 dbSNP
rs1479292381 1783 dbSNP
rs1170832070 1784 dbSNP
rs571344265 1789 dbSNP
rs978624570 1790 dbSNP
rs550094904 1796 dbSNP
rs1196385045 1799 dbSNP
rs968524570 1800 dbSNP
rs1022717712 1801 dbSNP
rs1012742542 1802 dbSNP
rs1297393000 1804 dbSNP
rs1345998077 1805 dbSNP
rs959758124 1808 dbSNP
rs1272561791 1809 dbSNP
rs1343757368 1811 dbSNP
rs758604789 1822 dbSNP
rs1003984823 1823 dbSNP
rs886414651 1826 dbSNP
rs1216259112 1827 dbSNP
rs1048027851 1828 dbSNP
rs531484910 1830 dbSNP
rs1197452370 1835 dbSNP
rs1246167406 1837 dbSNP
rs1470582996 1841 dbSNP
rs1180615603 1847 dbSNP
rs1378659877 1856 dbSNP
rs1419339587 1863 dbSNP
rs1157767185 1870 dbSNP
rs961600349 1872 dbSNP
rs899339701 1873 dbSNP
rs1447371588 1874 dbSNP
rs1321551678 1875 dbSNP
rs1039253825 1881 dbSNP
rs943547810 1883 dbSNP
rs1399302000 1886 dbSNP
rs138836362 1888 dbSNP
rs1442247182 1888 dbSNP
rs756361021 1888 dbSNP
rs770418120 1888 dbSNP
rs78964779 1888 dbSNP
rs911659300 1888 dbSNP
rs1328969496 1889 dbSNP
rs567288508 1892 dbSNP
rs113502064 1893 dbSNP
rs1200539360 1899 dbSNP
rs1236449077 1912 dbSNP
rs202142539 1914 dbSNP
rs1184513709 1919 dbSNP
rs1368799305 1919 dbSNP
rs1167774517 1922 dbSNP
rs1161274665 1944 dbSNP
rs1164787358 1946 dbSNP
rs1466088653 1947 dbSNP
rs1332772885 1955 dbSNP
rs1397578622 1956 dbSNP
rs375978646 1956 dbSNP
rs55745631 1956 dbSNP
rs1259822941 1957 dbSNP
rs148236264 1957 dbSNP
rs1491462217 1958 dbSNP
rs1181081550 1959 dbSNP
rs1221064811 1960 dbSNP
rs1256232765 1967 dbSNP
rs1457403762 1972 dbSNP
rs1440792016 1974 dbSNP
rs746300223 1987 dbSNP
rs1258480659 1990 dbSNP
rs934338378 1994 dbSNP
rs1177235597 2010 dbSNP
rs1185067503 2013 dbSNP
rs1367737240 2015 dbSNP
rs1478102093 2025 dbSNP
rs1453673438 2030 dbSNP
rs924239718 2030 dbSNP
rs1420802062 2040 dbSNP
rs1464607158 2041 dbSNP
rs1290209744 2050 dbSNP
rs1302955460 2052 dbSNP
rs746056548 2054 dbSNP
rs1054683746 2055 dbSNP
rs527263005 2060 dbSNP
rs924523925 2061 dbSNP
rs947339140 2068 dbSNP
rs1402366169 2074 dbSNP
rs559816921 2076 dbSNP
rs1317869361 2090 dbSNP
rs1224126012 2098 dbSNP
rs1257845430 2109 dbSNP
rs1343120283 2135 dbSNP
rs1200157205 2136 dbSNP
rs563016235 2140 dbSNP
rs543062376 2141 dbSNP
rs1488520512 2147 dbSNP
rs544661668 2160 dbSNP
rs1375968336 2163 dbSNP
rs1260887297 2164 dbSNP
rs918012356 2173 dbSNP
rs1378920628 2185 dbSNP
rs1464227656 2187 dbSNP
rs991758297 2197 dbSNP
rs1171678333 2203 dbSNP
rs757312438 2204 dbSNP
rs1402187228 2212 dbSNP
rs184275026 2216 dbSNP
rs2977454 2220 dbSNP
rs1035529562 2225 dbSNP
rs1324496045 2226 dbSNP
rs920127838 2232 dbSNP
rs542628945 2234 dbSNP
rs1404940686 2236 dbSNP
rs1303494794 2245 dbSNP
rs1329455239 2246 dbSNP
rs574030927 2253 dbSNP
rs974233167 2256 dbSNP
rs961659280 2263 dbSNP
rs1356158517 2266 dbSNP
rs1363808916 2268 dbSNP
rs1218438628 2272 dbSNP
rs1160462019 2273 dbSNP
rs1015822039 2276 dbSNP
rs757672717 2277 dbSNP
rs181681564 2285 dbSNP
rs1026286377 2286 dbSNP
rs2944760 2289 dbSNP
rs2944759 2295 dbSNP
rs1197750426 2300 dbSNP
rs892859330 2308 dbSNP
rs1017841324 2313 dbSNP
rs1264707232 2314 dbSNP
rs1008153880 2326 dbSNP
rs1386241134 2328 dbSNP
rs1306965209 2332 dbSNP
rs1310089158 2344 dbSNP
rs1216784953 2357 dbSNP
rs1352311393 2361 dbSNP
rs1283856172 2362 dbSNP
rs759426355 2384 dbSNP
rs1239610699 2394 dbSNP
rs1306803016 2394 dbSNP
rs1316167961 2414 dbSNP
rs1222192672 2415 dbSNP
rs1032840832 2438 dbSNP
rs2944757 2444 dbSNP
rs1208665647 2445 dbSNP
rs572172637 2445 dbSNP
rs1441149218 2451 dbSNP
rs72694425 2452 dbSNP
rs1273972025 2453 dbSNP
rs1380052153 2453 dbSNP
rs750654531 2455 dbSNP
rs902931019 2472 dbSNP
rs189839891 2499 dbSNP
rs947033383 2500 dbSNP
rs1300264118 2507 dbSNP
rs938146244 2514 dbSNP
rs1380200188 2517 dbSNP
rs138028937 2517 dbSNP
rs397968671 2517 dbSNP
rs1228636002 2520 dbSNP
rs1314625726 2531 dbSNP
rs915860315 2538 dbSNP
rs991394920 2545 dbSNP
rs1232668213 2550 dbSNP
rs573096148 2553 dbSNP
rs772861643 2556 dbSNP
rs574704948 2557 dbSNP
rs928450767 2564 dbSNP
rs982613924 2569 dbSNP
rs1231913845 2576 dbSNP
rs1483375047 2578 dbSNP
rs1157594164 2583 dbSNP
rs1412154570 2584 dbSNP
rs781251904 2589 dbSNP
rs940133867 2591 dbSNP
rs950812286 2594 dbSNP
rs1425849788 2612 dbSNP
rs1026399080 2615 dbSNP
rs556495813 2633 dbSNP
rs1426328135 2640 dbSNP
rs963345357 2651 dbSNP
rs1376749713 2658 dbSNP
rs1477240026 2660 dbSNP
rs1425395553 2664 dbSNP
rs955801538 2672 dbSNP
rs1319954290 2681 dbSNP
rs1216177930 2688 dbSNP
rs1271694193 2704 dbSNP
rs1028013060 2714 dbSNP
rs1211885466 2719 dbSNP
rs975482544 2720 dbSNP
rs957151627 2725 dbSNP
rs28616790 2726 dbSNP
rs1007770257 2727 dbSNP
rs570820527 2734 dbSNP
rs776103633 2739 dbSNP
rs998663370 2741 dbSNP
rs890625931 2742 dbSNP
rs1030531670 2744 dbSNP
rs184791633 2753 dbSNP
rs1167391778 2756 dbSNP
rs1024077927 2757 dbSNP
rs1014194336 2762 dbSNP
rs556068234 2777 dbSNP
rs1042777073 2782 dbSNP
rs112708509 2784 dbSNP
rs1011212276 2786 dbSNP
rs894119539 2788 dbSNP
rs192573998 2789 dbSNP
rs746286105 2791 dbSNP
rs552725630 2792 dbSNP
rs1398137021 2799 dbSNP
rs898586577 2800 dbSNP
rs928535911 2802 dbSNP
rs1038441094 2810 dbSNP
rs940186189 2814 dbSNP
rs1217724441 2815 dbSNP
rs1046932075 2818 dbSNP
rs908740141 2819 dbSNP
rs929777252 2829 dbSNP
rs1247339259 2844 dbSNP
rs919354264 2846 dbSNP
rs921481793 2851 dbSNP
rs1394634465 2854 dbSNP
rs1440564418 2858 dbSNP
rs1159009279 2859 dbSNP
rs1362298778 2861 dbSNP
rs1402867804 2862 dbSNP
rs1417755203 2862 dbSNP
rs1170979226 2865 dbSNP
rs779100067 2870 dbSNP
rs973460653 2874 dbSNP
rs1477260080 2880 dbSNP
rs1416782735 2883 dbSNP
rs534263202 2889 dbSNP
rs957236440 2890 dbSNP
rs1472833509 2896 dbSNP
rs1369719542 2899 dbSNP
rs548816889 2909 dbSNP
rs1207899377 2921 dbSNP
rs1458951616 2927 dbSNP
rs1311872866 2932 dbSNP
rs1258411385 2944 dbSNP
rs1204937861 2947 dbSNP
rs1291168296 2947 dbSNP
rs749322196 2949 dbSNP
rs1199520657 2952 dbSNP
rs867367045 2960 dbSNP
rs28390280 2961 dbSNP
rs955020958 2980 dbSNP
rs1458382241 2983 dbSNP
rs1180792353 2997 dbSNP
rs967081997 2998 dbSNP
rs1030980980 3004 dbSNP
rs1468365044 3004 dbSNP
rs1414359778 3005 dbSNP
rs566124369 3010 dbSNP
rs1284163212 3016 dbSNP
rs553987639 3031 dbSNP
rs1402927337 3034 dbSNP
rs1332388304 3035 dbSNP
rs1268937272 3038 dbSNP
rs1034644032 3042 dbSNP
rs1238696434 3045 dbSNP
rs1465432715 3058 dbSNP
rs1002229661 3068 dbSNP
rs898472457 3070 dbSNP
rs1166444721 3073 dbSNP
rs1405489791 3085 dbSNP
rs1412397161 3089 dbSNP
rs1181698257 3090 dbSNP
rs1441400985 3122 dbSNP
rs548791506 3154 dbSNP
rs1021350119 3155 dbSNP
rs756261142 3157 dbSNP
rs369855585 3158 dbSNP
rs1237904442 3159 dbSNP
rs894142738 3166 dbSNP
rs1417102381 3167 dbSNP
rs1465650671 3170 dbSNP
rs1172196124 3175 dbSNP
rs187650483 3177 dbSNP
rs532868166 3182 dbSNP
rs1335268944 3187 dbSNP
rs1289169917 3191 dbSNP
rs375486572 3192 dbSNP
rs1379847766 3193 dbSNP
rs1319254183 3196 dbSNP
rs1047001870 3198 dbSNP
rs1220480645 3200 dbSNP
rs1338970658 3201 dbSNP
rs929813168 3203 dbSNP
rs1310613707 3206 dbSNP
rs1279038189 3208 dbSNP
rs921547706 3209 dbSNP
rs565511036 3213 dbSNP
rs919718789 3214 dbSNP
rs1037796312 3219 dbSNP
rs781249746 3220 dbSNP
rs942126491 3225 dbSNP
rs1195194861 3227 dbSNP
rs61453301 3230 dbSNP
rs557505893 3231 dbSNP
rs1172852058 3244 dbSNP
rs977053012 3246 dbSNP
rs1433204956 3251 dbSNP
rs986171662 3253 dbSNP
rs1312660085 3255 dbSNP
rs967132703 3261 dbSNP
rs562881647 3263 dbSNP
rs1293522687 3268 dbSNP
rs1348807252 3270 dbSNP
rs1161054718 3274 dbSNP
rs766071450 3275 dbSNP
rs1234080649 3276 dbSNP
rs762717035 3277 dbSNP
rs1343137886 3285 dbSNP
rs967522876 3286 dbSNP
rs1279414437 3290 dbSNP
rs749907494 3291 dbSNP
rs1218755266 3293 dbSNP
rs2977453 3297 dbSNP
rs958523245 3298 dbSNP
rs963274268 3303 dbSNP
rs1034495798 3321 dbSNP
rs1378936735 3322 dbSNP
rs1452205372 3323 dbSNP
rs184796711 3349 dbSNP
rs1173395161 3350 dbSNP
rs1488892610 3354 dbSNP
rs1268442619 3363 dbSNP
rs1361651260 3366 dbSNP
rs1422031376 3369 dbSNP
rs1220429532 3372 dbSNP
rs1387354853 3378 dbSNP
rs761433083 3381 dbSNP
rs543304246 3384 dbSNP
rs572518727 3391 dbSNP
rs1369032839 3407 dbSNP
rs1287419724 3409 dbSNP
rs1302374086 3414 dbSNP
rs1240010929 3417 dbSNP
rs1025569632 3421 dbSNP
rs1315532669 3423 dbSNP
rs868246182 3426 dbSNP
rs887192734 3427 dbSNP
rs898406712 3428 dbSNP
rs775844835 3434 dbSNP
rs1038247858 3440 dbSNP
rs1192669525 3454 dbSNP
rs1380548223 3467 dbSNP
rs1441883686 3468 dbSNP
rs1157375777 3471 dbSNP
rs1300885719 3472 dbSNP
rs942508306 3479 dbSNP
rs1401359561 3480 dbSNP
rs192455135 3484 dbSNP
rs760250629 3485 dbSNP
rs900027446 3490 dbSNP
rs1332240557 3497 dbSNP
rs1039853418 3498 dbSNP
rs1225193883 3499 dbSNP
rs1304618251 3507 dbSNP
rs1050909334 3542 dbSNP
rs1245519876 3543 dbSNP
rs1451476092 3543 dbSNP
rs1274477598 3555 dbSNP
rs1332099786 3561 dbSNP
rs1212553655 3568 dbSNP
rs1458821895 3573 dbSNP
rs933356644 3574 dbSNP
rs1250333836 3582 dbSNP
rs923237818 3589 dbSNP
rs1176610454 3591 dbSNP
rs1424872678 3592 dbSNP
rs772700341 3592 dbSNP
rs904774179 3596 dbSNP
rs545518121 3597 dbSNP
rs946337707 3601 dbSNP
rs1171482945 3607 dbSNP
rs141656181 3617 dbSNP
rs1263939208 3620 dbSNP
rs917026950 3633 dbSNP
rs990302657 3636 dbSNP
rs1296240169 3637 dbSNP
rs556590739 3639 dbSNP
rs537644600 3655 dbSNP
rs137933288 3656 dbSNP
rs990816742 3658 dbSNP
rs992960429 3671 dbSNP
rs959113769 3676 dbSNP
rs1258278593 3678 dbSNP
rs937095834 3680 dbSNP
rs774706950 3694 dbSNP
rs1323246799 3695 dbSNP
rs1202052497 3714 dbSNP
rs927143123 3719 dbSNP
rs771105838 3727 dbSNP
rs981558989 3730 dbSNP
rs1190552694 3732 dbSNP
rs555280338 3733 dbSNP
rs1475176482 3743 dbSNP
rs963324285 3745 dbSNP
rs563713444 3750 dbSNP
rs1408398842 3751 dbSNP
rs1276955018 3756 dbSNP
rs1170075201 3757 dbSNP
rs1359993058 3760 dbSNP
rs993830759 3760 dbSNP
rs1466298319 3762 dbSNP
rs778109796 3763 dbSNP
rs898437545 3764 dbSNP
rs1314501058 3800 dbSNP
rs1353467910 3802 dbSNP
rs545510871 3814 dbSNP
rs566161322 3815 dbSNP
rs1414162272 3824 dbSNP
rs1278242953 3846 dbSNP
rs1363513227 3856 dbSNP
rs1212315340 3861 dbSNP
rs1294356824 3875 dbSNP
rs551077472 3876 dbSNP
rs1303338326 3877 dbSNP
rs1278712488 3886 dbSNP
rs539387966 3888 dbSNP
rs951332000 3889 dbSNP
rs1006735793 3892 dbSNP
rs1218041851 3903 dbSNP
rs1243900627 3912 dbSNP
rs959334046 3913 dbSNP
rs78688261 3930 dbSNP
rs1403586950 3934 dbSNP
rs1435188195 3935 dbSNP
rs550605267 3938 dbSNP
rs933367633 3939 dbSNP
rs1434000465 3942 dbSNP
rs1029650147 3949 dbSNP
rs759167253 3954 dbSNP
rs1427959370 3976 dbSNP
rs1424431044 3986 dbSNP
rs901929965 3989 dbSNP
rs1287796487 3999 dbSNP
rs531823096 4003 dbSNP
rs946033523 4004 dbSNP
rs368505751 4016 dbSNP
rs1286913100 4017 dbSNP
rs990780282 4017 dbSNP
rs188035688 4024 dbSNP
rs1018890741 4025 dbSNP
rs1215136718 4034 dbSNP
rs937527309 4035 dbSNP
rs927419358 4036 dbSNP
rs549725440 4038 dbSNP
rs527973221 4040 dbSNP
rs1201496003 4042 dbSNP
rs774967680 4043 dbSNP
rs904784245 4044 dbSNP
rs1041930780 4049 dbSNP
rs771630493 4051 dbSNP
rs749650219 4059 dbSNP
rs778010275 4063 dbSNP
rs981623957 4064 dbSNP
rs1317017215 4073 dbSNP
rs183025577 4074 dbSNP
rs1200155800 4076 dbSNP
rs1323422621 4077 dbSNP
rs545092636 4081 dbSNP
rs972418918 4082 dbSNP
rs1281695239 4086 dbSNP
rs13261777 4092 dbSNP
rs533308717 4096 dbSNP
rs1016876869 4097 dbSNP
rs895502215 4098 dbSNP
rs1341708722 4104 dbSNP
rs1007182875 4111 dbSNP
rs1252537549 4114 dbSNP
rs953913599 4116 dbSNP
rs1380329929 4123 dbSNP
rs937126706 4124 dbSNP
rs1029945135 4126 dbSNP
rs559970728 4127 dbSNP
rs1418520118 4129 dbSNP
rs973241679 4139 dbSNP
rs901959727 4140 dbSNP
rs1401370448 4152 dbSNP
rs1041772167 4164 dbSNP
rs1460560682 4167 dbSNP
rs1393257780 4168 dbSNP
rs941819073 4169 dbSNP
rs1010206305 4170 dbSNP
rs983394096 4174 dbSNP
rs1441959300 4177 dbSNP
rs1285259005 4195 dbSNP
rs954630730 4199 dbSNP
rs893116789 4210 dbSNP
rs1318867584 4214 dbSNP
rs748327542 4217 dbSNP
rs1444499239 4230 dbSNP
rs1241687132 4244 dbSNP
rs1435819197 4253 dbSNP
rs1180865235 4254 dbSNP
rs937624246 4255 dbSNP
rs927563987 4264 dbSNP
rs1271901973 4273 dbSNP
rs1018319067 4280 dbSNP
rs1416572967 4282 dbSNP
rs562849123 4293 dbSNP
rs968832110 4298 dbSNP
rs1409682431 4300 dbSNP
rs754979574 4303 dbSNP
rs746751009 4313 dbSNP
rs1010469748 4320 dbSNP
rs1292718207 4325 dbSNP
rs191588183 4331 dbSNP
rs542054185 4333 dbSNP
rs573549255 4334 dbSNP
rs375023839 4335 dbSNP
rs918351198 4337 dbSNP
rs540173773 4353 dbSNP
rs574539106 4356 dbSNP
rs905612475 4360 dbSNP
rs1265459508 4361 dbSNP
rs1245161099 4365 dbSNP
rs972451144 4376 dbSNP
rs1428549950 4402 dbSNP
rs1194699665 4403 dbSNP
rs780025266 4415 dbSNP
rs141342843 4419 dbSNP
rs371649183 4420 dbSNP
rs1334913618 4421 dbSNP
rs1047591824 4425 dbSNP
rs1389841955 4428 dbSNP
rs558003888 4437 dbSNP
rs758306392 4441 dbSNP
rs985138316 4442 dbSNP
rs1383932203 4444 dbSNP
rs977158428 4447 dbSNP
rs1326065664 4452 dbSNP
rs748344890 4455 dbSNP
rs539065775 4456 dbSNP
rs1349720028 4459 dbSNP
rs367572433 4467 dbSNP
rs113941680 4468 dbSNP
rs978845576 4475 dbSNP
rs1206367588 4479 dbSNP
rs1440732413 4480 dbSNP
rs1232619422 4484 dbSNP
rs998456958 4495 dbSNP
rs968757236 4500 dbSNP
rs966488592 4506 dbSNP
rs1452920370 4512 dbSNP
rs556820912 4518 dbSNP
rs1020451670 4520 dbSNP
rs397841523 4523 dbSNP
rs1010353490 4524 dbSNP
rs1384407892 4530 dbSNP
rs1020345312 4532 dbSNP
rs1010242371 4534 dbSNP
rs1035907268 4535 dbSNP
rs1491191874 4535 dbSNP
rs3839859 4535 dbSNP
rs535519335 4535 dbSNP
rs1001620255 4541 dbSNP
rs1288121070 4542 dbSNP
rs1240729349 4544 dbSNP
rs1241147945 4544 dbSNP
rs1258411712 4545 dbSNP
rs1327800067 4547 dbSNP
rs1349716889 4549 dbSNP
rs752486186 4549 dbSNP
rs1277497145 4563 dbSNP
rs1193373590 4564 dbSNP
rs1251735001 4568 dbSNP
rs533758734 4576 dbSNP
rs1180217920 4585 dbSNP
rs1001524432 4595 dbSNP
rs1363737230 4598 dbSNP
rs905555815 4602 dbSNP
rs906135094 4604 dbSNP
rs1045953205 4606 dbSNP
rs781196703 4607 dbSNP
rs865846443 4619 dbSNP
rs567892218 4620 dbSNP
rs1373858554 4622 dbSNP
rs1392931218 4625 dbSNP
rs1304697870 4626 dbSNP
rs886179613 4627 dbSNP
rs1036791893 4629 dbSNP
rs933128904 4632 dbSNP
rs923197712 4641 dbSNP
rs549613306 4646 dbSNP
rs1363747112 4647 dbSNP
rs943270022 4660 dbSNP
rs1481787033 4664 dbSNP
rs911248627 4668 dbSNP
rs1250374723 4670 dbSNP
rs978732413 4682 dbSNP
rs1190118996 4688 dbSNP
rs750019004 4689 dbSNP
rs909632859 4701 dbSNP
rs1474995622 4709 dbSNP
rs764995720 4710 dbSNP
rs1171325263 4712 dbSNP
rs527858872 4716 dbSNP
rs145874185 4717 dbSNP
rs1296260665 4726 dbSNP
rs1369847610 4730 dbSNP
rs1407726651 4731 dbSNP
rs2235117 4737 dbSNP
rs9969410 4739 dbSNP
rs796941707 4740 dbSNP
rs1036254305 4752 dbSNP
rs1227250738 4756 dbSNP
rs148933423 4762 dbSNP
rs767950616 4763 dbSNP
rs1202841681 4771 dbSNP
rs1198196153 4775 dbSNP
rs1489654502 4776 dbSNP
rs1213714018 4785 dbSNP
rs966519487 4787 dbSNP
rs188098251 4803 dbSNP
rs1020777382 4805 dbSNP
rs544408312 4807 dbSNP
rs957709622 4808 dbSNP
rs970294611 4810 dbSNP
rs1446286168 4823 dbSNP
rs1033084154 4829 dbSNP
rs879933126 4833 dbSNP
rs1005854187 4843 dbSNP
rs886189451 4846 dbSNP
rs1202018107 4847 dbSNP
rs1001952258 4851 dbSNP
rs905838331 4867 dbSNP
rs1026043727 4874 dbSNP
rs997770006 4879 dbSNP
rs901706891 4892 dbSNP
rs6578113 4902 dbSNP
rs1223083546 4903 dbSNP
rs1363598267 4916 dbSNP
rs1212512387 4917 dbSNP
rs1014478461 4918 dbSNP
rs943341831 4923 dbSNP
rs903774662 4924 dbSNP
rs183055505 4926 dbSNP
rs1216559579 4933 dbSNP
rs1243954433 4934 dbSNP
rs559027623 4938 dbSNP
rs941494220 4942 dbSNP
rs913338461 4944 dbSNP
rs763827403 4945 dbSNP
rs988939825 4945 dbSNP
rs928857939 4946 dbSNP
rs1416555034 4947 dbSNP
rs1413881038 4948 dbSNP
rs980669453 4955 dbSNP
rs533918793 4957 dbSNP
rs773304419 4958 dbSNP
rs922254480 4961 dbSNP
rs1479218696 4969 dbSNP
rs770061979 4970 dbSNP
rs1371317058 4973 dbSNP
rs557776999 4977 dbSNP
rs945333684 4979 dbSNP
rs984472419 4987 dbSNP
rs1301756849 4990 dbSNP
rs1193833295 4995 dbSNP
rs748119847 5006 dbSNP
rs989302620 5007 dbSNP
rs776795137 5008 dbSNP
rs1033527098 5009 dbSNP
rs980170869 5016 dbSNP
rs1273995219 5020 dbSNP
rs535005794 5024 dbSNP
rs970469862 5025 dbSNP
rs1262214945 5036 dbSNP
rs1024348224 5039 dbSNP
rs1477649875 5050 dbSNP
rs1203282243 5053 dbSNP
rs1177656309 5055 dbSNP
rs1410074362 5070 dbSNP
rs768674395 5085 dbSNP
rs897437337 5088 dbSNP
rs6578112 5099 dbSNP
rs1260224697 5109 dbSNP
rs1394734549 5114 dbSNP
rs780189027 5122 dbSNP
rs888598730 5123 dbSNP
rs1049946727 5140 dbSNP
rs932385819 5145 dbSNP
rs900915753 5152 dbSNP
rs1040708901 5154 dbSNP
rs1330940771 5156 dbSNP
rs1443397063 5157 dbSNP
rs945030515 5160 dbSNP
rs575198082 5161 dbSNP
rs758252904 5163 dbSNP
rs556899545 5173 dbSNP
rs989332049 5176 dbSNP
rs1450747064 5197 dbSNP
rs947405024 5200 dbSNP
rs1289447405 5216 dbSNP
rs936501678 5226 dbSNP
rs1450756174 5236 dbSNP
rs148047035 5241 dbSNP
rs926441673 5242 dbSNP
rs745739787 5243 dbSNP
rs778360675 5254 dbSNP
rs1234484962 5259 dbSNP
rs1471597076 5260 dbSNP
rs752270864 5263 dbSNP
rs938813814 5264 dbSNP
rs767317157 5268 dbSNP
rs1161033284 5270 dbSNP
rs1402090868 5272 dbSNP
rs980295435 5273 dbSNP
rs1410837194 5278 dbSNP
rs535405011 5280 dbSNP
rs377377969 5281 dbSNP
rs1369217329 5288 dbSNP
rs1409824752 5291 dbSNP
rs909476129 5292 dbSNP
rs985068641 5311 dbSNP
rs950928765 5312 dbSNP
rs1283776083 5313 dbSNP
rs918970274 5333 dbSNP
rs1214916383 5344 dbSNP
rs1274902799 5345 dbSNP
rs976149141 5347 dbSNP
rs965832066 5354 dbSNP
rs1017732885 5375 dbSNP
rs553054681 5376 dbSNP
rs534398817 5378 dbSNP
rs1184811992 5385 dbSNP
rs796194537 5385 dbSNP
rs1015872607 5387 dbSNP
rs1005764833 5390 dbSNP
rs1475561935 5395 dbSNP
rs1181590010 5396 dbSNP
rs1388770548 5397 dbSNP
rs953001191 5399 dbSNP
rs1429528490 5407 dbSNP
rs145686992 5426 dbSNP
rs207470033 5431 dbSNP
rs1333646316 5445 dbSNP
rs551832421 5453 dbSNP
rs900958888 5462 dbSNP
rs865924860 5467 dbSNP
rs1339732619 5469 dbSNP
rs1227395305 5474 dbSNP
rs1280899306 5489 dbSNP
rs1350029155 5492 dbSNP
rs1198202468 5494 dbSNP
rs1040741363 5496 dbSNP
rs1009203942 5502 dbSNP
rs1447205365 5521 dbSNP
rs892088706 5535 dbSNP
rs113871356 5536 dbSNP
rs1245821913 5546 dbSNP
rs763568780 5549 dbSNP
rs936634039 5550 dbSNP
rs1397404094 5556 dbSNP
rs569193362 5558 dbSNP
rs926532200 5564 dbSNP
rs1172062372 5565 dbSNP
rs1385830319 5566 dbSNP
rs1230531057 5568 dbSNP
rs1360878056 5572 dbSNP
rs1318705067 5576 dbSNP
rs374225940 5584 dbSNP
rs1434065767 5586 dbSNP
rs1303936225 5590 dbSNP
rs529224001 5594 dbSNP
rs1332759045 5596 dbSNP
rs561849983 5601 dbSNP
rs548380351 5604 dbSNP
rs546649720 5605 dbSNP
rs1206410231 5608 dbSNP
rs917354237 5620 dbSNP
rs1265799082 5623 dbSNP
rs1464196916 5624 dbSNP
rs532585541 5630 dbSNP
rs528312028 5631 dbSNP
rs1431928448 5632 dbSNP
rs759110207 5634 dbSNP
rs141015637 5635 dbSNP
rs984521263 5636 dbSNP
rs376445310 5639 dbSNP
rs545811060 5640 dbSNP
rs1462228493 5659 dbSNP
rs953014641 5665 dbSNP
rs536861582 5666 dbSNP
rs1384868404 5668 dbSNP
rs997037735 5670 dbSNP
rs1229672807 5671 dbSNP
rs1285956831 5674 dbSNP
rs577734097 5678 dbSNP
rs1019323998 5682 dbSNP
rs541849848 5683 dbSNP
rs1274673445 5709 dbSNP
rs892206249 5712 dbSNP
rs1209648668 5713 dbSNP
rs1251805866 5714 dbSNP
rs1053494555 5719 dbSNP
rs1180106198 5724 dbSNP
rs967767009 5732 dbSNP
rs1000922768 5734 dbSNP
rs1167283180 5742 dbSNP
rs1366970145 5762 dbSNP
rs1456154582 5773 dbSNP
rs1292778672 5775 dbSNP
rs1178007714 5783 dbSNP
rs76540425 5787 dbSNP
rs1009321453 5795 dbSNP
rs1411656292 5795 dbSNP
rs905138839 5797 dbSNP
rs1349270675 5799 dbSNP
rs763163172 5801 dbSNP
rs569061099 5802 dbSNP
rs1480391274 5803 dbSNP
rs1314381347 5809 dbSNP
rs1454682420 5820 dbSNP
rs1319573691 5822 dbSNP
rs1244482677 5829 dbSNP
rs574442609 5832 dbSNP
rs373313135 5833 dbSNP
rs1484317472 5836 dbSNP
rs949268193 5840 dbSNP
rs1203562174 5841 dbSNP
rs917717655 5843 dbSNP
rs1223943069 5847 dbSNP
rs1251736876 5861 dbSNP
rs1486017659 5861 dbSNP
rs553142549 5872 dbSNP
rs1057247366 5877 dbSNP
rs1002887474 5882 dbSNP
rs1163799453 5883 dbSNP
rs1373490860 5885 dbSNP
rs940122426 5887 dbSNP
rs1244356587 5889 dbSNP
rs1166560648 5890 dbSNP
rs908609299 5895 dbSNP
rs563514763 5903 dbSNP
rs1414810787 5905 dbSNP
rs1044397600 5910 dbSNP
rs368992699 5914 dbSNP
rs1308072732 5928 dbSNP
rs550266457 5935 dbSNP
rs112953029 5936 dbSNP
rs931276856 5939 dbSNP
rs1294905272 5941 dbSNP
rs1226689765 5943 dbSNP
rs763370284 5944 dbSNP
rs1274488782 5957 dbSNP
rs1049267969 5966 dbSNP
rs921547631 5971 dbSNP
rs1405075636 5974 dbSNP
rs1235869586 5981 dbSNP
rs1483039478 5982 dbSNP
rs773640214 5982 dbSNP
rs765328300 5983 dbSNP
rs944964344 5986 dbSNP
rs1301236470 5995 dbSNP
rs1421375851 6006 dbSNP
rs1364162923 6009 dbSNP
rs965523177 6016 dbSNP
rs35111046 6020 dbSNP
rs1356879649 6028 dbSNP
rs1158187990 6032 dbSNP
rs1465115853 6043 dbSNP
rs910235517 6044 dbSNP
rs1366944956 6045 dbSNP
rs1433320972 6049 dbSNP
rs1297380464 6065 dbSNP
rs1019773223 6070 dbSNP
rs988264914 6083 dbSNP
rs956480217 6085 dbSNP
rs1032495970 6086 dbSNP
rs1216624313 6087 dbSNP
rs573383821 6095 dbSNP
rs558317033 6096 dbSNP
rs914952460 6101 dbSNP
rs539613892 6106 dbSNP
rs1463750087 6111 dbSNP
rs762125534 6112 dbSNP
rs987950908 6116 dbSNP
rs1201818316 6117 dbSNP
rs2977452 6126 dbSNP
rs1439573551 6128 dbSNP
rs1192786974 6132 dbSNP
rs1268199227 6132 dbSNP
rs1423017947 6133 dbSNP
rs1432043413 6134 dbSNP
rs1220913151 6135 dbSNP
rs1159259422 6136 dbSNP
rs1390348335 6137 dbSNP
rs1455378748 6141 dbSNP
rs1034845026 6142 dbSNP
rs1395597832 6145 dbSNP
rs1439058240 6156 dbSNP
rs550818564 6164 dbSNP
rs982460076 6173 dbSNP
rs1367540619 6190 dbSNP
rs1224384008 6210 dbSNP
rs535465842 6212 dbSNP
rs1013475453 6213 dbSNP
rs1327327255 6225 dbSNP
rs1315476884 6227 dbSNP
rs969331545 6229 dbSNP
rs896396757 6230 dbSNP
rs568106073 6234 dbSNP
rs1451931105 6235 dbSNP
rs546738134 6237 dbSNP
rs1036237495 6242 dbSNP
rs940491112 6252 dbSNP
rs1401301919 6254 dbSNP
rs1385651764 6268 dbSNP
rs887866783 6271 dbSNP
rs887211484 6272 dbSNP
rs1027717359 6286 dbSNP
rs1048933964 6290 dbSNP
rs931333351 6291 dbSNP
rs768831981 6297 dbSNP
rs541509474 6318 dbSNP
rs993695223 6318 dbSNP
rs528566013 6319 dbSNP
rs975429434 6333 dbSNP
rs944330640 6337 dbSNP
rs1428856944 6346 dbSNP
rs1348642355 6362 dbSNP
rs912795819 6370 dbSNP
rs1040530656 6374 dbSNP
rs1358800925 6375 dbSNP
rs1227675070 6376 dbSNP
rs1229789641 6381 dbSNP
rs1467192060 6384 dbSNP
rs1450952795 6391 dbSNP
rs1205709842 6392 dbSNP
rs988299356 6393 dbSNP
rs956842173 6397 dbSNP
rs1032112448 6402 dbSNP
rs1481762656 6405 dbSNP
rs1430363348 6414 dbSNP
rs373429054 6415 dbSNP
rs1186406334 6416 dbSNP
rs747143164 6419 dbSNP
rs1161820397 6424 dbSNP
rs1413455628 6428 dbSNP
rs1265319481 6429 dbSNP
rs532633902 6430 dbSNP
rs1050052441 6440 dbSNP
rs7009129 6455 dbSNP
rs1409261857 6458 dbSNP
rs915002945 6460 dbSNP
rs1229035985 6473 dbSNP
rs1326474283 6478 dbSNP
rs1446169313 6479 dbSNP
rs1294808415 6481 dbSNP
rs1380401164 6494 dbSNP
rs1381079951 6495 dbSNP
rs145259967 6496 dbSNP
rs1203768045 6498 dbSNP
rs1014820599 6500 dbSNP
rs369248963 6501 dbSNP
rs1004736127 6508 dbSNP
rs887568380 6509 dbSNP
rs1184877816 6511 dbSNP
rs1236570237 6513 dbSNP
rs139633549 6513 dbSNP
rs542133981 6518 dbSNP
rs1463623297 6525 dbSNP
rs778788382 6535 dbSNP
rs147434947 6540 dbSNP
rs1173223001 6541 dbSNP
rs1404374764 6545 dbSNP
rs559367309 6545 dbSNP
rs541163720 6549 dbSNP
rs114795417 6552 dbSNP
rs1245502976 6559 dbSNP
rs969719611 6567 dbSNP
rs559717102 6571 dbSNP
rs558343316 6572 dbSNP
rs1275375834 6581 dbSNP
rs1052616198 6583 dbSNP
rs935518812 6584 dbSNP
rs796252664 6586 dbSNP
rs540029891 6592 dbSNP
rs1240932088 6597 dbSNP
rs1449258009 6600 dbSNP
rs1200113457 6604 dbSNP
rs1027645064 6605 dbSNP
rs866686166 6606 dbSNP
rs1172115122 6607 dbSNP
rs1389609287 6610 dbSNP
rs969583701 6611 dbSNP
rs36119666 6612 dbSNP
rs376589326 6614 dbSNP
rs1322280794 6618 dbSNP
rs916315370 6633 dbSNP
rs1224610336 6637 dbSNP
rs575708856 6638 dbSNP
rs1009027197 6643 dbSNP
rs889383758 6647 dbSNP
rs1451703973 6648 dbSNP
rs960338029 6656 dbSNP
rs557272957 6659 dbSNP
rs535744514 6660 dbSNP
rs1050606372 6662 dbSNP
rs1229789418 6680 dbSNP
rs1265857686 6690 dbSNP
rs946954853 6691 dbSNP
rs1270066540 6693 dbSNP
rs1412864449 6696 dbSNP
rs1473619792 6702 dbSNP
rs1014851699 6703 dbSNP
rs1267011699 6704 dbSNP
rs1393298777 6706 dbSNP
rs1385069955 6709 dbSNP
rs1052103348 6712 dbSNP
rs935111135 6718 dbSNP
rs770675076 6723 dbSNP
rs927703026 6726 dbSNP
rs1397302222 6727 dbSNP
rs947848774 6730 dbSNP
rs1267674205 6734 dbSNP
rs1354842806 6736 dbSNP
rs1297745117 6740 dbSNP
rs748952727 6743 dbSNP
rs1484050473 6745 dbSNP
rs568144759 6758 dbSNP
rs952590353 6759 dbSNP
rs1424683974 6764 dbSNP
rs920634264 6765 dbSNP
rs972054833 6766 dbSNP
rs565225731 6769 dbSNP
rs534680609 6770 dbSNP
rs570927739 6777 dbSNP
rs1383717483 6780 dbSNP
rs755619885 6784 dbSNP
rs1411101882 6785 dbSNP
rs1305678522 6786 dbSNP
rs899943484 6787 dbSNP
rs1438113049 6789 dbSNP
rs1245736281 6791 dbSNP
rs1039736111 6794 dbSNP
rs752210201 6795 dbSNP
rs1344987913 6800 dbSNP
rs552180590 6805 dbSNP
rs1193624040 6810 dbSNP
rs552348969 6812 dbSNP
rs1254375708 6815 dbSNP
rs891088953 6816 dbSNP
rs73713162 6819 dbSNP
rs935616202 6826 dbSNP
rs577133389 6827 dbSNP
rs569862520 6829 dbSNP
rs1166157961 6835 dbSNP
rs1353355796 6877 dbSNP
rs925556067 6889 dbSNP
rs1466107536 6900 dbSNP
rs1044309384 6920 dbSNP
rs948216228 6924 dbSNP
rs34227953 6928 dbSNP
rs1452335338 6933 dbSNP
rs1298889568 6943 dbSNP
rs1367960716 6945 dbSNP
rs916350773 6948 dbSNP
rs148611932 6970 dbSNP
rs1312809816 6971 dbSNP
rs1011150422 6973 dbSNP
rs960368103 6976 dbSNP
rs529998650 6985 dbSNP
rs1248470862 6986 dbSNP
rs1451113263 6993 dbSNP
rs1367485269 6998 dbSNP
rs1418750784 7002 dbSNP
rs560234699 7003 dbSNP
rs1469022445 7004 dbSNP
rs1320831257 7007 dbSNP
rs1304304078 7008 dbSNP
rs1391212072 7008 dbSNP
rs1433393821 7014 dbSNP
rs559654092 7023 dbSNP
rs1288749958 7025 dbSNP
rs1424511661 7028 dbSNP
rs1220983931 7029 dbSNP
rs541043769 7030 dbSNP
rs1160713398 7038 dbSNP
rs1027558861 7042 dbSNP
rs758967704 7046 dbSNP
rs1052540053 7055 dbSNP
rs1270255384 7058 dbSNP
rs999162623 7065 dbSNP
rs1213409107 7068 dbSNP
rs750713938 7068 dbSNP
rs1241417553 7071 dbSNP
rs1470705594 7072 dbSNP
rs1488805769 7074 dbSNP
rs906295367 7080 dbSNP
rs1426518271 7083 dbSNP
rs1362905316 7087 dbSNP
rs541521743 7095 dbSNP
rs1413750332 7096 dbSNP
rs1046122078 7103 dbSNP
rs1268912087 7104 dbSNP
rs190913276 7105 dbSNP
rs1439289226 7111 dbSNP
rs916441780 7117 dbSNP
rs1344890367 7118 dbSNP
rs1410547790 7119 dbSNP
rs1048255751 7120 dbSNP
rs931254422 7121 dbSNP
rs1018318150 7122 dbSNP
rs1221857639 7122 dbSNP
rs1286243163 7123 dbSNP
rs1205549506 7133 dbSNP
rs574579525 7139 dbSNP
rs962041409 7141 dbSNP
rs768926392 7142 dbSNP
rs891203153 7146 dbSNP
rs565001420 7147 dbSNP
rs1253483893