miRTarBase - #MIRT478911 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CPSF7   
Synonyms CFIm59
Description cleavage and polyadenylation specific factor 7
Transcript NM_001136040   
Other Transcripts NM_001142565 , NM_024811   
Expression
Putative miRNA Targets on CPSF7
3'UTR of CPSF7
(miRNA target sites are highlighted)
>CPSF7|NM_001136040|3'UTR
   1 GAAAGGAGTCTGGTTGGAAGCAAATGTTTTTTTAATGGACTTGCATCTCCTCACCTTGATCAGGACTAAAGGACGGAGGC
  81 CGCCCCACCCCCTTCCCTTTCCTCCAAACCCCTAACTCCCTCCAGACACCCAGGGAATACCCTCTGCCCCACAGGATTGA
 161 AGACTGCTTGGCAGTCCTCCCAATCCCACACCTCCTGTTTGCCAGGGGAAAGAACCTAAAGACTTCGTGTGATTGGGAGG
 241 GGTGGCAGACAGGAAGAAAACATGTCCAGGCCCCTGGTCTCCATAGAGAATGGTGCTTTGTCCAAGAAAACGTATGAGTT
 321 TCTGATTCTCCGGGAGCCGTTCAATGGTGAGGTTGATGGGAAGACTTCCTTCCCAAAGAAAATAGATCCTCCATGCAGGA
 401 TCTAGGAGAGTGACTGGGTGTGCCAAAATATGCCCAGGGTCCTGCCCTCAGCACTAGATTTAATGGGGCCAAGAGGGTCC
 481 AAACCCCTTGCTAACATACCACTTCTTTGTTTAACTCCTTTACCTTTCCAGCCCTTTGAGGAGGGACCATGAGAACAGAA
 561 ATTACCTTATGAAAAGCTACTTCTGTTCCTGCTTTCCCTCTCACGTATTGACGGTTTATTTCTTTGACCTCCCAGAGGGC
 641 TGAACTCTTTCAACTCTGCGCTGCCCAGCCTTCTCAGTGGACTTGCCCCTCCTAAGCAGAGAAGGCCTATGAGGTTGCTT
 721 GCTGCTGGGAAGCCTGGCAGAGCCAATTACCACCCTCTGCTGCTTAGTGCTTGGGTACCTCTTGCAATAACCAGCTCTTA
 801 GTTGTTCCCTTTCCCTGGGGCTTTTCCATTTAACACATGGAGCCCTTCCCCCAGAAGGCTACTTCCTTGTTTTAGAGGAA
 881 GGTACTGCCCATTGGGAGATGGGGACATTGGGACCTCAGCAATGAAGAACCCTTGTGAAGTAACCAGGAGGAATGGGGAA
 961 AGAAGCAAGTTGGGCAGGATATGGCCTACTTCCATAGGCTTTTCTTTTTTCAGGTTTGATGTAAGCATGGGCTTACATCC
1041 CCCAGGTACATACTTTTACTTATTGTGGGATAACCTGGCACTAGTAGGCAGGTAAAGTCACAAATTTGGTGTCTTTTCAC
1121 CTTTTGACTGTTGACTTAATAGCTCCTCTCACTCTGCCTGGAGATACTTCCTGCCTCAGATGAGGAGCCAGAAGAAACAG
1201 AGCCCGACTTGAATGAACTCAGCTCAGAGTTCTAAGGACCAGCATTCTGGGGGCCATTTTCTCTACAGGCAAATGGAATT
1281 GCTTTTCCATAACATCCAAATTGTAATGTGGTTGCTGCTGAAGGAGGAGGCAGCAGCGAGGTCCTGCGGTACCCATGGGG
1361 TGATGCTACTTCTGCATGCATCTACAGGGCATCTGACACCTAACATGAGACGTGGCATGTGAGATGAGACTTGGCATGTG
1441 AGACATAGGGTCACTAGAGACCCTTCTGGGTCAGAGGAGAGAGACTGAATTGGACTAAACCCGTCCTCTGTTCCCAGCAC
1521 GTTTCTCATATAGCCCTCAGTCACTGAGGGAGTCCCCCGCAGGATTGGAGAGGCACATTCCCTTGGGACAGAGGCTACAG
1601 GTTGGAGCTTTTTTTCCCCTGTCCCCCAACCCCATCCCCACCTCCACTTCAGAACATGGCACCCCACCCAACTGGCCAAG
1681 TGTTAAGTGATGTGCTTATTGAGAGCAACTCCGGGTGTCTTTTAAAATGTAGAGAAAAGGTGACAGTTTAAGGAAAAATA
1761 TATATAGAATACCAGAAATGCCGTTTACCCGGAGAATTTTTTTCTCCCCATTTGTTTTGTTTTTACTCAATGACACCATT
1841 TTTAGTTTTATTTCCTGATAGCAAAAGGAAAAAAAACACCCATCCCTCAAAAAGGCCAAGGTCCCGTCCCCCTGTTGTCG
1921 GTGATTTGTTTGTCTTTCTGATAGGTTGAAAATTGTGTAATAAACTTGATGACGCTGTCAATCTTTTATACTGCATTGTA
2001 TTTTTTTCCTTTTGTAACAAAATATTTTTAAATAATAAATGGGGTGTGAGCTGTTTTATGGAAAAAAAAAAAAAAAAAAA
2081 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC----ACGACGAu 5'
            ||||:::| |||    ||||||| 
Target 5' tcCAAATTGTAATGTGGTTGCTGCTg 3'
1295 - 1320 166.00 -15.10
2
miRNA  3' guGUU--UGGUAAUACACGACGAu 5'
            |||  ||||   | ||||||| 
Target 5' gcCAATTACCACCCTCTGCTGCTt 3'
742 - 765 158.00 -13.80
3
miRNA  3' gugUUUGG-UAAU---AC--ACGACGAu 5'
             |::|| || |   ||  ||||||| 
Target 5' agaAGGCCTATGAGGTTGCTTGCTGCTg 3'
700 - 727 149.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26971772 39 COSMIC
COSN26971771 49 COSMIC
COSN5915933 268 COSMIC
COSN21204363 729 COSMIC
COSN24491809 847 COSMIC
COSN24360938 1278 COSMIC
COSN21245898 1285 COSMIC
COSN15189396 1393 COSMIC
COSN26374393 1732 COSMIC
COSN15838880 1868 COSMIC
COSN20941560 1902 COSMIC
COSN1539992 2195 COSMIC
COSN7015942 2538 COSMIC
COSN18765754 2868 COSMIC
COSN17057857 3517 COSMIC
COSN5795473 3865 COSMIC
COSN28131636 5188 COSMIC
COSN5307958 5923 COSMIC
COSN6610675 6106 COSMIC
COSN21290740 6213 COSMIC
COSN21092892 6218 COSMIC
COSN28636844 6501 COSMIC
COSN30175639 6564 COSMIC
COSN24997063 6568 COSMIC
COSN5915932 6681 COSMIC
COSN16720533 6934 COSMIC
COSN1135557 6966 COSMIC
COSN15660699 7480 COSMIC
COSN16437289 7511 COSMIC
COSN31552051 7735 COSMIC
COSN2508372 7744 COSMIC
COSN30165599 7771 COSMIC
COSN27899902 7871 COSMIC
COSN29248825 8097 COSMIC
COSN26573370 8128 COSMIC
COSN31532551 8206 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1327762277 1 dbSNP
rs370581145 8 dbSNP
rs745966296 9 dbSNP
rs779045047 13 dbSNP
rs201473405 20 dbSNP
rs200407063 21 dbSNP
rs764518218 25 dbSNP
rs1192864304 26 dbSNP
rs756478141 27 dbSNP
rs753227647 32 dbSNP
rs1191210955 34 dbSNP
rs768161827 38 dbSNP
rs747461406 46 dbSNP
rs1035009174 47 dbSNP
rs1383184894 55 dbSNP
rs1421328366 60 dbSNP
rs1158998332 64 dbSNP
rs917517161 64 dbSNP
rs111435714 73 dbSNP
rs992109576 74 dbSNP
rs1417782906 76 dbSNP
rs1335628157 80 dbSNP
rs1002241011 82 dbSNP
rs1446862383 82 dbSNP
rs1458190752 88 dbSNP
rs1282112184 91 dbSNP
rs1378628608 99 dbSNP
rs1252533412 102 dbSNP
rs528127049 103 dbSNP
rs1218681725 106 dbSNP
rs1353630251 110 dbSNP
rs1203848291 116 dbSNP
rs959075921 117 dbSNP
rs905092546 119 dbSNP
rs529574178 129 dbSNP
rs546844889 130 dbSNP
rs1241581735 136 dbSNP
rs1441760010 143 dbSNP
rs1006007140 145 dbSNP
rs951764277 153 dbSNP
rs1026042007 159 dbSNP
rs886951062 162 dbSNP
rs1468546775 169 dbSNP
rs1174198510 179 dbSNP
rs1402334395 189 dbSNP
rs1046761379 191 dbSNP
rs1402108239 197 dbSNP
rs933740431 202 dbSNP
rs1375135986 213 dbSNP
rs900965229 224 dbSNP
rs993350758 230 dbSNP
rs186474200 231 dbSNP
rs146399364 232 dbSNP
rs753258996 239 dbSNP
rs942398785 239 dbSNP
rs1346298496 243 dbSNP
rs1393751681 249 dbSNP
rs1007882626 256 dbSNP
rs889162851 265 dbSNP
rs1459262476 267 dbSNP
rs1403144099 274 dbSNP
rs1292310889 280 dbSNP
rs1199443223 281 dbSNP
rs1237364520 310 dbSNP
rs1435823548 311 dbSNP
rs1200707834 319 dbSNP
rs1457435334 319 dbSNP
rs544912919 322 dbSNP
rs764590619 324 dbSNP
rs1350543162 330 dbSNP
rs1378193823 340 dbSNP
rs1477654909 348 dbSNP
rs979715992 361 dbSNP
rs936115581 366 dbSNP
rs946826761 375 dbSNP
rs1465841820 382 dbSNP
rs914068188 384 dbSNP
rs1393839230 386 dbSNP
rs1390074224 387 dbSNP
rs1325924357 388 dbSNP
rs182229130 389 dbSNP
rs1281471217 390 dbSNP
rs960766619 393 dbSNP
rs1219512153 403 dbSNP
rs1041760625 404 dbSNP
rs1337682711 412 dbSNP
rs1378218213 416 dbSNP
rs1267706190 418 dbSNP
rs1450978207 422 dbSNP
rs1035129357 428 dbSNP
rs561888545 444 dbSNP
rs1264745295 447 dbSNP
rs1177830909 449 dbSNP
rs981159786 456 dbSNP
rs950219305 457 dbSNP
rs141217270 464 dbSNP
rs373830949 464 dbSNP
rs1459113839 466 dbSNP
rs1017231979 467 dbSNP
rs1391834023 473 dbSNP
rs1005470674 476 dbSNP
rs1381096390 483 dbSNP
rs1252530165 503 dbSNP
rs1189408023 506 dbSNP
rs1342900323 516 dbSNP
rs1400754792 522 dbSNP
rs1294941290 523 dbSNP
rs1487841881 524 dbSNP
rs1265581680 529 dbSNP
rs1265838721 538 dbSNP
rs1224250757 539 dbSNP
rs887065535 549 dbSNP
rs1219940881 562 dbSNP
rs542333035 569 dbSNP
rs1025423768 578 dbSNP
rs1488567305 581 dbSNP
rs917379721 584 dbSNP
rs1258969064 585 dbSNP
rs1285724329 585 dbSNP
rs1187751835 606 dbSNP
rs1369441290 609 dbSNP
rs573225346 614 dbSNP
rs1241263845 617 dbSNP
rs1337930536 618 dbSNP
rs1424469949 631 dbSNP
rs1162031004 638 dbSNP
rs991787192 639 dbSNP
rs900906517 660 dbSNP
rs1299735152 666 dbSNP
rs543992037 673 dbSNP
rs1368380147 679 dbSNP
rs942326032 682 dbSNP
rs1382821269 683 dbSNP
rs1295429863 684 dbSNP
rs1313756672 687 dbSNP
rs1382287573 691 dbSNP
rs1243568665 694 dbSNP
rs1311173615 695 dbSNP
rs1354329822 696 dbSNP
rs904191302 701 dbSNP
rs1258457102 705 dbSNP
rs1418074970 712 dbSNP
rs926340307 717 dbSNP
rs1483922607 718 dbSNP
rs984878252 721 dbSNP
rs1255104288 722 dbSNP
rs770599793 730 dbSNP
rs1182138345 731 dbSNP
rs1026074630 739 dbSNP
rs1382495924 740 dbSNP
rs143861697 760 dbSNP
rs369404697 761 dbSNP
rs1362537510 767 dbSNP
rs965902566 772 dbSNP
rs946942929 775 dbSNP
rs1405708345 785 dbSNP
rs760448169 787 dbSNP
rs1019192148 790 dbSNP
rs1450632725 793 dbSNP
rs914183349 797 dbSNP
rs1377296274 806 dbSNP
rs1007499754 807 dbSNP
rs556874676 810 dbSNP
rs1313859713 813 dbSNP
rs939521189 819 dbSNP
rs1032899013 823 dbSNP
rs1000170803 830 dbSNP
rs61895956 835 dbSNP
rs928011288 841 dbSNP
rs1173856659 844 dbSNP
rs1459711464 847 dbSNP
rs903153270 847 dbSNP
rs536904984 848 dbSNP
rs995525720 851 dbSNP
rs969756870 853 dbSNP
rs898095118 855 dbSNP
rs1458526828 858 dbSNP
rs376746663 860 dbSNP
rs951287548 863 dbSNP
rs950128181 866 dbSNP
rs1176880687 867 dbSNP
rs896023332 875 dbSNP
rs1025534650 884 dbSNP
rs1173044024 894 dbSNP
rs1216888955 904 dbSNP
rs1056348793 920 dbSNP
rs997946045 921 dbSNP
rs1296227496 923 dbSNP
rs1369648256 926 dbSNP
rs937498006 933 dbSNP
rs910145383 936 dbSNP
rs1219905456 937 dbSNP
rs1258362551 938 dbSNP
rs984335419 947 dbSNP
rs868174041 949 dbSNP
rs117732409 956 dbSNP
rs1204351630 958 dbSNP
rs1231465125 960 dbSNP
rs1489759723 962 dbSNP
rs529539636 964 dbSNP
rs1200718189 967 dbSNP
rs1409603232 974 dbSNP
rs145644967 974 dbSNP
rs760615588 974 dbSNP
rs904303654 974 dbSNP
rs1254685849 976 dbSNP
rs1009927443 981 dbSNP
rs763312309 983 dbSNP
rs1313347995 984 dbSNP
rs1285779048 986 dbSNP
rs892701360 988 dbSNP
rs918918990 994 dbSNP
rs57991692 995 dbSNP
rs748042693 1000 dbSNP
rs1271349403 1005 dbSNP
rs1323836650 1007 dbSNP
rs928158543 1010 dbSNP
rs1291749439 1014 dbSNP
rs1386871398 1015 dbSNP
rs965768820 1016 dbSNP
rs376106023 1017 dbSNP
rs373251731 1022 dbSNP
rs190750990 1024 dbSNP
rs1018809239 1029 dbSNP
rs948155778 1034 dbSNP
rs986381878 1040 dbSNP
rs1184963287 1043 dbSNP
rs1465462038 1046 dbSNP
rs562290145 1048 dbSNP
rs1162683550 1049 dbSNP
rs1033345402 1060 dbSNP
rs1000033246 1067 dbSNP
rs1363714388 1073 dbSNP
rs1178533931 1077 dbSNP
rs552298827 1088 dbSNP
rs540079968 1089 dbSNP
rs1020237565 1093 dbSNP
rs571018294 1097 dbSNP
rs1428248849 1098 dbSNP
rs551300116 1099 dbSNP
rs895903412 1100 dbSNP
rs1055861549 1101 dbSNP
rs531204004 1102 dbSNP
rs888590604 1104 dbSNP
rs1200189423 1108 dbSNP
rs760400034 1109 dbSNP
rs772915467 1110 dbSNP
rs113810322 1113 dbSNP
rs187563642 1114 dbSNP
rs1239493156 1118 dbSNP
rs965713689 1126 dbSNP
rs1182762693 1132 dbSNP
rs1278993995 1134 dbSNP
rs1441486344 1135 dbSNP
rs1229850238 1139 dbSNP
rs944358772 1140 dbSNP
rs911648102 1141 dbSNP
rs1359449839 1144 dbSNP
rs1451376840 1150 dbSNP
rs1336511585 1152 dbSNP
rs371078494 1153 dbSNP
rs1395194626 1159 dbSNP
rs1242732512 1163 dbSNP
rs1280695987 1166 dbSNP
rs1350579893 1182 dbSNP
rs1406544427 1185 dbSNP
rs953341603 1186 dbSNP
rs1464050862 1188 dbSNP
rs925798275 1192 dbSNP
rs1203211990 1200 dbSNP
rs532617513 1202 dbSNP
rs1021808619 1215 dbSNP
rs1458953898 1223 dbSNP
rs978686629 1225 dbSNP
rs368474352 1226 dbSNP
rs1232289425 1229 dbSNP
rs1168032743 1230 dbSNP
rs1173824195 1231 dbSNP
rs1429309694 1233 dbSNP
rs1468997583 1238 dbSNP
rs1476121381 1243 dbSNP
rs1401997108 1249 dbSNP
rs891477543 1250 dbSNP
rs369713031 1254 dbSNP
rs1186410185 1256 dbSNP
rs1335693814 1259 dbSNP
rs1424703572 1260 dbSNP
rs200406337 1262 dbSNP
rs202223231 1263 dbSNP
rs1440578302 1266 dbSNP
rs79285879 1266 dbSNP
rs548330496 1278 dbSNP
rs1196227374 1279 dbSNP
rs1222944437 1279 dbSNP
rs398016258 1279 dbSNP
rs548313748 1279 dbSNP
rs71046721 1279 dbSNP
rs1271940509 1280 dbSNP
rs528468390 1280 dbSNP
rs1020270076 1281 dbSNP
rs1014228502 1290 dbSNP
rs1269476811 1294 dbSNP
rs1457744134 1305 dbSNP
rs1258773136 1309 dbSNP
rs1479853020 1322 dbSNP
rs1045222897 1326 dbSNP
rs1425411657 1331 dbSNP
rs960029751 1335 dbSNP
rs559635320 1346 dbSNP
rs948243845 1348 dbSNP
rs1396171920 1354 dbSNP
rs1408742542 1355 dbSNP
rs1034856603 1356 dbSNP
rs1404470910 1357 dbSNP
rs1048469996 1360 dbSNP
rs1342616262 1365 dbSNP
rs1228354073 1368 dbSNP
rs1269401202 1377 dbSNP
rs1337251841 1378 dbSNP
rs778915351 1382 dbSNP
rs929938137 1383 dbSNP
rs769723261 1388 dbSNP
rs536600217 1390 dbSNP
rs745982426 1393 dbSNP
rs1048576803 1394 dbSNP
rs976753728 1404 dbSNP
rs1191981088 1407 dbSNP
rs781177599 1408 dbSNP
rs183334344 1413 dbSNP
rs1165845057 1423 dbSNP
rs911150926 1424 dbSNP
rs985285962 1425 dbSNP
rs1301387097 1439 dbSNP
rs1387168030 1439 dbSNP
rs968971746 1445 dbSNP
rs897425835 1448 dbSNP
rs1021352354 1453 dbSNP
rs757468774 1455 dbSNP
rs988565543 1460 dbSNP
rs955814841 1463 dbSNP
rs1376133670 1465 dbSNP
rs1243620846 1476 dbSNP
rs1287585986 1476 dbSNP
rs1035347592 1485 dbSNP
rs751844253 1487 dbSNP
rs1259299311 1488 dbSNP
rs1443779840 1514 dbSNP
rs192010006 1515 dbSNP
rs563095243 1516 dbSNP
rs1424982696 1523 dbSNP
rs911525658 1524 dbSNP
rs1050633918 1527 dbSNP
rs906768384 1528 dbSNP
rs1366035035 1530 dbSNP
rs1177217988 1536 dbSNP
rs931747338 1547 dbSNP
rs925812270 1548 dbSNP
rs1239273232 1558 dbSNP
rs186307806 1559 dbSNP
rs1449876328 1560 dbSNP
rs1289314019 1562 dbSNP
rs1210655462 1566 dbSNP
rs1381715203 1573 dbSNP
rs1450142421 1576 dbSNP
rs1309127117 1578 dbSNP
rs967162179 1579 dbSNP
rs1317434761 1583 dbSNP
rs913155102 1588 dbSNP
rs1258367053 1589 dbSNP
rs1325261027 1594 dbSNP
rs1293644033 1598 dbSNP
rs1244166228 1599 dbSNP
rs992725901 1599 dbSNP
rs1048582971 1601 dbSNP
rs930054060 1603 dbSNP
rs574610641 1608 dbSNP
rs3019199 1610 dbSNP
rs1158490319 1611 dbSNP
rs761635927 1614 dbSNP
rs12277311 1615 dbSNP
rs952815819 1617 dbSNP
rs376014480 1626 dbSNP
rs911110425 1630 dbSNP
rs1405599652 1634 dbSNP
rs1450260043 1641 dbSNP
rs746080678 1642 dbSNP
rs571998952 1643 dbSNP
rs1405160095 1645 dbSNP
rs1027043805 1646 dbSNP
rs914407583 1650 dbSNP
rs1419406440 1652 dbSNP
rs1409188390 1653 dbSNP
rs1223559015 1654 dbSNP
rs1160782848 1656 dbSNP
rs994354783 1656 dbSNP
rs181422524 1657 dbSNP
rs765801378 1658 dbSNP
rs1208464668 1659 dbSNP
rs1019883371 1664 dbSNP
rs1008469421 1665 dbSNP
rs1200290194 1666 dbSNP
rs768048213 1679 dbSNP
rs538691722 1684 dbSNP
rs1200222084 1687 dbSNP
rs1035463998 1688 dbSNP
rs1261219268 1690 dbSNP
rs188682584 1691 dbSNP
rs1050076288 1703 dbSNP
rs1284778305 1710 dbSNP
rs1461449830 1712 dbSNP
rs931752572 1713 dbSNP
rs904292625 1722 dbSNP
rs1042750267 1727 dbSNP
rs1274210459 1730 dbSNP
rs372789920 1731 dbSNP
rs552971031 1732 dbSNP
rs1343267917 1736 dbSNP
rs185186348 1741 dbSNP
rs34950099 1742 dbSNP
rs376137604 1742 dbSNP
rs372266417 1747 dbSNP
rs994317372 1748 dbSNP
rs537638878 1749 dbSNP
rs758916946 1750 dbSNP
rs368494376 1752 dbSNP
rs1188467903 1756 dbSNP
rs753362534 1760 dbSNP
rs952668947 1765 dbSNP
rs944021124 1771 dbSNP
rs12284002 1776 dbSNP
rs1049793461 1780 dbSNP
rs776877921 1780 dbSNP
rs1363118530 1782 dbSNP
rs180955275 1782 dbSNP
rs1289135672 1788 dbSNP
rs914521373 1789 dbSNP
rs1295777379 1793 dbSNP
rs1341847294 1793 dbSNP
rs1362241655 1793 dbSNP
rs112950993 1795 dbSNP
rs1193210673 1801 dbSNP
rs1291174361 1803 dbSNP
rs1019790878 1807 dbSNP
rs1449980574 1809 dbSNP
rs1218012898 1811 dbSNP
rs1242980330 1815 dbSNP
rs1486337766 1827 dbSNP
rs1242461770 1833 dbSNP
rs559657267 1836 dbSNP
rs1186458982 1837 dbSNP
rs890029910 1840 dbSNP
rs1445195726 1848 dbSNP
rs934499805 1850 dbSNP
rs771927101 1852 dbSNP
rs761732395 1869 dbSNP
rs995860269 1870 dbSNP
rs1159195202 1871 dbSNP
rs928340958 1872 dbSNP
rs1428149812 1883 dbSNP
rs904164697 1892 dbSNP
rs1385389683 1897 dbSNP
rs1453798154 1898 dbSNP
rs1315027498 1903 dbSNP
rs774107713 1913 dbSNP
rs552255378 1914 dbSNP
rs969870926 1920 dbSNP
rs915553689 1926 dbSNP
rs1316576880 1935 dbSNP
rs984502195 1938 dbSNP
rs1461639747 1940 dbSNP
rs952945405 1940 dbSNP
rs945797086 1941 dbSNP
rs891656466 1952 dbSNP
rs1275835113 1961 dbSNP
rs535904162 1969 dbSNP
rs1471084412 1973 dbSNP
rs1056955346 1976 dbSNP
rs1027209052 1982 dbSNP
rs938486283 1984 dbSNP
rs532441324 1989 dbSNP
rs138237749 1991 dbSNP
rs1271591237 1994 dbSNP
rs961531454 2006 dbSNP
rs1019657662 2008 dbSNP
rs1008728424 2014 dbSNP
rs1446223114 2015 dbSNP
rs1280240716 2025 dbSNP
rs980386354 2026 dbSNP
rs543246758 2038 dbSNP
rs543622037 2042 dbSNP
rs1398161169 2047 dbSNP
rs199958886 2051 dbSNP
rs372515459 2051 dbSNP
rs893036171 2058 dbSNP
rs368186126 2061 dbSNP
rs1182391733 2066 dbSNP
rs541281065 2067 dbSNP
rs1429219858 2069 dbSNP
rs1053038384 2073 dbSNP
rs771054580 2074 dbSNP
rs934441229 2078 dbSNP
rs1429640151 2081 dbSNP
rs865871963 2083 dbSNP
rs1180345924 2089 dbSNP
rs906609753 2090 dbSNP
rs986999015 2101 dbSNP
rs1045603448 2102 dbSNP
rs1411968438 2102 dbSNP
rs1370467437 2103 dbSNP
rs1471657328 2117 dbSNP
rs747174379 2118 dbSNP
rs1285192115 2120 dbSNP
rs1242363204 2121 dbSNP
rs1204219018 2130 dbSNP
rs147477849 2133 dbSNP
rs915684119 2145 dbSNP
rs954330362 2153 dbSNP
rs1196138770 2168 dbSNP
rs984837342 2172 dbSNP
rs1482030170 2173 dbSNP
rs1224077884 2190 dbSNP
rs1268917737 2194 dbSNP
rs777973339 2195 dbSNP
rs1196352871 2202 dbSNP
rs1307603545 2206 dbSNP
rs1476625335 2218 dbSNP
rs1274606146 2219 dbSNP
rs1226315610 2222 dbSNP
rs1378894297 2224 dbSNP
rs1428321032 2229 dbSNP
rs951726338 2232 dbSNP
rs1028583788 2235 dbSNP
rs1001065655 2239 dbSNP
rs1366230615 2240 dbSNP
rs968395723 2241 dbSNP
rs1021227375 2242 dbSNP
rs1009972167 2244 dbSNP
rs1227971677 2247 dbSNP
rs1462497785 2249 dbSNP
rs1356371577 2257 dbSNP
rs891561709 2261 dbSNP
rs1248029421 2266 dbSNP
rs1162935708 2267 dbSNP
rs1207535124 2272 dbSNP
rs1405062205 2274 dbSNP
rs1384349574 2288 dbSNP
rs1263490807 2298 dbSNP
rs558559971 2299 dbSNP
rs972962960 2300 dbSNP
rs1057262542 2305 dbSNP
rs10466667 2306 dbSNP
rs905657973 2311 dbSNP
rs1166064184 2312 dbSNP
rs1386386007 2325 dbSNP
rs1457522302 2332 dbSNP
rs1020195467 2335 dbSNP
rs1387421883 2338 dbSNP
rs1382935440 2339 dbSNP
rs1044351833 2344 dbSNP
rs1446249466 2345 dbSNP
rs567532283 2350 dbSNP
rs1362815188 2351 dbSNP
rs1008426887 2352 dbSNP
rs1315711940 2353 dbSNP
rs1028426721 2359 dbSNP
rs1011556306 2362 dbSNP
rs1234180089 2366 dbSNP
rs1350977562 2368 dbSNP
rs893150628 2370 dbSNP
rs1218884625 2374 dbSNP
rs1053148547 2378 dbSNP
rs1292078955 2384 dbSNP
rs931213685 2392 dbSNP
rs1166623605 2394 dbSNP
rs919948460 2395 dbSNP
rs998762678 2403 dbSNP
rs576241381 2405 dbSNP
rs1185529396 2407 dbSNP
rs115306225 2411 dbSNP
rs1306847960 2422 dbSNP
rs912665414 2423 dbSNP
rs557023071 2425 dbSNP
rs987256248 2426 dbSNP
rs1378363604 2433 dbSNP
rs537296115 2434 dbSNP
rs954272548 2435 dbSNP
rs1436001793 2440 dbSNP
rs1366377149 2447 dbSNP
rs1165740064 2451 dbSNP
rs1426245203 2462 dbSNP
rs921429787 2463 dbSNP
rs1227225474 2482 dbSNP
rs979677389 2493 dbSNP
rs565051536 2495 dbSNP
rs1325238862 2509 dbSNP
rs1205972347 2515 dbSNP
rs1256898969 2520 dbSNP
rs1158281916 2527 dbSNP
rs1199283066 2534 dbSNP
rs1253257176 2539 dbSNP
rs1419638917 2540 dbSNP
rs1181541473 2541 dbSNP
rs755508400 2546 dbSNP
rs568626968 2547 dbSNP
rs1021135761 2553 dbSNP
rs1176911304 2554 dbSNP
rs1358322622 2558 dbSNP
rs1464331272 2560 dbSNP
rs1299870662 2564 dbSNP
rs1420825136 2566 dbSNP
rs1397114646 2567 dbSNP
rs1188896581 2576 dbSNP
rs1285833895 2582 dbSNP
rs1490051709 2583 dbSNP
rs554971273 2586 dbSNP
rs142817144 2590 dbSNP
rs765860155 2600 dbSNP
rs1260577743 2601 dbSNP
rs1035452084 2602 dbSNP
rs1312026904 2606 dbSNP
rs565756408 2620 dbSNP
rs1253665458 2623 dbSNP
rs1483627448 2630 dbSNP
rs537245172 2630 dbSNP
rs1240354611 2633 dbSNP
rs1249647108 2638 dbSNP
rs1003025560 2646 dbSNP
rs755692707 2650 dbSNP
rs1200471686 2654 dbSNP
rs750058094 2656 dbSNP
rs995452285 2657 dbSNP
rs898427915 2660 dbSNP
rs971740222 2661 dbSNP
rs940266895 2669 dbSNP
rs1036924861 2676 dbSNP
rs1305666910 2680 dbSNP
rs1366852334 2681 dbSNP
rs1405004397 2682 dbSNP
rs552118342 2687 dbSNP
rs1292642777 2688 dbSNP
rs1365046052 2689 dbSNP
rs748864646 2690 dbSNP
rs891114359 2695 dbSNP
rs1288119335 2697 dbSNP
rs1343524211 2697 dbSNP
rs1051230055 2707 dbSNP
rs1273073227 2714 dbSNP
rs545262545 2714 dbSNP
rs571060202 2720 dbSNP
rs987350958 2721 dbSNP
rs921472418 2724 dbSNP
rs569842206 2726 dbSNP
rs946865005 2731 dbSNP
rs990230264 2735 dbSNP
rs1386997668 2738 dbSNP
rs1424819796 2739 dbSNP
rs1163380646 2740 dbSNP
rs1347767021 2745 dbSNP
rs914159670 2746 dbSNP
rs1429444403 2748 dbSNP
rs1291028420 2751 dbSNP
rs550239961 2760 dbSNP
rs1476660326 2766 dbSNP
rs988320598 2778 dbSNP
rs1031664381 2782 dbSNP
rs1261446653 2783 dbSNP
rs998878854 2786 dbSNP
rs1385618713 2789 dbSNP
rs955764486 2792 dbSNP
rs1035759591 2793 dbSNP
rs190310008 2794 dbSNP
rs1024237369 2797 dbSNP
rs1254704458 2812 dbSNP
rs970196747 2817 dbSNP
rs1022692028 2818 dbSNP
rs561091314 2823 dbSNP
rs995357387 2824 dbSNP
rs894310712 2825 dbSNP
rs1410935653 2826 dbSNP
rs1217004653 2832 dbSNP
rs1326023694 2843 dbSNP
rs1401904532 2846 dbSNP
rs1296596741 2847 dbSNP
rs1382507465 2848 dbSNP
rs1457110451 2861 dbSNP
rs1386882061 2864 dbSNP
rs1408958606 2864 dbSNP
rs1334587323 2866 dbSNP
rs1469291547 2867 dbSNP
rs1045213924 2868 dbSNP
rs755440727 2869 dbSNP
rs1178031122 2874 dbSNP
rs1048922754 2886 dbSNP
rs111594039 2886 dbSNP
rs1188005822 2886 dbSNP
rs1377122561 2886 dbSNP
rs533030983 2886 dbSNP
rs1410782206 2887 dbSNP
rs1471374841 2888 dbSNP
rs1157431662 2904 dbSNP
rs540990983 2920 dbSNP
rs1404752492 2927 dbSNP
rs1415372327 2929 dbSNP
rs1476569231 2934 dbSNP
rs930389566 2936 dbSNP
rs774164547 2953 dbSNP
rs897610034 2954 dbSNP
rs948518232 2955 dbSNP
rs1350124097 2959 dbSNP
rs1226751352 2962 dbSNP
rs1035971172 2969 dbSNP
rs1345509673 2978 dbSNP
rs1218416616 2981 dbSNP
rs1193463548 2982 dbSNP
rs898292076 2983 dbSNP
rs1015555057 2985 dbSNP
rs912778657 2990 dbSNP
rs1254584987 2993 dbSNP
rs1481887505 3004 dbSNP
rs1201188563 3016 dbSNP
rs763860474 3018 dbSNP
rs987080120 3022 dbSNP
rs1478598292 3028 dbSNP
rs1172289689 3034 dbSNP
rs185833993 3034 dbSNP
rs1462194148 3052 dbSNP
rs1432114804 3059 dbSNP
rs891151398 3061 dbSNP
rs1370070400 3070 dbSNP
rs1051523002 3075 dbSNP
rs369480970 3079 dbSNP
rs374670323 3084 dbSNP
rs551181019 3098 dbSNP
rs1474797659 3104 dbSNP
rs1435508208 3110 dbSNP
rs899936883 3112 dbSNP
rs1043753994 3119 dbSNP
rs1341420294 3120 dbSNP
rs1229004445 3128 dbSNP
rs957422548 3132 dbSNP
rs565163989 3137 dbSNP
rs914063357 3145 dbSNP
rs1229957865 3147 dbSNP
rs988390053 3152 dbSNP
rs572956599 3155 dbSNP
rs1198623962 3167 dbSNP
rs1312704852 3174 dbSNP
rs1245304959 3181 dbSNP
rs1451679419 3186 dbSNP
rs1169832080 3188 dbSNP
rs1451801063 3189 dbSNP
rs939577529 3194 dbSNP
rs1427984751 3199 dbSNP
rs372073739 3200 dbSNP
rs977388206 3207 dbSNP
rs971428212 3213 dbSNP
rs1321377183 3220 dbSNP
rs1338658868 3221 dbSNP
rs928348057 3228 dbSNP
rs368568058 3233 dbSNP
rs1296861300 3242 dbSNP
rs1395162366 3247 dbSNP
rs1362859337 3252 dbSNP
rs969726786 3257 dbSNP
rs1012832429 3259 dbSNP
rs1265464573 3262 dbSNP
rs894419075 3273 dbSNP
rs1463237700 3276 dbSNP
rs1027433769 3278 dbSNP
rs556331004 3285 dbSNP
rs1189604731 3286 dbSNP
rs1247957394 3308 dbSNP
rs542664476 3329 dbSNP
rs1022722841 3330 dbSNP
rs1036084517 3334 dbSNP
rs1369094317 3335 dbSNP
rs770928092 3340 dbSNP
rs1488560807 3351 dbSNP
rs973783903 3352 dbSNP
rs1245433835 3355 dbSNP
rs574935219 3364 dbSNP
rs1391091901 3371 dbSNP
rs555115517 3387 dbSNP
rs1437297505 3390 dbSNP
rs1319575675 3395 dbSNP
rs1015419395 3399 dbSNP
rs1386386815 3400 dbSNP
rs747119554 3413 dbSNP
rs773370905 3425 dbSNP
rs1251415394 3434 dbSNP
rs1004162371 3435 dbSNP
rs1313305786 3438 dbSNP
rs1339412590 3442 dbSNP
rs772256353 3462 dbSNP
rs1289900786 3470 dbSNP
rs1329340739 3497 dbSNP
rs531845953 3499 dbSNP
rs1463960368 3511 dbSNP
rs779327028 3512 dbSNP
rs1202751220 3519 dbSNP
rs1257458303 3522 dbSNP
rs1423382360 3527 dbSNP
rs1185505441 3533 dbSNP
rs1414480362 3542 dbSNP
rs1473011657 3542 dbSNP
rs1029558706 3545 dbSNP
rs1050547249 3546 dbSNP
rs997259086 3548 dbSNP
rs932905028 3561 dbSNP
rs921536526 3563 dbSNP
rs1393793802 3570 dbSNP
rs1244927462 3572 dbSNP
rs1359896939 3573 dbSNP
rs1227354649 3576 dbSNP
rs1286036739 3578 dbSNP
rs1054604617 3580 dbSNP
rs1235874311 3581 dbSNP
rs936165388 3601 dbSNP
rs924653776 3611 dbSNP
rs977533944 3614 dbSNP
rs899812206 3622 dbSNP
rs566065699 3648 dbSNP
rs1483403293 3649 dbSNP
rs1181784982 3650 dbSNP
rs1440006728 3654 dbSNP
rs1010941042 3659 dbSNP
rs1434757776 3671 dbSNP
rs1176433498 3677 dbSNP
rs1334658729 3678 dbSNP
rs1329001783 3685 dbSNP
rs1169971297 3688 dbSNP
rs1464441067 3688 dbSNP
rs892657625 3701 dbSNP
rs558802898 3703 dbSNP
rs1305863719 3704 dbSNP
rs574590755 3712 dbSNP
rs374164985 3713 dbSNP
rs75025073 3721 dbSNP
rs1369284203 3725 dbSNP
rs1388893685 3727 dbSNP
rs1053017267 3729 dbSNP
rs1363284521 3732 dbSNP
rs755314435 3735 dbSNP
rs77956739 3748 dbSNP
rs866164239 3758 dbSNP
rs1232788346 3759 dbSNP
rs1277363859 3763 dbSNP
rs1343036282 3770 dbSNP
rs1045280799 3778 dbSNP
rs1425625258 3779 dbSNP
rs749738298 3787 dbSNP
rs1027549783 3795 dbSNP
rs1191582294 3796 dbSNP
rs1157330701 3799 dbSNP
rs915578385 3813 dbSNP
rs973843088 3818 dbSNP
rs192885881 3835 dbSNP
rs1190488747 3843 dbSNP
rs1470106819 3848 dbSNP
rs1364437154 3859 dbSNP
rs1390702311 3861 dbSNP
rs1184025502 3865 dbSNP
rs1449973456 3871 dbSNP
rs1166105654 3879 dbSNP
rs962441510 3890 dbSNP
rs779785989 3891 dbSNP
rs1458058712 3892 dbSNP
rs1292546210 3894 dbSNP
rs190423179 3896 dbSNP
rs1490448701 3897 dbSNP
rs1008646056 3904 dbSNP
rs1366471679 3906 dbSNP
rs1293759349 3912 dbSNP
rs1221981638 3918 dbSNP
rs780739072 3921 dbSNP
rs1050074959 3928 dbSNP
rs1222639622 3931 dbSNP
rs996262060 3935 dbSNP
rs1280095989 3944 dbSNP
rs955197882 3945 dbSNP
rs1240478080 3948 dbSNP
rs1030002724 3951 dbSNP
rs1248577818 3956 dbSNP
rs1282986651 3957 dbSNP
rs996770124 3964 dbSNP
rs550011500 3965 dbSNP
rs964052119 3970 dbSNP
rs530182099 3974 dbSNP
rs1022232652 3976 dbSNP
rs755637589 3977 dbSNP
rs1163700735 3978 dbSNP
rs115863287 3985 dbSNP
rs1367811866 3996 dbSNP
rs1390047013 4007 dbSNP
rs1434963724 4012 dbSNP
rs892560885 4020 dbSNP
rs1052505653 4023 dbSNP
rs1316748501 4024 dbSNP
rs1004122392 4025 dbSNP
rs1228949666 4027 dbSNP
rs1312367044 4035 dbSNP
rs547605626 4040 dbSNP
rs924769428 4041 dbSNP
rs1210375482 4046 dbSNP
rs749931278 4048 dbSNP
rs1464246150 4054 dbSNP
rs1045761330 4056 dbSNP
rs201536330 4056 dbSNP
rs527462928 4071 dbSNP
rs1428756681 4072 dbSNP
rs948267399 4073 dbSNP
rs1200409197 4080 dbSNP
rs991485434 4081 dbSNP
rs958714458 4089 dbSNP
rs769600754 4095 dbSNP
rs915778170 4099 dbSNP
rs920478636 4107 dbSNP
rs867575104 4108 dbSNP
rs973297058 4109 dbSNP
rs1316914054 4114 dbSNP
rs565223245 4115 dbSNP
rs1448861527 4136 dbSNP
rs1302281773 4145 dbSNP
rs1038055493 4152 dbSNP
rs1230504021 4154 dbSNP
rs138793285 4156 dbSNP
rs954461694 4162 dbSNP
rs1221851877 4166 dbSNP
rs531345836 4175 dbSNP
rs1284795551 4182 dbSNP
rs1232294625 4191 dbSNP
rs1280654928 4191 dbSNP
rs1254721537 4193 dbSNP
rs1483733146 4208 dbSNP
rs1182515814 4209 dbSNP
rs1250596722 4214 dbSNP
rs1029173096 4220 dbSNP
rs995820800 4226 dbSNP
rs893476557 4233 dbSNP
rs908295544 4238 dbSNP
rs1173131571 4244 dbSNP
rs1206883672 4248 dbSNP
rs1373756850 4248 dbSNP
rs1411724236 4249 dbSNP
rs982521430 4250 dbSNP
rs955420088 4251 dbSNP
rs922460609 4254 dbSNP
rs975757254 4259 dbSNP
rs767176027 4260 dbSNP
rs1282130013 4267 dbSNP
rs1053486726 4269 dbSNP
rs115251370 4271 dbSNP
rs185188223 4276 dbSNP
rs956666076 4284 dbSNP
rs1031511923 4294 dbSNP
rs371273321 4296 dbSNP
rs1041872906 4302 dbSNP
rs1273477003 4305 dbSNP
rs950284557 4307 dbSNP
rs1327404826 4311 dbSNP
rs1320834500 4312 dbSNP
rs1468765213 4314 dbSNP
rs1003622541 4318 dbSNP
rs1405404518 4339 dbSNP
rs906719105 4343 dbSNP
rs1023792268 4361 dbSNP
rs146179132 4367 dbSNP
rs895874425 4369 dbSNP
rs1186159319 4371 dbSNP
rs1012392410 4372 dbSNP
rs1169236982 4373 dbSNP
rs1396069554 4373 dbSNP
rs1325737482 4378 dbSNP
rs1331519459 4379 dbSNP
rs899434450 4379 dbSNP
rs1301245411 4382 dbSNP
rs377313076 4383 dbSNP
rs530780333 4383 dbSNP
rs920593778 4384 dbSNP
rs191519533 4390 dbSNP
rs940593134 4406 dbSNP
rs1211312428 4409 dbSNP
rs541639960 4426 dbSNP
rs1452613466 4427 dbSNP
rs886771329 4429 dbSNP
rs1213381545 4433 dbSNP
rs537862895 4440 dbSNP
rs1270381157 4447 dbSNP
rs1213687100 4449 dbSNP
rs1047292157 4457 dbSNP
rs187068494 4462 dbSNP
rs922455315 4463 dbSNP
rs1391721351 4465 dbSNP
rs1460733475 4466 dbSNP
rs1323580712 4467 dbSNP
rs975227367 4469 dbSNP
rs942511745 4472 dbSNP
rs974485151 4476 dbSNP
rs1382639054 4484 dbSNP
rs1317520351 4493 dbSNP
rs957805796 4504 dbSNP
rs915161224 4512 dbSNP
rs1284425007 4517 dbSNP
rs1355134054 4521 dbSNP
rs1233080412 4529 dbSNP
rs1271616047 4530 dbSNP
rs1466504273 4531 dbSNP
rs183525184 4540 dbSNP
rs1261626482 4558 dbSNP
rs1445419976 4559 dbSNP
rs956738319 4560 dbSNP
rs1189629438 4561 dbSNP
rs1369284451 4567 dbSNP
rs903414015 4569 dbSNP
rs762657480 4570 dbSNP
rs775455641 4574 dbSNP
rs1413961794 4578 dbSNP
rs1352895425 4585 dbSNP
rs11230688 4590 dbSNP
rs982633720 4596 dbSNP
rs1288281849 4604 dbSNP
rs1020971212 4613 dbSNP
rs1397279978 4616 dbSNP
rs1169999186 4617 dbSNP
rs1354460662 4620 dbSNP
rs1542324 4625 dbSNP
rs1289807775 4626 dbSNP
rs1331729768 4633 dbSNP
rs76509527 4635 dbSNP
rs895975506 4638 dbSNP
rs1349093732 4639 dbSNP
rs1056007577 4641 dbSNP
rs937420147 4652 dbSNP
rs1442579785 4653 dbSNP
rs1242384117 4659 dbSNP
rs1184152296 4660 dbSNP
rs1254235628 4661 dbSNP
rs1472796314 4664 dbSNP
rs899278501 4673 dbSNP
rs1230744628 4674 dbSNP
rs143467298 4678 dbSNP
rs773278714 4681 dbSNP
rs1016561997 4682 dbSNP
rs1374372252 4689 dbSNP
rs1276372675 4690 dbSNP
rs1005138230 4697 dbSNP
rs987796444 4703 dbSNP
rs1244152765 4707 dbSNP
rs886800062 4708 dbSNP
rs1359191596 4709 dbSNP
rs1316333943 4710 dbSNP
rs564379151 4711 dbSNP
rs1306679926 4715 dbSNP
rs1334546409 4719 dbSNP
rs148818974 4740 dbSNP
rs1281645216 4749 dbSNP
rs1371229436 4755 dbSNP
rs1046711405 4758 dbSNP
rs200908792 4761 dbSNP
rs957756752 4769 dbSNP
rs1297729069 4770 dbSNP
rs933620602 4785 dbSNP
rs900938153 4789 dbSNP
rs1394397948 4791 dbSNP
rs1356459127 4792 dbSNP
rs1432333047 4796 dbSNP
rs567773180 4800 dbSNP
rs921636 4801 dbSNP
rs386754139 4802 dbSNP
rs546224002 4808 dbSNP
rs1384446789 4820 dbSNP
rs1461138418 4822 dbSNP
rs866934753 4825 dbSNP
rs1296065081 4831 dbSNP
rs1425529571 4836 dbSNP
rs1304811220 4843 dbSNP
rs1370828167 4850 dbSNP
rs539276871 4858 dbSNP
rs1232206184 4859 dbSNP
rs1405136874 4865 dbSNP
rs1299864279 4866 dbSNP
rs1020498702 4874 dbSNP
rs1204150076 4876 dbSNP
rs1014920186 4878 dbSNP
rs1489378666 4880 dbSNP
rs1480675460 4883 dbSNP
rs1252312922 4887 dbSNP
rs1452447394 4916 dbSNP
rs915066881 4916 dbSNP
rs757677693 4917 dbSNP
rs1167957657 4921 dbSNP
rs1369838140 4923 dbSNP
rs1490287200 4929 dbSNP
rs146702557 4930 dbSNP
rs1394433276 4934 dbSNP
rs1247594173 4939 dbSNP
rs1315599997 4944 dbSNP
rs1034468389 4945 dbSNP
rs1362818779 4946 dbSNP
rs1214058398 4952 dbSNP
rs566991620 4961 dbSNP
rs749638321 4976 dbSNP
rs1293706903 4981 dbSNP
rs547166611 4982 dbSNP
rs1306949421 4984 dbSNP
rs1272271938 4985 dbSNP
rs923825578 4994 dbSNP
rs1224346817 5012 dbSNP
rs1352425469 5014 dbSNP
rs1485300050 5015 dbSNP
rs1184194502 5019 dbSNP
rs1415532155 5024 dbSNP
rs1281602753 5026 dbSNP
rs1475306410 5029 dbSNP
rs1163718459 5031 dbSNP
rs1417656448 5032 dbSNP
rs1001675220 5048 dbSNP
rs899224781 5055 dbSNP
rs1404642717 5058 dbSNP
rs1430122272 5066 dbSNP
rs982154005 5068 dbSNP
rs1381660945 5070 dbSNP
rs921635 5079 dbSNP
rs1459270866 5084 dbSNP
rs1292885354 5088 dbSNP
rs1332488334 5090 dbSNP
rs1230001461 5096 dbSNP
rs1284881373 5098 dbSNP
rs1343291040 5099 dbSNP
rs1158306282 5105 dbSNP
rs1238740851 5106 dbSNP
rs1485698668 5113 dbSNP
rs1023735263 5115 dbSNP
rs1186851762 5117 dbSNP
rs143238014 5129 dbSNP
rs990896262 5134 dbSNP
rs1413617878 5143 dbSNP
rs1179261010 5144 dbSNP
rs778398245 5144 dbSNP
rs886436677 5153 dbSNP
rs756659125 5154 dbSNP
rs572096350 5162 dbSNP
rs1051806011 5166 dbSNP
rs1157520874 5169 dbSNP
rs1361018276 5170 dbSNP
rs1435406130 5178 dbSNP
rs1479931899 5179 dbSNP
rs1312575013 5181 dbSNP
rs140671528 5185 dbSNP
rs548998090 5191 dbSNP
rs1269178950 5192 dbSNP
rs963581275 5216 dbSNP
rs1353727828 5222 dbSNP
rs1016424904 5230 dbSNP
rs1279876010 5233 dbSNP
rs746442498 5235 dbSNP
rs1222050199 5245 dbSNP
rs146833712 5248 dbSNP
rs560241000 5249 dbSNP
rs1277765427 5250 dbSNP
rs977839257 5257 dbSNP
rs966528192 5262 dbSNP
rs917567601 5263 dbSNP
rs991868983 5264 dbSNP
rs549335712 5282 dbSNP
rs900799769 5293 dbSNP
rs1454770707 5295 dbSNP
rs1261385655 5303 dbSNP
rs1373897708 5307 dbSNP
rs747109327 5314 dbSNP
rs1411901804 5322 dbSNP
rs756729264 5326 dbSNP
rs1001621607 5328 dbSNP
rs1353764045 5341 dbSNP
rs963514021 5342 dbSNP
rs751155292 5349 dbSNP
rs1039461681 5353 dbSNP
rs1006593021 5354 dbSNP
rs1232956924 5377 dbSNP
rs572308563 5378 dbSNP
rs1053563689 5379 dbSNP
rs777318144 5391 dbSNP
rs565107364 5392 dbSNP
rs1359674646 5394 dbSNP
rs886553726 5396 dbSNP
rs1271837607 5398 dbSNP
rs1202789126 5410 dbSNP
rs1288213890 5410 dbSNP
rs758160129 5414 dbSNP
rs1454283319 5416 dbSNP
rs529317059 5423 dbSNP
rs1173563212 5424 dbSNP
rs923884411 5429 dbSNP
rs900389475 5445 dbSNP
rs1038977887 5446 dbSNP
rs1046710568 5457 dbSNP
rs576361801 5471 dbSNP
rs1429469041 5478 dbSNP
rs1327611325 5479 dbSNP
rs149824828 5480 dbSNP
rs191389310 5484 dbSNP
rs1440133287 5489 dbSNP
rs1323784839 5493 dbSNP
rs573940133 5495 dbSNP
rs1227516673 5505 dbSNP
rs936451192 5514 dbSNP
rs1336982141 5521 dbSNP
rs752782796 5526 dbSNP
rs1427098642 5529 dbSNP
rs916583693 5530 dbSNP
rs765053686 5532 dbSNP
rs554246128 5541 dbSNP
rs1042281411 5547 dbSNP
rs963446424 5551 dbSNP
rs909265151 5553 dbSNP
rs1251675190 5563 dbSNP
rs534240895 5565 dbSNP
rs950906823 5566 dbSNP
rs1030588867 5569 dbSNP
rs1241767270 5575 dbSNP
rs571491555 5576 dbSNP
rs140032144 5578 dbSNP
rs1418370737 5582 dbSNP
rs1460718359 5583 dbSNP
rs1017877111 5585 dbSNP
rs1257967512 5586 dbSNP
rs753790502 5592 dbSNP
rs893575254 5597 dbSNP
rs1316964788 5598 dbSNP
rs1324357912 5608 dbSNP
rs115809937 5610 dbSNP
rs999375241 5611 dbSNP
rs1435567504 5612 dbSNP
rs866167203 5612 dbSNP
rs1336001386 5614 dbSNP
rs1016372925 5617 dbSNP
rs902338631 5625 dbSNP
rs569162403 5631 dbSNP
rs552880205 5632 dbSNP
rs1334610710 5636 dbSNP
rs950837399 5637 dbSNP
rs1030430187 5639 dbSNP
rs1173968431 5640 dbSNP
rs113752410 5649 dbSNP
rs1460191280 5652 dbSNP
rs1474762311 5670 dbSNP
rs997892667 5682 dbSNP
rs116439910 5683 dbSNP
rs1451753356 5686 dbSNP
rs1157902216 5693 dbSNP
rs1382210704 5694 dbSNP
rs1436033996 5699 dbSNP
rs1241768754 5700 dbSNP
rs1354417609 5702 dbSNP
rs142005607 5708 dbSNP
rs188703554 5719 dbSNP
rs1310988552 5725 dbSNP
rs1337863717 5738 dbSNP
rs1461822154 5742 dbSNP
rs1279426577 5748 dbSNP
rs1351604536 5751 dbSNP
rs1055139973 5753 dbSNP
rs1213102740 5758 dbSNP
rs1281380487 5759 dbSNP
rs1485452712 5760 dbSNP
rs1208509182 5762 dbSNP
rs941984321 5764 dbSNP
rs1258399339 5767 dbSNP
rs1419395617 5768 dbSNP
rs1181010036 5769 dbSNP
rs1361993452 5771 dbSNP
rs546310668 5774 dbSNP
rs903803032 5775 dbSNP
rs1374516830 5776 dbSNP
rs1042597516 5779 dbSNP
rs1299476464 5783 dbSNP
rs983905982 5796 dbSNP
rs1480399487 5809 dbSNP
rs1252136902 5810 dbSNP
rs1306992955 5811 dbSNP
rs896188579 5812 dbSNP
rs950946571 5830 dbSNP
rs1304212134 5834 dbSNP
rs1347187572 5846 dbSNP
rs1231360034 5847 dbSNP
rs774586465 5848 dbSNP
rs1480876403 5850 dbSNP
rs1195001351 5860 dbSNP
rs1248395996 5870 dbSNP
rs926282998 5874 dbSNP
rs1469740428 5879 dbSNP
rs1344053808 5881 dbSNP
rs973737577 5883 dbSNP
rs1312819575 5885 dbSNP
rs942268143 5898 dbSNP
rs1172093753 5900 dbSNP
rs976384655 5903 dbSNP
rs1373284239 5906 dbSNP
rs964917138 5909 dbSNP
rs532828402 5912 dbSNP
rs1389202150 5916 dbSNP
rs114132023 5919 dbSNP
rs1327100724 5928 dbSNP
rs983997736 5929 dbSNP
rs950922464 5931 dbSNP
rs768739156 5936 dbSNP
rs1298077808 5937 dbSNP
rs1030793035 5939 dbSNP
rs1383849186 5941 dbSNP
rs1226476823 5942 dbSNP
rs1255954964 5947 dbSNP
rs1163470416 5953 dbSNP
rs976191240 5954 dbSNP
rs1445818825 5956 dbSNP
rs545224040 5957 dbSNP
rs957668693 5958 dbSNP
rs1032127035 5959 dbSNP
rs999682161 5966 dbSNP
rs112637956 5967 dbSNP
rs1251438777 5976 dbSNP
rs1167825682 5981 dbSNP
rs200174043 5988 dbSNP
rs865799224 5991 dbSNP
rs1009773960 5992 dbSNP
rs563234293 5999 dbSNP
rs896315682 6000 dbSNP
rs759779044 6001 dbSNP
rs895080180 6011 dbSNP
rs754141444 6012 dbSNP
rs1056732303 6018 dbSNP
rs542908372 6036 dbSNP
rs377348803 6043 dbSNP
rs1357138636 6046 dbSNP
rs1443002508 6048 dbSNP
rs1233671074 6050 dbSNP
rs1272531845 6061 dbSNP
rs1055007065 6070 dbSNP
rs942016995 6075 dbSNP
rs540901881 6083 dbSNP
rs1217359629 6084 dbSNP
rs149789231 6092 dbSNP
rs1485229921 6102 dbSNP
rs1334677190 6103 dbSNP
rs1259180403 6106 dbSNP
rs1476426759 6114 dbSNP
rs1288581035 6115 dbSNP
rs1417828704 6119 dbSNP
rs1244801614 6128 dbSNP
rs1411319695 6132 dbSNP
rs1161853072 6133 dbSNP
rs554183006 6138 dbSNP
rs1345875558 6140 dbSNP
rs1195529749 6144 dbSNP
rs1037976288 6145 dbSNP
rs1377487504 6154 dbSNP
rs1415219377 6164 dbSNP
rs1292413185 6166 dbSNP
rs543717117 6173 dbSNP
rs1302873471 6203 dbSNP
rs941043206 6206 dbSNP
rs1225410221 6214 dbSNP
rs1307545039 6218 dbSNP
rs909422430 6227 dbSNP
rs983724765 6246 dbSNP
rs1282084047 6260 dbSNP
rs1406345545 6278 dbSNP
rs1209659747 6291 dbSNP
rs929587225 6291 dbSNP
rs1047846939 6295 dbSNP
rs533670483 6307 dbSNP
rs578170005 6314 dbSNP
rs111946712 6315 dbSNP
rs943501651 6318 dbSNP
rs538086096 6321 dbSNP
rs964774861 6321 dbSNP
rs990355373 6324 dbSNP
rs1184580662 6326 dbSNP
rs979400084 6330 dbSNP
rs564642730 6334 dbSNP
rs1357223183 6342 dbSNP
rs1268479036 6347 dbSNP
rs115160217 6349 dbSNP
rs1451972155 6358 dbSNP
rs1291868044 6362 dbSNP
rs1203381003 6370 dbSNP
rs767187427 6379 dbSNP
rs1021410826 6397 dbSNP
rs1032406206 6398 dbSNP
rs1233128435 6402 dbSNP
rs555644480 6403 dbSNP
rs1009477694 6406 dbSNP
rs1207048160 6412 dbSNP
rs1234015898 6418 dbSNP
rs1343206669 6419 dbSNP
rs1282244151 6421 dbSNP
rs977900064 6422 dbSNP
rs1396988197 6430 dbSNP
rs1034841685 6441 dbSNP
rs1172213879 6442 dbSNP
rs535359664 6449 dbSNP
rs1423315775 6454 dbSNP
rs866717312 6459 dbSNP
rs1002009337 6460 dbSNP
rs1024700569 6460 dbSNP
rs61895955 6461 dbSNP
rs1444503756 6468 dbSNP
rs1327771062 6472 dbSNP
rs1371098440 6474 dbSNP
rs1038093929 6476 dbSNP
rs144201412 6476 dbSNP
rs751829229 6476 dbSNP
rs1013424915 6494 dbSNP
rs1341009213 6494 dbSNP
rs1274184652 6498 dbSNP
rs3741264 6499 dbSNP
rs1197314827 6503 dbSNP
rs886774763 6504 dbSNP
rs1469014015 6505 dbSNP
rs184197212 6507 dbSNP
rs1389446669 6508 dbSNP
rs1476532636 6514 dbSNP
rs1006139160 6521 dbSNP
rs1468328340 6522 dbSNP
rs887806922 6533 dbSNP
rs1428777078 6534 dbSNP
rs1422674478 6544 dbSNP
rs191559724 6545 dbSNP
rs1167099074 6547 dbSNP
rs923544284 6552 dbSNP
rs1404295710 6561 dbSNP
rs1320976904 6562 dbSNP
rs1327635458 6563 dbSNP
rs188467126 6564 dbSNP
rs570257613 6565 dbSNP
rs1340299635 6569 dbSNP
rs756534271 6571 dbSNP
rs372987735 6572 dbSNP
rs943532390 6573 dbSNP
rs1209727252 6575 dbSNP
rs550249925 6577 dbSNP
rs183094914 6584 dbSNP
rs190140954 6587 dbSNP
rs1194175340 6594 dbSNP
rs1262737490 6595 dbSNP
rs1189772357 6599 dbSNP
rs1418537715 6602 dbSNP
rs1472443447 6603 dbSNP
rs1161341147 6605 dbSNP
rs1386508500 6605 dbSNP
rs1248601313 6608 dbSNP
rs1400713194 6610 dbSNP
rs1209980781 6611 dbSNP
rs968156583 6620 dbSNP
rs1398587280 6623 dbSNP
rs1040426440 6626 dbSNP
rs1295538713 6626 dbSNP
rs753175665 6627 dbSNP
rs943575249 6639 dbSNP
rs774142603 6643 dbSNP
rs369975222 6667 dbSNP
rs1219512940 6669 dbSNP
rs1205778020 6678 dbSNP
rs1285639786 6687 dbSNP
rs1347541592 6696 dbSNP
rs1213235136 6704 dbSNP
rs990386694 6708 dbSNP
rs1257991548 6711 dbSNP
rs1441571656 6715 dbSNP
rs936246041 6717 dbSNP
rs1430492466 6718 dbSNP
rs1185333713 6724 dbSNP
rs1365455501 6728 dbSNP
rs1470247221 6731 dbSNP
rs1157500374 6738 dbSNP
rs878938441 6743 dbSNP
rs746521401 6762 dbSNP
rs1366506075 6766 dbSNP
rs1436228694 6767 dbSNP
rs924861829 6770 dbSNP
rs1313050937 6776 dbSNP
rs978182082 6781 dbSNP
rs1323148181 6789 dbSNP
rs529529681 6800 dbSNP
rs1332837975 6807 dbSNP
rs1338027972 6811 dbSNP
rs1405517209 6814 dbSNP
rs1177053806 6816 dbSNP
rs1416426846 6831 dbSNP
rs960632016 6834 dbSNP
rs1236786312 6837 dbSNP
rs1256738824 6838 dbSNP
rs560754008 6838 dbSNP
rs777387977 6841 dbSNP
rs572960325 6845 dbSNP
rs1177881566 6846 dbSNP
rs982797658 6846 dbSNP
rs959230937 6847 dbSNP
rs1455146053 6859 dbSNP
rs1033493460 6863 dbSNP
rs1006170272 6867 dbSNP
rs1465899213 6870 dbSNP
rs34832054 6873 dbSNP
rs1171154761 6878 dbSNP
rs757953126 6881 dbSNP
rs1190496496 6884 dbSNP
rs1399032905 6884 dbSNP
rs185820379 6886 dbSNP
rs1026206570 6892 dbSNP
rs1046711185 6893 dbSNP
rs1210362540 6900 dbSNP
rs1443739006 6913 dbSNP
rs993913502 6915 dbSNP
rs1231288425 6916 dbSNP
rs1252880375 6919 dbSNP
rs901836056 6942 dbSNP
rs1197943902 6945 dbSNP
rs1040476445 6962 dbSNP
rs1214286864 6964 dbSNP
rs1469464896 6966 dbSNP
rs1040658135 6979 dbSNP
rs1007581863 6983 dbSNP
rs778626073 7000 dbSNP
rs201110401 7007 dbSNP
rs943638892 7012 dbSNP
rs1375154838 7018 dbSNP
rs1466406125 7019 dbSNP
rs910714613 7025 dbSNP
rs1398715406 7028 dbSNP
rs1244509269 7029 dbSNP
rs1382094743 7054 dbSNP
rs758269906 7056 dbSNP
rs1294153821 7063 dbSNP
rs1366942129 7069 dbSNP
rs1385326507 7070 dbSNP
rs147488050 7074 dbSNP
rs1450330909 7077 dbSNP
rs1267421579 7085 dbSNP
rs1340972309 7113 dbSNP
rs1352908871 7115 dbSNP
rs754775128 7125 dbSNP
rs558325498 7140 dbSNP
rs1371007981 7154 dbSNP
rs913993008 7155 dbSNP
rs1222166801 7157 dbSNP
rs988129603 7163 dbSNP
rs1487184755 7181 dbSNP
rs1206531161 7186 dbSNP
rs939355358 7187 dbSNP
rs927847153 7196 dbSNP
rs1193365280 7198 dbSNP
rs1041936637 7206 dbSNP
rs1422154204 7207 dbSNP
rs1442758475 7208 dbSNP
rs1166037470 7209 dbSNP
rs1413009597 7212 dbSNP
rs1349378933 7215 dbSNP
rs1456454739 7222 dbSNP
rs980654116 7228 dbSNP
rs969311159 7233 dbSNP
rs1473496649 7236 dbSNP
rs1016710406 7237 dbSNP
rs945068357 7237 dbSNP
rs983944907 7245 dbSNP
rs1204078284 7247 dbSNP
rs1228830073 7254 dbSNP
rs1311836204 7263 dbSNP
rs917586431 7287 dbSNP
rs1240542491 7295 dbSNP
rs991930675 7296 dbSNP
rs1487738568 7298 dbSNP
rs1025830479 7308 dbSNP
rs1483585907 7316 dbSNP
rs544339250 7317 dbSNP
rs1183026319 7318 dbSNP
rs997829629 7327 dbSNP
rs778571204 7330 dbSNP
rs959097617 7334 dbSNP
rs900830649 7337 dbSNP
rs374940594 7339 dbSNP
rs1161340380 7343 dbSNP
rs1277267219 7344 dbSNP
rs926331442 7353 dbSNP
rs1419354941 7367 dbSNP
rs1296516536 7374 dbSNP
rs1377051057 7378 dbSNP
rs575418057 7384 dbSNP
rs1293293865 7388 dbSNP
rs1017985932 7393 dbSNP
rs951880282 7394 dbSNP
rs1026684542 7396 dbSNP
rs1309388385 7407 dbSNP
rs1332177058 7431 dbSNP
rs993426778 7438 dbSNP
rs555235891 7439 dbSNP
rs753739115 7457 dbSNP
rs1211237694 7458 dbSNP
rs1279182080 7463 dbSNP
rs1482581448 7472 dbSNP
rs1180999774 7480 dbSNP
rs766251639 7482 dbSNP
rs1238879518 7487 dbSNP
rs1439090420 7487 dbSNP
rs1157153791 7494 dbSNP
rs371425642 7502 dbSNP
rs1370917855 7521 dbSNP
rs573081732 7522 dbSNP
rs939491420 7536 dbSNP
rs78315492 7537 dbSNP
rs539084568 7538 dbSNP
rs1000777494 7540 dbSNP
rs903340896 7545 dbSNP
rs1406591612 7547 dbSNP
rs1305247757 7554 dbSNP
rs1042399234 7563 dbSNP
rs1405252491 7566 dbSNP
rs1180967527 7568 dbSNP
rs570071416 7570 dbSNP
rs113244338 7571 dbSNP
rs1197626562 7572 dbSNP
rs1056154134 7580 dbSNP
rs937636613 7581 dbSNP
rs550262044 7588 dbSNP
rs926362661 7590 dbSNP
rs1176831782 7595 dbSNP
rs1248710818 7599 dbSNP
rs1266531945 7605 dbSNP
rs984531347 7606 dbSNP
rs930512594 7607 dbSNP
rs1171372807 7609 dbSNP
rs919079530 7610 dbSNP
rs1267639976 7613 dbSNP
rs1324991463 7617 dbSNP
rs965185261 7617 dbSNP
rs1435327171 7618 dbSNP
rs1017933835 7619 dbSNP
rs889342457 7626 dbSNP
rs1352519997 7628 dbSNP
rs1317808456 7633 dbSNP
rs1197255038 7634 dbSNP
rs1292140000 7636 dbSNP
rs1452191080 7640 dbSNP
rs1221203785 7641 dbSNP
rs1245192020 7644 dbSNP
rs573598048 7645 dbSNP
rs536721786 7651 dbSNP
rs1194083446 7652 dbSNP
rs751562388 7656 dbSNP
rs1366724212 7664 dbSNP
rs1476813611 7664 dbSNP
rs1390834765 7667 dbSNP
rs892625847 7671