miRTarBase - #MIRT477849 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DYRK3   
Synonyms DYRK5, RED, REDK, hYAK3-2
Description dual specificity tyrosine phosphorylation regulated kinase 3
Transcript NM_001004023   
Other Transcripts NM_003582   
Expression
Putative miRNA Targets on DYRK3
3'UTR of DYRK3
(miRNA target sites are highlighted)
>DYRK3|NM_001004023|3'UTR
   1 TGGACAGAGATATGCCCAGAGATGCATATGTGTATATTTTTATGATCTTACAAACCTGCAAATGGAAAAAATGCAAGCCC
  81 ATTGGTGGATGTTTTTGTTAGAGTAGACTTTTTTTAAACAAGACAAAACATTTTTATATGATTATAAAAGAATTCTTCAA
 161 GGGCTAATTACCTAACCAGCTTGTATTGGCCATCTGGAATATGCATTAAATGACTTTTTATAGGTCAATGCAAAAAAAAA
 241 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU-GGUAA-UAC--ACGACGAu 5'
            |||: ||||| :||  ||:| :| 
Target 5' tgCAAGCCCATTGGTGGATGTTTTTg 3'
72 - 97 102.00 -12.50
2
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            | |||||   ||| :||   
Target 5' acCTAACCAGCTTGTATTGgcc 3'
170 - 191 80.00 -8.82
3
miRNA  3' guguuugguaauacacGACGau 5'
                          ||||  
Target 5' ttatgatcttacaaacCTGCaa 3'
40 - 61 80.00 -6.47
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30171553 8 COSMIC
COSN18725988 57 COSMIC
COSN30518792 102 COSMIC
COSN31536541 105 COSMIC
COSN31606295 151 COSMIC
COSN31566317 156 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781981992 1 dbSNP
rs1441047482 3 dbSNP
rs1278434200 6 dbSNP
rs1206108050 8 dbSNP
rs1353393402 10 dbSNP
rs781820020 11 dbSNP
rs551854696 12 dbSNP
rs148139981 14 dbSNP
rs782033949 19 dbSNP
rs1227188183 20 dbSNP
rs782047095 24 dbSNP
rs1355592372 25 dbSNP
rs201145019 27 dbSNP
rs781821673 29 dbSNP
rs1029374889 33 dbSNP
rs782111789 34 dbSNP
rs782780113 35 dbSNP
rs192975758 39 dbSNP
rs1402237351 40 dbSNP
rs200134906 41 dbSNP
rs782012801 42 dbSNP
rs74147411 49 dbSNP
rs201787773 62 dbSNP
rs200225267 63 dbSNP
rs969312127 68 dbSNP
rs201612172 70 dbSNP
rs202226255 74 dbSNP
rs200436281 75 dbSNP
rs201510016 80 dbSNP
rs1194302322 81 dbSNP
rs956083360 82 dbSNP
rs781966083 91 dbSNP
rs1449122259 99 dbSNP
rs1266753517 100 dbSNP
rs1208690469 102 dbSNP
rs1334911015 105 dbSNP
rs199536987 108 dbSNP
rs1226129128 109 dbSNP
rs917280001 109 dbSNP
rs1377906056 110 dbSNP
rs948707013 112 dbSNP
rs200805518 121 dbSNP
rs868910215 124 dbSNP
rs141705007 137 dbSNP
rs1324508347 144 dbSNP
rs201440619 151 dbSNP
rs782074368 156 dbSNP
rs1461951150 165 dbSNP
rs1396617656 166 dbSNP
rs199654996 187 dbSNP
rs1403711395 192 dbSNP
rs1413285924 194 dbSNP
rs200754147 201 dbSNP
rs909776730 205 dbSNP
rs201628362 208 dbSNP
rs1476573725 213 dbSNP
rs150539050 218 dbSNP
rs1036831718 220 dbSNP
rs1469256134 225 dbSNP
rs200756836 227 dbSNP
rs1218689971 229 dbSNP
rs576111587 231 dbSNP
rs1273231342 232 dbSNP
rs201457150 233 dbSNP
rs896989650 234 dbSNP
rs1339792334 239 dbSNP
rs997969869 243 dbSNP
rs185204467 247 dbSNP
rs868932514 248 dbSNP
rs1323837708 249 dbSNP
rs1434377108 250 dbSNP
rs201018041 251 dbSNP
rs1171387590 261 dbSNP
rs189793069 264 dbSNP
rs1388562213 266 dbSNP
rs1168277751 267 dbSNP
rs1455004434 280 dbSNP
rs1018289265 282 dbSNP
rs1397374079 283 dbSNP
rs868992678 287 dbSNP
rs1190022836 295 dbSNP
rs1487870669 304 dbSNP
rs1233014248 305 dbSNP
rs1206025199 309 dbSNP
rs572029974 314 dbSNP
rs1234695110 324 dbSNP
rs552152813 326 dbSNP
rs576415405 327 dbSNP
rs1218639909 328 dbSNP
rs1366976169 334 dbSNP
rs1298758288 340 dbSNP
rs1000775981 341 dbSNP
rs1031877412 344 dbSNP
rs956198908 350 dbSNP
rs1307681399 353 dbSNP
rs992900203 356 dbSNP
rs540849505 357 dbSNP
rs970049659 369 dbSNP
rs1433056518 371 dbSNP
rs1409361948 374 dbSNP
rs1178394171 393 dbSNP
rs1471338648 395 dbSNP
rs782550795 397 dbSNP
rs868913151 399 dbSNP
rs909797324 402 dbSNP
rs1486524654 405 dbSNP
rs1254082372 412 dbSNP
rs139490218 415 dbSNP
rs973054474 418 dbSNP
rs1309095674 428 dbSNP
rs1230248759 430 dbSNP
rs1348760810 434 dbSNP
rs1287958950 445 dbSNP
rs1415688109 447 dbSNP
rs1404639101 452 dbSNP
rs529410608 469 dbSNP
rs1465885440 474 dbSNP
rs1346260833 480 dbSNP
rs1161982228 482 dbSNP
rs1455162581 484 dbSNP
rs782772491 485 dbSNP
rs755523312 489 dbSNP
rs542919742 492 dbSNP
rs1475949139 494 dbSNP
rs1253645963 496 dbSNP
rs1050850009 498 dbSNP
rs11803762 508 dbSNP
rs1262397963 517 dbSNP
rs545242283 518 dbSNP
rs942370452 519 dbSNP
rs531638813 528 dbSNP
rs1233986124 532 dbSNP
rs903512697 534 dbSNP
rs1310877284 537 dbSNP
rs1395788652 538 dbSNP
rs1363146043 550 dbSNP
rs114302861 551 dbSNP
rs1433595546 552 dbSNP
rs1388561632 553 dbSNP
rs1031869636 562 dbSNP
rs1459020702 568 dbSNP
rs1366298447 582 dbSNP
rs891984602 587 dbSNP
rs1428862210 588 dbSNP
rs571744072 589 dbSNP
rs1186461703 590 dbSNP
rs79791040 596 dbSNP
rs572388031 604 dbSNP
rs782603927 609 dbSNP
rs1214349251 610 dbSNP
rs748899197 633 dbSNP
rs1244428708 650 dbSNP
rs1308428596 650 dbSNP
rs1300196180 656 dbSNP
rs1433351301 659 dbSNP
rs541194032 672 dbSNP
rs1327187654 706 dbSNP
rs1387984089 708 dbSNP
rs980512354 709 dbSNP
rs144222684 718 dbSNP
rs567478333 735 dbSNP
rs963021550 738 dbSNP
rs1292578781 744 dbSNP
rs1462128426 746 dbSNP
rs1391637637 756 dbSNP
rs181307117 758 dbSNP
rs1448669228 763 dbSNP
rs918484022 766 dbSNP
rs1200966579 769 dbSNP
rs1453401013 772 dbSNP
rs1265434986 773 dbSNP
rs1209328220 780 dbSNP
rs778891382 786 dbSNP
rs556545030 787 dbSNP
rs1277071431 795 dbSNP
rs910979536 804 dbSNP
rs1341955561 813 dbSNP
rs1304764834 819 dbSNP
rs942504731 824 dbSNP
rs1236157546 827 dbSNP
rs1328833982 831 dbSNP
rs1299911941 832 dbSNP
rs1391496643 835 dbSNP
rs1371971721 836 dbSNP
rs1305851446 842 dbSNP
rs1428836397 843 dbSNP
rs569955974 849 dbSNP
rs1174229788 854 dbSNP
rs903546287 862 dbSNP
rs1377007259 863 dbSNP
rs1198205909 867 dbSNP
rs1472973751 869 dbSNP
rs1254222367 874 dbSNP
rs369910620 879 dbSNP
rs1482931722 889 dbSNP
rs934970417 894 dbSNP
rs782681176 895 dbSNP
rs1343441335 911 dbSNP
rs185117204 912 dbSNP
rs1239108495 927 dbSNP
rs1351838049 934 dbSNP
rs782271599 935 dbSNP
rs892018663 940 dbSNP
rs1014383792 942 dbSNP
rs1024387253 950 dbSNP
rs906022623 956 dbSNP
rs187965963 958 dbSNP
rs1412579888 960 dbSNP
rs1401352553 967 dbSNP
rs747950968 970 dbSNP
rs12037236 972 dbSNP
rs530096719 973 dbSNP
rs972700872 977 dbSNP
rs1025576332 978 dbSNP
rs1180271410 978 dbSNP
rs955237983 984 dbSNP
rs986715055 986 dbSNP
rs571978735 987 dbSNP
rs1278496003 993 dbSNP
rs1209972034 995 dbSNP
rs964205955 1007 dbSNP
rs781979368 1009 dbSNP
rs534432477 1014 dbSNP
rs1227254328 1020 dbSNP
rs1335035082 1026 dbSNP
rs1285620595 1029 dbSNP
rs1445514624 1039 dbSNP
rs1339700387 1057 dbSNP
rs12080114 1058 dbSNP
rs1437262963 1059 dbSNP
rs181956276 1067 dbSNP
rs1156982500 1075 dbSNP
rs1456798220 1075 dbSNP
rs1414771012 1079 dbSNP
rs1165259243 1081 dbSNP
rs1472010581 1090 dbSNP
rs1237321957 1093 dbSNP
rs542807312 1110 dbSNP
rs1466584861 1114 dbSNP
rs1246765521 1124 dbSNP
rs913487705 1126 dbSNP
rs1321851516 1139 dbSNP
rs1291542226 1152 dbSNP
rs1226327510 1161 dbSNP
rs1355362723 1164 dbSNP
rs950342226 1166 dbSNP
rs1319863104 1168 dbSNP
rs1350604266 1179 dbSNP
rs1045949669 1180 dbSNP
rs1325753818 1191 dbSNP
rs782718700 1193 dbSNP
rs562879872 1194 dbSNP
rs1413348790 1195 dbSNP
rs782339895 1201 dbSNP
rs1451746914 1202 dbSNP
rs1388835560 1205 dbSNP
rs1002086409 1216 dbSNP
rs1488520709 1217 dbSNP
rs1248010615 1225 dbSNP
rs576308658 1231 dbSNP
rs1450616680 1235 dbSNP
rs1274937364 1242 dbSNP
rs1207007000 1248 dbSNP
rs868918144 1254 dbSNP
rs535535104 1257 dbSNP
rs1219797900 1259 dbSNP
rs1369652927 1261 dbSNP
rs1276619063 1264 dbSNP
rs1434436190 1265 dbSNP
rs994174635 1266 dbSNP
rs772960741 1270 dbSNP
rs1308921062 1275 dbSNP
rs1431984913 1289 dbSNP
rs545658843 1304 dbSNP
rs1025690850 1306 dbSNP
rs955352220 1308 dbSNP
rs1168498258 1312 dbSNP
rs1427874364 1328 dbSNP
rs1008174560 1336 dbSNP
rs1477437378 1337 dbSNP
rs1252048663 1338 dbSNP
rs1018589080 1340 dbSNP
rs1183983197 1351 dbSNP
rs1481941035 1352 dbSNP
rs1273574354 1354 dbSNP
rs1210560516 1365 dbSNP
rs781925643 1366 dbSNP
rs1276450688 1368 dbSNP
rs1217530715 1370 dbSNP
rs547608067 1375 dbSNP
rs1289217806 1391 dbSNP
rs1411973395 1394 dbSNP
rs563491128 1398 dbSNP
rs979644968 1410 dbSNP
rs925063339 1413 dbSNP
rs1348881395 1429 dbSNP
rs1297896545 1448 dbSNP
rs1361383075 1450 dbSNP
rs1174624165 1453 dbSNP
rs956417160 1469 dbSNP
rs565153712 1474 dbSNP
rs917615440 1478 dbSNP
rs1412138726 1493 dbSNP
rs949038122 1494 dbSNP
rs1183729659 1503 dbSNP
rs1471365816 1507 dbSNP
rs782801553 1513 dbSNP
rs1182177315 1516 dbSNP
rs1484142556 1518 dbSNP
rs1235638831 1520 dbSNP
rs1209418918 1521 dbSNP
rs1322904377 1525 dbSNP
rs927507534 1534 dbSNP
rs1230309612 1539 dbSNP
rs1327290955 1558 dbSNP
rs1306588776 1559 dbSNP
rs1396941575 1567 dbSNP
rs1381879688 1568 dbSNP
rs937533773 1569 dbSNP
rs1301591502 1571 dbSNP
rs1452472304 1580 dbSNP
rs1390021019 1587 dbSNP
rs1038906772 1588 dbSNP
rs782007082 1592 dbSNP
rs1455206168 1598 dbSNP
rs994288893 1600 dbSNP
rs782111751 1603 dbSNP
rs1165096481 1609 dbSNP
rs1425334867 1623 dbSNP
rs1181082913 1624 dbSNP
rs782765112 1631 dbSNP
rs527644368 1636 dbSNP
rs1249854407 1646 dbSNP
rs1210616714 1650 dbSNP
rs1463632216 1657 dbSNP
rs10551035 1659 dbSNP
rs137881094 1659 dbSNP
rs1245873652 1662 dbSNP
rs947017529 1665 dbSNP
rs1323744501 1680 dbSNP
rs186127746 1683 dbSNP
rs1245736216 1689 dbSNP
rs1047163576 1700 dbSNP
rs891153866 1727 dbSNP
rs1323192730 1738 dbSNP
rs1008205654 1743 dbSNP
rs1383705548 1756 dbSNP
rs561366517 1758 dbSNP
rs1018202216 1759 dbSNP
rs1293742428 1761 dbSNP
rs192219859 1766 dbSNP
rs529956673 1778 dbSNP
rs1162657068 1784 dbSNP
rs1032628752 1797 dbSNP
rs956530287 1799 dbSNP
rs781824245 1806 dbSNP
rs549984365 1810 dbSNP
rs1449873663 1819 dbSNP
rs372053724 1820 dbSNP
rs1045705064 1822 dbSNP
rs1391926221 1827 dbSNP
rs1186668381 1829 dbSNP
rs1447718430 1831 dbSNP
rs1261056987 1833 dbSNP
rs1210514218 1835 dbSNP
rs1489564102 1847 dbSNP
rs987875572 1848 dbSNP
rs1222182899 1854 dbSNP
rs1343370693 1860 dbSNP
rs1300446377 1861 dbSNP
rs1226919175 1862 dbSNP
rs1326375907 1862 dbSNP
rs1301277343 1864 dbSNP
rs1388043348 1866 dbSNP
rs569992816 1877 dbSNP
rs782063792 1878 dbSNP
rs1302202316 1879 dbSNP
rs183551328 1884 dbSNP
rs980811984 1888 dbSNP
rs1372241465 1899 dbSNP
rs1166495754 1902 dbSNP
rs369467795 1920 dbSNP
rs1378162135 1925 dbSNP
rs781906722 1928 dbSNP
rs1199606884 1933 dbSNP
rs1435025199 1941 dbSNP
rs927572144 1952 dbSNP
rs937631057 1972 dbSNP
rs1199059720 1987 dbSNP
rs1483581664 1999 dbSNP
rs565546671 2002 dbSNP
rs920118489 2017 dbSNP
rs930109236 2034 dbSNP
rs1339261392 2035 dbSNP
rs370819692 2036 dbSNP
rs891184889 2037 dbSNP
rs944026307 2039 dbSNP
rs1234756800 2043 dbSNP
rs1328891343 2046 dbSNP
rs1282226005 2047 dbSNP
rs1409995341 2048 dbSNP
rs1040070674 2056 dbSNP
rs775807232 2057 dbSNP
rs1305908678 2072 dbSNP
rs1409174346 2075 dbSNP
rs1402790925 2083 dbSNP
rs1174285003 2090 dbSNP
rs1467648184 2098 dbSNP
rs1427361252 2102 dbSNP
rs1175819308 2106 dbSNP
rs1473005618 2111 dbSNP
rs1254285132 2114 dbSNP
rs147342674 2115 dbSNP
rs899828426 2123 dbSNP
rs186956427 2124 dbSNP
rs1257444856 2125 dbSNP
rs1202764084 2129 dbSNP
rs1343507993 2136 dbSNP
rs1001223845 2140 dbSNP
rs574183262 2143 dbSNP
rs1261895280 2150 dbSNP
rs1228503858 2156 dbSNP
rs1330707540 2158 dbSNP
rs1286119941 2163 dbSNP
rs1340909887 2176 dbSNP
rs1336080821 2179 dbSNP
rs782534834 2194 dbSNP
rs1032246493 2196 dbSNP
rs1405273830 2199 dbSNP
rs1336121431 2215 dbSNP
rs1457857085 2215 dbSNP
rs1414438608 2218 dbSNP
rs1469944627 2221 dbSNP
rs1369352850 2223 dbSNP
rs532263030 2224 dbSNP
rs782352969 2226 dbSNP
rs1460340543 2227 dbSNP
rs1243094805 2229 dbSNP
rs1009328107 2230 dbSNP
rs540138494 2236 dbSNP
rs1024688192 2244 dbSNP
rs868985311 2245 dbSNP
rs1281688586 2247 dbSNP
rs1222913481 2252 dbSNP
rs556363169 2254 dbSNP
rs1242386320 2256 dbSNP
rs1381888623 2258 dbSNP
rs139799576 2272 dbSNP
rs1391013242 2276 dbSNP
rs1316328921 2281 dbSNP
rs1400270565 2282 dbSNP
rs980546476 2294 dbSNP
rs1033800267 2295 dbSNP
rs1165313565 2304 dbSNP
rs1443214825 2311 dbSNP
rs533762543 2315 dbSNP
rs782309565 2327 dbSNP
rs545387613 2330 dbSNP
rs974756926 2339 dbSNP
rs565526747 2340 dbSNP
rs1239806793 2341 dbSNP
rs1214467142 2343 dbSNP
rs1451785278 2352 dbSNP
rs920149966 2356 dbSNP
rs930138887 2357 dbSNP
rs1358515425 2369 dbSNP
rs1298240972 2375 dbSNP
rs1230596502 2383 dbSNP
rs1362948306 2384 dbSNP
rs564550733 2384 dbSNP
rs1430133655 2389 dbSNP
rs1331875837 2399 dbSNP
rs1325817287 2402 dbSNP
rs572397215 2404 dbSNP
rs1423122138 2405 dbSNP
rs1365405735 2409 dbSNP
rs1169635299 2420 dbSNP
rs1432099720 2424 dbSNP
rs782646412 2437 dbSNP
rs1185385192 2441 dbSNP
rs570325265 2445 dbSNP
rs944158955 2454 dbSNP
rs541407211 2456 dbSNP
rs561401418 2457 dbSNP
rs1196925326 2458 dbSNP
rs1039782169 2462 dbSNP
rs74560096 2467 dbSNP
rs1207071151 2475 dbSNP
rs556180250 2478 dbSNP
rs936662529 2480 dbSNP
rs1368477367 2493 dbSNP
rs1285412605 2495 dbSNP
rs191344115 2499 dbSNP
rs1403271332 2511 dbSNP
rs1345124444 2512 dbSNP
rs1054126531 2513 dbSNP
rs1308977774 2515 dbSNP
rs1412095547 2517 dbSNP
rs1353250654 2520 dbSNP
rs1170410830 2527 dbSNP
rs1414540027 2532 dbSNP
rs892350084 2534 dbSNP
rs1009359183 2539 dbSNP
rs1479882443 2543 dbSNP
rs1252114437 2545 dbSNP
rs1184052504 2548 dbSNP
rs1024805943 2563 dbSNP
rs374749877 2569 dbSNP
rs906371286 2570 dbSNP
rs1232225005 2571 dbSNP
rs182521121 2572 dbSNP
rs1033418646 2573 dbSNP
rs1313891545 2577 dbSNP
rs1221798400 2579 dbSNP
rs963391167 2579 dbSNP
rs994482943 2590 dbSNP
rs1289279338 2607 dbSNP
rs764274075 2611 dbSNP
rs1371715669 2618 dbSNP
rs1027246814 2619 dbSNP
rs951567695 2621 dbSNP
rs983028064 2628 dbSNP
rs1298093402 2629 dbSNP
rs1449327727 2635 dbSNP
rs1334060281 2643 dbSNP
rs1408979097 2643 dbSNP
rs1468878602 2645 dbSNP
rs782604970 2648 dbSNP
rs1412211153 2652 dbSNP
rs74147412 2655 dbSNP
rs975925732 2684 dbSNP
rs1406898217 2693 dbSNP
rs1182236355 2701 dbSNP
rs921330157 2702 dbSNP
rs1241226770 2718 dbSNP
rs782180792 2722 dbSNP
rs552187736 2723 dbSNP
rs1201832647 2724 dbSNP
rs1460963552 2729 dbSNP
rs1269002731 2730 dbSNP
rs1218282630 2734 dbSNP
rs1315366404 2737 dbSNP
rs1306656973 2741 dbSNP
rs1229271729 2751 dbSNP
rs1385587395 2755 dbSNP
rs1313604620 2758 dbSNP
rs1451272683 2764 dbSNP
rs1388800320 2769 dbSNP
rs782428341 2779 dbSNP
rs541917497 2808 dbSNP
rs1451088941 2810 dbSNP
rs1344268297 2818 dbSNP
rs1165159845 2820 dbSNP
rs1425388387 2821 dbSNP
rs373905157 2824 dbSNP
rs1182983109 2825 dbSNP
rs1444073400 2835 dbSNP
rs1053676064 2841 dbSNP
rs1206981610 2855 dbSNP
rs565959580 2860 dbSNP
rs1260410499 2863 dbSNP
rs1222732895 2877 dbSNP
rs1362123589 2878 dbSNP
rs1290196402 2879 dbSNP
rs1245804226 2885 dbSNP
rs782674241 2886 dbSNP
rs1297042452 2887 dbSNP
rs1380052818 2888 dbSNP
rs1360813416 2895 dbSNP
rs1046287461 2902 dbSNP
rs906385327 2903 dbSNP
rs1426317834 2910 dbSNP
rs1363547480 2912 dbSNP
rs1162711394 2918 dbSNP
rs1430257676 2921 dbSNP
rs1374757169 2927 dbSNP
rs1195385537 2928 dbSNP
rs534359289 2933 dbSNP
rs186796143 2937 dbSNP
rs1426855046 2943 dbSNP
rs782272821 2944 dbSNP
rs1055293850 2949 dbSNP
rs1490904621 2954 dbSNP
rs898879671 2955 dbSNP
rs567692640 2956 dbSNP
rs1267126181 2957 dbSNP
rs994912452 2959 dbSNP
rs1222251805 2966 dbSNP
rs1343435099 2972 dbSNP
rs1026023972 2973 dbSNP
rs1253649506 2973 dbSNP
rs1224577279 2977 dbSNP
rs1301523953 2978 dbSNP
rs536767826 2980 dbSNP
rs567385535 2982 dbSNP
rs1343261358 2985 dbSNP
rs1302261249 3001 dbSNP
rs1410258149 3004 dbSNP
rs1398502946 3033 dbSNP
rs1166155197 3040 dbSNP
rs1004497064 3041 dbSNP
rs1019860218 3044 dbSNP
rs1372513330 3046 dbSNP
rs1177248518 3047 dbSNP
rs965943018 3052 dbSNP
rs1267062477 3055 dbSNP
rs1199125420 3057 dbSNP
rs1438799387 3060 dbSNP
rs1253286766 3062 dbSNP
rs975573220 3066 dbSNP
rs1480600108 3067 dbSNP
rs1256005965 3070 dbSNP
rs556601977 3082 dbSNP
rs1320915018 3085 dbSNP
rs782376965 3086 dbSNP
rs958188925 3087 dbSNP
rs989517757 3091 dbSNP
rs1337367035 3095 dbSNP
rs913934404 3103 dbSNP
rs1390682712 3118 dbSNP
rs1402860020 3125 dbSNP
rs536313360 3126 dbSNP
rs1471024039 3131 dbSNP
rs782085016 3132 dbSNP
rs1427425262 3133 dbSNP
rs1176065874 3155 dbSNP
rs1046318330 3164 dbSNP
rs927872857 3167 dbSNP
rs191308300 3170 dbSNP
rs1180120580 3180 dbSNP
rs937848327 3181 dbSNP
rs1244319539 3188 dbSNP
rs1204980611 3191 dbSNP
rs1459640495 3198 dbSNP
rs1262103963 3218 dbSNP
rs782324209 3222 dbSNP
rs1352401232 3223 dbSNP
rs1277514816 3224 dbSNP
rs1238088273 3229 dbSNP
rs898989087 3244 dbSNP
rs559028743 3248 dbSNP
rs994622853 3249 dbSNP
rs1317129177 3251 dbSNP
rs1454646058 3256 dbSNP
rs1047498877 3259 dbSNP
rs1404075866 3260 dbSNP
rs1336177985 3262 dbSNP
rs572684345 3272 dbSNP
rs1387459922 3282 dbSNP
rs1157146191 3285 dbSNP
rs886128945 3289 dbSNP
rs10863766 3296 dbSNP
rs183417528 3297 dbSNP
rs1019886464 3308 dbSNP
rs1443338327 3323 dbSNP
rs1241908353 3325 dbSNP
rs1193319241 3330 dbSNP
rs7554274 3334 dbSNP
rs997505401 3337 dbSNP
rs1204294637 3338 dbSNP
rs1359976211 3341 dbSNP
rs543942697 3342 dbSNP
rs1243606505 3349 dbSNP
rs563723437 3352 dbSNP
rs1381953226 3353 dbSNP
rs1314425444 3355 dbSNP
rs1431604091 3360 dbSNP
rs1028525212 3362 dbSNP
rs1328406247 3368 dbSNP
rs532250917 3372 dbSNP
rs989548699 3378 dbSNP
rs1366517512 3388 dbSNP
rs145034917 3390 dbSNP
rs1165862514 3394 dbSNP
rs188012785 3398 dbSNP
rs1385181817 3401 dbSNP
rs1167965283 3404 dbSNP
rs966696658 3405 dbSNP
rs982041942 3409 dbSNP
rs559421108 3415 dbSNP
rs1240000978 3423 dbSNP
rs1192101191 3426 dbSNP
rs1490415633 3431 dbSNP
rs1270692257 3446 dbSNP
rs927870636 3449 dbSNP
rs781872683 3451 dbSNP
rs937980559 3452 dbSNP
rs1341628443 3454 dbSNP
rs991135575 3455 dbSNP
rs1268503334 3459 dbSNP
rs1430193798 3469 dbSNP
rs528411209 3471 dbSNP
rs80271495 3472 dbSNP
rs1403540250 3481 dbSNP
rs567729276 3484 dbSNP
rs1171810760 3500 dbSNP
rs1411145076 3503 dbSNP
rs530379559 3508 dbSNP
rs1047529707 3510 dbSNP
rs782739271 3523 dbSNP
rs1416698297 3525 dbSNP
rs1166815200 3527 dbSNP
rs1480536907 3528 dbSNP
rs193251937 3531 dbSNP
rs1196993963 3537 dbSNP
rs1490137249 3540 dbSNP
rs1233371096 3545 dbSNP
rs1206463550 3547 dbSNP
rs1436008749 3553 dbSNP
rs1270916069 3563 dbSNP
rs34895247 3568 dbSNP
rs1218115674 3572 dbSNP
rs1324510639 3575 dbSNP
rs944357619 3581 dbSNP
rs1285473720 3585 dbSNP
rs1222060069 3595 dbSNP
rs185340527 3596 dbSNP
rs781817690 3597 dbSNP
rs1353301926 3600 dbSNP
rs1327549810 3602 dbSNP
rs1469915918 3613 dbSNP
rs1407810524 3627 dbSNP
rs1173897859 3628 dbSNP
rs190090579 3635 dbSNP
rs997137737 3636 dbSNP
rs782460250 3640 dbSNP
rs559084177 3650 dbSNP
rs1198053881 3658 dbSNP
rs1461881868 3660 dbSNP
rs1265216559 3664 dbSNP
rs1201944510 3673 dbSNP
rs1311834124 3686 dbSNP
rs1308107464 3687 dbSNP
rs1225857041 3691 dbSNP
rs893997944 3693 dbSNP
rs531491479 3695 dbSNP
rs375572445 3696 dbSNP
rs192714130 3698 dbSNP
rs966724163 3699 dbSNP
rs1465193278 3700 dbSNP
rs1345439542 3713 dbSNP
rs1160990672 3715 dbSNP
rs1398775632 3718 dbSNP
rs543444261 3758 dbSNP
rs1184196223 3762 dbSNP
rs183879798 3763 dbSNP
rs1446385608 3768 dbSNP
rs1244975561 3780 dbSNP
rs1181859209 3781 dbSNP
rs1483020811 3794 dbSNP
rs765854998 3802 dbSNP
rs1261587869 3807 dbSNP
rs1218354473 3809 dbSNP
rs1315576220 3821 dbSNP
rs555261228 3833 dbSNP
rs1247263031 3835 dbSNP
rs1385657318 3836 dbSNP
rs1312215764 3844 dbSNP
rs1394990633 3852 dbSNP
rs1362183500 3855 dbSNP
rs561720762 3870 dbSNP
rs1428366573 3875 dbSNP
rs1359595526 3878 dbSNP
rs1163987953 3881 dbSNP
rs1426430751 3894 dbSNP
rs1035060251 3899 dbSNP
rs1161724943 3899 dbSNP
rs1423366764 3916 dbSNP
rs1262695782 3919 dbSNP
rs1188568234 3927 dbSNP
rs959623108 3940 dbSNP
rs753365298 3950 dbSNP
rs574885904 3953 dbSNP
rs782679891 3957 dbSNP
rs1223712346 3960 dbSNP
rs930475811 3965 dbSNP
rs1362188746 3970 dbSNP
rs781891566 3972 dbSNP
rs983244268 3973 dbSNP
rs1290267061 3974 dbSNP
rs907706608 3980 dbSNP
rs1307630130 3985 dbSNP
rs944474564 3993 dbSNP
rs1212369566 3997 dbSNP
rs188220557 4002 dbSNP
rs572217997 4004 dbSNP
rs921642252 4005 dbSNP
rs557212745 4008 dbSNP
rs1363608684 4015 dbSNP
rs1292941978 4016 dbSNP
rs1050025450 4017 dbSNP
rs1373662841 4020 dbSNP
rs1172659083 4029 dbSNP
rs1476934774 4037 dbSNP
rs1423239199 4050 dbSNP
rs894029215 4052 dbSNP
rs1490962025 4059 dbSNP
rs1267363426 4065 dbSNP
rs782640622 4079 dbSNP
rs1481247959 4080 dbSNP
rs1252515928 4081 dbSNP
rs1224642670 4087 dbSNP
rs1316899222 4088 dbSNP
rs1011030808 4089 dbSNP
rs577250680 4096 dbSNP
rs545955714 4097 dbSNP
rs1343475598 4117 dbSNP
rs1300349894 4118 dbSNP
rs902680653 4121 dbSNP
rs1398571967 4140 dbSNP
rs1299940533 4142 dbSNP
rs1399829305 4155 dbSNP
rs1481548476 4157 dbSNP
rs149083059 4157 dbSNP
rs1376214234 4163 dbSNP
rs1198637317 4172 dbSNP
rs142144188 4176 dbSNP
rs1193539312 4181 dbSNP
rs782347909 4186 dbSNP
rs1456986344 4187 dbSNP
rs1263363870 4194 dbSNP
rs782597395 4200 dbSNP
rs1320982351 4201 dbSNP
rs1035495538 4206 dbSNP
rs1255143851 4210 dbSNP
rs959419178 4215 dbSNP
rs1337428123 4216 dbSNP
rs1012632171 4217 dbSNP
rs1444638427 4220 dbSNP
rs1376177401 4229 dbSNP
rs1337475258 4241 dbSNP
rs1471055211 4246 dbSNP
rs541728242 4250 dbSNP
rs547536454 4253 dbSNP
rs561646012 4257 dbSNP
rs1366056513 4262 dbSNP
rs1177382122 4265 dbSNP
rs983361134 4267 dbSNP
rs1243153674 4280 dbSNP
rs1184937633 4283 dbSNP
rs1440312931 4287 dbSNP
rs907739190 4292 dbSNP
rs1277520001 4297 dbSNP
rs965851948 4299 dbSNP
rs151069398 4301 dbSNP
rs1258752040 4306 dbSNP
rs1239252713 4309 dbSNP
rs1360111621 4313 dbSNP
rs1315762990 4315 dbSNP
rs114411812 4317 dbSNP
rs570483736 4319 dbSNP
rs879991289 4324 dbSNP
rs914234421 4325 dbSNP
rs947002363 4332 dbSNP
rs1387528146 4334 dbSNP
rs533068045 4339 dbSNP
rs1419589277 4340 dbSNP
rs116585757 4343 dbSNP
rs566271309 4344 dbSNP
rs1471560919 4347 dbSNP
rs1236518038 4355 dbSNP
rs1193380088 4382 dbSNP
rs1448371522 4385 dbSNP
rs35538933 4387 dbSNP
rs541427654 4388 dbSNP
rs117370340 4389 dbSNP
rs1215656235 4390 dbSNP
rs1490486951 4391 dbSNP
rs895186928 4402 dbSNP
rs1012330025 4408 dbSNP
rs1027691217 4410 dbSNP
rs1354406788 4413 dbSNP
rs548943686 4415 dbSNP
rs952013437 4422 dbSNP
rs1283691845 4431 dbSNP
rs1004827708 4434 dbSNP
rs1228346348 4437 dbSNP
rs1014827258 4445 dbSNP
rs1296689765 4450 dbSNP
rs1399820705 4463 dbSNP
rs1366723295 4470 dbSNP
rs1305548223 4477 dbSNP
rs782430116 4498 dbSNP
rs1404110196 4500 dbSNP
rs965920341 4501 dbSNP
rs1168024345 4506 dbSNP
rs1476161408 4512 dbSNP
rs1421086700 4513 dbSNP
rs568758325 4525 dbSNP
rs1490471871 4528 dbSNP
rs1270945038 4531 dbSNP
rs1219215539 4538 dbSNP
rs1450971081 4542 dbSNP
rs537474375 4546 dbSNP
rs921706698 4550 dbSNP
rs1196481577 4552 dbSNP
rs557300927 4554 dbSNP
rs953286931 4555 dbSNP
rs1346477941 4561 dbSNP
rs1285587469 4570 dbSNP
rs1434889272 4577 dbSNP
rs180970939 4579 dbSNP
rs371047821 4581 dbSNP
rs1328920798 4587 dbSNP
rs1411194712 4591 dbSNP
rs1397669651 4593 dbSNP
rs1169595562 4599 dbSNP
rs1480567962 4606 dbSNP
rs989906020 4607 dbSNP
rs1189286277 4611 dbSNP
rs782014618 4612 dbSNP
rs782132959 4625 dbSNP
rs1477631294 4629 dbSNP
rs1233440293 4638 dbSNP
rs1182608405 4646 dbSNP
rs1459187852 4650 dbSNP
rs1256247668 4651 dbSNP
rs1198169210 4653 dbSNP
rs1324572300 4691 dbSNP
rs782368363 4706 dbSNP
rs914265678 4714 dbSNP
rs539933747 4717 dbSNP
rs781959088 4720 dbSNP
rs1280712007 4734 dbSNP
rs1373940905 4735 dbSNP
rs1448338507 4735 dbSNP
rs1330101150 4738 dbSNP
rs183547928 4740 dbSNP
rs1407876558 4744 dbSNP
rs1173673299 4745 dbSNP
rs939543622 4748 dbSNP
rs1408605498 4749 dbSNP
rs1178816808 4751 dbSNP
rs782701649 4752 dbSNP
rs1057074739 4756 dbSNP
rs1178124777 4765 dbSNP
rs1461924149 4770 dbSNP
rs1239471776 4772 dbSNP
rs1208456467 4795 dbSNP
rs1312039134 4796 dbSNP
rs895308919 4809 dbSNP
rs1352194699 4810 dbSNP
rs948166209 4815 dbSNP
rs1049157696 4833 dbSNP
rs572748667 4851 dbSNP
rs1380853060 4856 dbSNP
rs868953507 4862 dbSNP
rs747966971 4868 dbSNP
rs1300772175 4885 dbSNP
rs190567070 4888 dbSNP
rs12076938 4890 dbSNP
rs1014859938 4893 dbSNP
rs1417729382 4900 dbSNP
rs182357368 4913 dbSNP
rs901721751 4928 dbSNP
rs186792074 4929 dbSNP
rs777794343 4939 dbSNP
rs1029274688 4945 dbSNP
rs564123932 4949 dbSNP
rs1483051702 4961 dbSNP
rs1219280693 4980 dbSNP
rs1243018142 4980 dbSNP
rs1487583571 4983 dbSNP
rs56082269 4985 dbSNP
rs1227343091 4988 dbSNP
rs1322936388 4988 dbSNP
rs532751606 4988 dbSNP
rs782755982 4988 dbSNP
rs1362250859 4989 dbSNP
rs1021305650 4992 dbSNP
rs1299784443 4993 dbSNP
rs967029703 4995 dbSNP
rs1397955288 5007 dbSNP
rs782148343 5008 dbSNP
rs1359818575 5018 dbSNP
rs1303748275 5023 dbSNP
rs546677975 5024 dbSNP
rs1351624472 5029 dbSNP
rs1162809776 5032 dbSNP
rs1423417565 5034 dbSNP
rs1420558785 5042 dbSNP
rs1196263277 5043 dbSNP
rs191629584 5044 dbSNP
rs1477086958 5054 dbSNP
rs1262931295 5056 dbSNP
rs1223783506 5062 dbSNP
rs1489770968 5063 dbSNP
rs1263110531 5065 dbSNP
rs1220249852 5071 dbSNP
rs528734636 5077 dbSNP
rs1279771681 5081 dbSNP
rs1216554071 5082 dbSNP
rs1339536201 5085 dbSNP
rs1283690285 5091 dbSNP
rs1388407439 5111 dbSNP
rs1388522752 5127 dbSNP
rs924219377 5143 dbSNP
rs1457507951 5146 dbSNP
rs1401302598 5154 dbSNP
rs374442958 5163 dbSNP
rs1173013085 5179 dbSNP
rs1464263434 5180 dbSNP
rs1423305002 5183 dbSNP
rs1200049762 5185 dbSNP
rs548782293 5186 dbSNP
rs1265928811 5189 dbSNP
rs568797016 5192 dbSNP
rs1480706516 5193 dbSNP
rs746875175 5196 dbSNP
rs992409691 5200 dbSNP
rs1196293992 5206 dbSNP
rs1316957224 5207 dbSNP
rs1263477261 5212 dbSNP
rs537758540 5213 dbSNP
rs1329248509 5214 dbSNP
rs1300591611 5225 dbSNP
rs948224231 5226 dbSNP
rs1377650456 5235 dbSNP
rs1049188510 5238 dbSNP
rs1444770412 5242 dbSNP
rs550954931 5253 dbSNP
rs570830520 5257 dbSNP
rs1173492261 5260 dbSNP
rs1467960869 5267 dbSNP
rs782800001 5282 dbSNP
rs1376415401 5283 dbSNP
rs1175907254 5287 dbSNP
rs1440850995 5293 dbSNP
rs1036405678 5300 dbSNP
rs547692211 5311 dbSNP
rs1239416801 5318 dbSNP
rs1176273133 5320 dbSNP
rs1457014676 5332 dbSNP
rs141280810 5333 dbSNP
rs543505750 5346 dbSNP
rs1342687866 5348 dbSNP
rs1255212129 5350 dbSNP
rs553472337 5356 dbSNP
rs1239623970 5360 dbSNP
rs1028889907 5361 dbSNP
rs1311518271 5367 dbSNP
rs181338247 5368 dbSNP
rs1011335170 5383 dbSNP
rs1376425068 5393 dbSNP
rs374459609 5394 dbSNP
rs532725748 5397 dbSNP
rs967061070 5400 dbSNP
rs1302656768 5407 dbSNP
rs782443146 5410 dbSNP
rs1382741330 5411 dbSNP
rs146780668 5420 dbSNP
rs1035793683 5424 dbSNP
rs1368677491 5436 dbSNP
rs1189106974 5437 dbSNP
rs959716359 5449 dbSNP
rs116372008 5451 dbSNP
rs1217124099 5456 dbSNP
rs1489219212 5462 dbSNP
rs1283870878 5463 dbSNP
rs916810956 5486 dbSNP
rs1352996054 5499 dbSNP
rs1284868828 5502 dbSNP
rs969554897 5504 dbSNP
rs1338955738 5512 dbSNP
rs1312414438 5519 dbSNP
rs768924455 5520 dbSNP
rs1401041177 5525 dbSNP
rs575060812 5526 dbSNP
rs1362987388 5527 dbSNP
rs984919839 5528 dbSNP
rs1419626745 5530 dbSNP
rs909379648 5554 dbSNP
rs1164529810 5555 dbSNP
rs544503268 5564 dbSNP
rs774498441 5567 dbSNP
rs940786402 5570 dbSNP
rs1194101466 5571 dbSNP
rs1478720184 5572 dbSNP
rs1260772646 5574 dbSNP
rs1215734133 5581 dbSNP
rs564177926 5587 dbSNP
rs577613144 5588 dbSNP
rs782670813 5592 dbSNP
rs1211752324 5594 dbSNP
rs570288786 5604 dbSNP
rs1292968560 5608 dbSNP
rs933310709 5621 dbSNP
rs140748618 5628 dbSNP
rs1276708488 5631 dbSNP
rs546209991 5633 dbSNP
rs1332221370 5637 dbSNP
rs1324933984 5642 dbSNP
rs560019200 5648 dbSNP
rs889003890 5658 dbSNP
rs1389563383 5659 dbSNP
rs782271803 5660 dbSNP
rs1011367358 5678 dbSNP
rs1170866201 5696 dbSNP
rs782512376 5702 dbSNP
rs903011299 5717 dbSNP
rs998586489 5720 dbSNP
rs1035422763 5724 dbSNP
rs1248430724 5735 dbSNP
rs560321199 5736 dbSNP
rs185559721 5739 dbSNP
rs1450005651 5749 dbSNP
rs1272627364 5750 dbSNP
rs549070300 5753 dbSNP
rs562278682 5754 dbSNP
rs1320315850 5755 dbSNP
rs1256530242 5764 dbSNP
rs1012552590 5775 dbSNP
rs1346315043 5780 dbSNP
rs1277187706 5792 dbSNP
rs1434954511 5793 dbSNP
rs537717542 5812 dbSNP
rs1331468337 5819 dbSNP
rs1397723005 5822 dbSNP
rs969670592 5822 dbSNP
rs1169665217 5824 dbSNP
rs556215002 5827 dbSNP
rs1427172246 5828 dbSNP
rs15972 5832 dbSNP
rs1252395170 5833 dbSNP
rs1179385865 5835 dbSNP
rs1459244212 5839 dbSNP
rs1236644403 5846 dbSNP
rs909407301 5848 dbSNP
rs962183722 5849 dbSNP
rs13208 5853 dbSNP
rs1281186322 5857 dbSNP
rs1217928733 5858 dbSNP
rs535552224 5860 dbSNP
rs1309314267 5861 dbSNP
rs1241746797 5862 dbSNP
rs571049790 5882 dbSNP
rs1448304011 5885 dbSNP
rs1360620698 5894 dbSNP
rs190168136 5899 dbSNP
rs546657028 5907 dbSNP
rs138306174 5912 dbSNP
rs374492394 5914 dbSNP
rs910550162 5923 dbSNP
rs1380899140 5935 dbSNP
rs947334591 5940 dbSNP
rs61652458 5943 dbSNP
rs1159317929 5947 dbSNP
rs1441699171 5957 dbSNP
rs1176777432 5959 dbSNP
rs1378555860 5959 dbSNP
rs535567488 5961 dbSNP
rs1483714497 5962 dbSNP
rs1208514479 5963 dbSNP
rs1239539744 5963 dbSNP
rs1485618439 5965 dbSNP
rs1287432995 5982 dbSNP
rs1218157209 5985 dbSNP
rs1350775438 5991 dbSNP
rs372058963 5995 dbSNP
rs903043793 5999 dbSNP
rs1305687268 6002 dbSNP
rs1228485211 6017 dbSNP
rs1282192753 6018 dbSNP
rs998617793 6022 dbSNP
rs1299891173 6028 dbSNP
rs1417803189 6030 dbSNP
rs1358651368 6053 dbSNP
rs1057293982 6054 dbSNP
rs35746528 6056 dbSNP
rs1158515071 6064 dbSNP
rs1424583617 6066 dbSNP
rs1416290432 6077 dbSNP
rs555401017 6078 dbSNP
rs1180466568 6082 dbSNP
rs1475122765 6083 dbSNP
rs568714633 6084 dbSNP
rs1013075784 6092 dbSNP
rs1487604702 6093 dbSNP
rs1259584979 6101 dbSNP
rs1221730224 6110 dbSNP
rs1323136076 6111 dbSNP
rs1287381069 6120 dbSNP
rs1232309857 6139 dbSNP
rs1340836861 6141 dbSNP
rs1398029174 6143 dbSNP
rs547379566 6158 dbSNP
rs1361236674 6160 dbSNP
rs781932265 6161 dbSNP
rs952347424 6163 dbSNP
rs1006504329 6166 dbSNP
rs1351827669 6167 dbSNP
rs782177774 6168 dbSNP
rs1461130371 6187 dbSNP
rs1424723929 6193 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000367108.3 | 3UTR | UCACACUAAAUGCUGCUCAUAACCCAUCCUCCUCUUCUUUAUUCAUCACUGCCUUCUUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.511 6.4e-3 0.427 2.1e-2 23 Click to see details
GSE38226 Liver fibrosis -0.482 1.3e-2 -0.502 1.0e-2 21 Click to see details
GSE21032 Prostate cancer -0.242 1.4e-2 -0.166 6.7e-2 83 Click to see details
GSE17498 Multiple myeloma 0.326 2.0e-2 0.112 2.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.363 4.1e-2 -0.301 7.6e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.35 4.3e-2 0.352 4.2e-2 25 Click to see details
GSE27834 Pluripotent stem cells -0.42 5.3e-2 -0.356 8.8e-2 16 Click to see details
GSE21687 Ependynoma primary tumors 0.182 7.5e-2 0.147 1.2e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.283 8.5e-2 0.367 3.6e-2 25 Click to see details
GSE14794 Lymphoblastoid cells 0.145 8.6e-2 0.167 5.8e-2 90 Click to see details
GSE19350 CNS germ cell tumors 0.326 1.5e-1 0.336 1.4e-1 12 Click to see details
GSE17306 Multiple myeloma 0.136 1.8e-1 0.133 1.8e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.111 3.2e-1 0.386 4.6e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.126 3.4e-1 -0.209 2.5e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.031 3.9e-1 0.098 2.0e-1 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.058 4.0e-1 -0.068 3.9e-1 20 Click to see details
GSE21849 B cell lymphoma 0.047 4.0e-1 0.239 1.1e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.044 4.1e-1 0.034 4.3e-1 32 Click to see details
GSE28544 Breast cancer -0.041 4.2e-1 0.071 3.7e-1 24 Click to see details
GSE19536 Breast cancer 0.003 4.9e-1 0.064 2.6e-1 100 Click to see details
GSE19536 Breast cancer 0.003 4.9e-1 0.064 2.6e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.627 0 -0.646 0 32 Click to see details
KIRP 0.489 0 0.475 0 32 Click to see details
BRCA -0.304 0 -0.261 0.01 84 Click to see details
PAAD -0.935 0.03 -0.400 0.3 4 Click to see details
LUAD 0.547 0.03 0.622 0.02 12 Click to see details
LUSC 0.262 0.06 0.235 0.08 38 Click to see details
ESCA 0.443 0.09 0.455 0.08 11 Click to see details
HNSC -0.154 0.17 -0.136 0.2 42 Click to see details
LIHC 0.138 0.17 0.157 0.14 49 Click to see details
KIRC 0.095 0.22 0.146 0.12 68 Click to see details
PCPG -0.669 0.27 -0.500 0.33 3 Click to see details
COAD -0.245 0.28 -0.643 0.04 8 Click to see details
CHOL 0.191 0.31 0.317 0.2 9 Click to see details
UCEC 0.12 0.31 0.202 0.2 19 Click to see details
CESC 0.514 0.33 0.500 0.33 3 Click to see details
THCA 0.059 0.33 0.065 0.31 59 Click to see details
BLCA 0.088 0.36 0.265 0.14 18 Click to see details
KICH 0.061 0.39 0.089 0.34 25 Click to see details
PRAD 0.027 0.43 0.096 0.25 50 Click to see details
PRAD 0.027 0.43 0.096 0.25 50 Click to see details
PRAD 0.027 0.43 0.096 0.25 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2