miRTarBase - #MIRT476861 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FHL2   
Synonyms AAG11, DRAL, FHL-2, SLIM-3, SLIM3
Description four and a half LIM domains 2
Transcript NM_001039492   
Other Transcripts NM_001450 , NM_201555 , NM_201557   
Putative miRNA Targets on FHL2
3'UTR of FHL2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            |:::|: ||  || |:||||  
113 - 136 122.00 -10.00
            ||: |||| |||    |:||| |||: 
362 - 390 114.00 -10.20
             |||||  | ||| | | ||| 
245 - 268 105.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30145006 15 COSMIC
COSN4893311 24 COSMIC
COSN31557795 28 COSMIC
COSN8407702 31 COSMIC
COSN30106588 33 COSMIC
COSN31508417 41 COSMIC
COSN31529417 46 COSMIC
COSN24309060 55 COSMIC
COSN30467986 67 COSMIC
COSN30152539 88 COSMIC
COSN30534480 99 COSMIC
COSN6672252 102 COSMIC
COSN30152850 113 COSMIC
COSN31554686 132 COSMIC
COSN31507796 156 COSMIC
COSN31526614 158 COSMIC
COSN30528697 161 COSMIC
COSN5475813 204 COSMIC
COSN31567180 208 COSMIC
COSN31603218 301 COSMIC
COSN8980488 302 COSMIC
COSN31537693 348 COSMIC
COSN31534036 354 COSMIC
COSN7454996 658 COSMIC
COSN8264059 1057 COSMIC
COSN29172841 1103 COSMIC
COSN29176232 1114 COSMIC
COSN7454995 1143 COSMIC
COSN21094280 1495 COSMIC
COSN6150649 1698 COSMIC
COSN1776104 1790 COSMIC
COSN1221025 2099 COSMIC
COSN26494470 2194 COSMIC
COSN7454994 2361 COSMIC
COSN1776103 2464 COSMIC
COSN24780088 2883 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1257674816 9 dbSNP
rs199691250 13 dbSNP
rs756430758 16 dbSNP
rs368824523 30 dbSNP
rs781750373 31 dbSNP
rs757735612 33 dbSNP
rs752238903 37 dbSNP
rs1463367047 40 dbSNP
rs1290529530 41 dbSNP
rs1000798237 50 dbSNP
rs775963548 50 dbSNP
rs1453217065 63 dbSNP
rs1338143273 83 dbSNP
rs530518744 84 dbSNP
rs1392063589 92 dbSNP
rs1295912741 94 dbSNP
rs1308864748 98 dbSNP
rs903741979 100 dbSNP
rs1398684313 101 dbSNP
rs939760066 101 dbSNP
rs1204821226 104 dbSNP
rs1239304356 107 dbSNP
rs1484960127 109 dbSNP
rs1297009989 110 dbSNP
rs778092790 113 dbSNP
rs879204828 116 dbSNP
rs1478919170 118 dbSNP
rs1174014635 131 dbSNP
rs1428264194 132 dbSNP
rs11537577 134 dbSNP
rs945037275 136 dbSNP
rs890907386 137 dbSNP
rs1167556039 147 dbSNP
rs908299857 148 dbSNP
rs1416748178 149 dbSNP
rs1182034016 155 dbSNP
rs1363652833 165 dbSNP
rs1402641267 166 dbSNP
rs1050850135 168 dbSNP
rs758826156 172 dbSNP
rs1247782423 175 dbSNP
rs932361126 176 dbSNP
rs1224479747 177 dbSNP
rs753215391 180 dbSNP
rs952578481 181 dbSNP
rs926496385 182 dbSNP
rs765710296 184 dbSNP
rs1261329295 185 dbSNP
rs980674894 187 dbSNP
rs2278500 194 dbSNP
rs909455005 195 dbSNP
rs983479116 196 dbSNP
rs1192678906 200 dbSNP
rs757512099 201 dbSNP
rs1405788849 216 dbSNP
rs546996537 227 dbSNP
rs1024955854 233 dbSNP
rs1159200732 237 dbSNP
rs992268924 238 dbSNP
rs956979827 239 dbSNP
rs529805708 245 dbSNP
rs1302196363 251 dbSNP
rs1365774780 253 dbSNP
rs959687850 264 dbSNP
rs1276958386 266 dbSNP
rs1283860422 270 dbSNP
rs1371832019 273 dbSNP
rs1033521747 282 dbSNP
rs1001106034 288 dbSNP
rs1307840926 293 dbSNP
rs1373862633 295 dbSNP
rs1337671446 303 dbSNP
rs1220324042 322 dbSNP
rs542257095 324 dbSNP
rs183756866 332 dbSNP
rs11537579 333 dbSNP
rs1230896745 337 dbSNP
rs1395874415 345 dbSNP
rs1044097 348 dbSNP
rs1177663064 353 dbSNP
rs1009213718 357 dbSNP
rs1162368723 362 dbSNP
rs559524401 366 dbSNP
rs1390428008 370 dbSNP
rs540935979 375 dbSNP
rs577099490 377 dbSNP
rs1325951807 385 dbSNP
rs1158839319 392 dbSNP
rs558160021 397 dbSNP
rs766063018 399 dbSNP
rs1332692675 400 dbSNP
rs1379725875 404 dbSNP
rs777604080 405 dbSNP
rs1314453027 406 dbSNP
rs932428413 421 dbSNP
rs1360441266 431 dbSNP
rs1230197110 432 dbSNP
rs899574331 434 dbSNP
rs546264176 441 dbSNP
rs1180477880 448 dbSNP
rs1204918723 450 dbSNP
rs773058177 459 dbSNP
rs942158903 465 dbSNP
rs909494051 466 dbSNP
rs1254844626 472 dbSNP
rs939720033 485 dbSNP
rs908248135 493 dbSNP
rs1473593337 495 dbSNP
rs771990202 498 dbSNP
rs1165744450 499 dbSNP
rs1048149550 515 dbSNP
rs931087687 518 dbSNP
rs926438832 526 dbSNP
rs980622332 530 dbSNP
rs1284675989 531 dbSNP
rs545800352 532 dbSNP
rs970621766 535 dbSNP
rs1451025552 540 dbSNP
rs1336193964 561 dbSNP
rs917855107 567 dbSNP
rs988118893 573 dbSNP
rs956736287 593 dbSNP
rs1219072428 597 dbSNP
rs1032808289 600 dbSNP
rs1321341048 606 dbSNP
rs929520528 608 dbSNP
rs953627539 613 dbSNP
rs575797400 616 dbSNP
rs557448899 623 dbSNP
rs992533551 627 dbSNP
rs535956014 628 dbSNP
rs1426176757 629 dbSNP
rs568532424 635 dbSNP
rs146492348 637 dbSNP
rs1403490726 638 dbSNP
rs967840371 647 dbSNP
rs1020713417 648 dbSNP
rs1306324246 652 dbSNP
rs1009444449 661 dbSNP
rs1400767939 670 dbSNP
rs1004251282 672 dbSNP
rs534985326 679 dbSNP
rs1222651857 680 dbSNP
rs868738452 681 dbSNP
rs1256558269 683 dbSNP
rs1347035694 684 dbSNP
rs1202916644 685 dbSNP
rs1330947616 691 dbSNP
rs1319388479 694 dbSNP
rs1218276173 703 dbSNP
rs1266294210 705 dbSNP
rs1402740182 706 dbSNP
rs1199142847 713 dbSNP
rs1378775763 714 dbSNP
rs1479256441 718 dbSNP
rs758308832 720 dbSNP
rs886767995 725 dbSNP
rs1048574126 728 dbSNP
rs931057392 733 dbSNP
rs571171036 736 dbSNP
rs551747536 737 dbSNP
rs371436181 741 dbSNP
rs530385928 744 dbSNP
rs569315595 745 dbSNP
rs759638777 751 dbSNP
rs367835825 762 dbSNP
rs899606048 765 dbSNP
rs1241640021 766 dbSNP
rs1242565100 766 dbSNP
rs1038516553 770 dbSNP
rs374388549 774 dbSNP
rs1005277469 776 dbSNP
rs1268410501 777 dbSNP
rs1453865158 778 dbSNP
rs1363707128 779 dbSNP
rs1445020405 780 dbSNP
rs1160528491 781 dbSNP
rs191042649 782 dbSNP
rs1424196664 790 dbSNP
rs1047887054 801 dbSNP
rs1392572500 802 dbSNP
rs752675068 806 dbSNP
rs929551597 826 dbSNP
rs918155133 833 dbSNP
rs1056506675 834 dbSNP
rs1377544457 834 dbSNP
rs1425928207 841 dbSNP
rs1312208010 844 dbSNP
rs1358290010 845 dbSNP
rs370111688 859 dbSNP
rs925305017 866 dbSNP
rs1433361443 873 dbSNP
rs926754489 878 dbSNP
rs1238173757 880 dbSNP
rs1458598773 881 dbSNP
rs1325013210 887 dbSNP
rs1180606447 892 dbSNP
rs1297247425 895 dbSNP
rs979866616 901 dbSNP
rs1423496193 902 dbSNP
rs1165807069 906 dbSNP
rs953450768 908 dbSNP
rs1460331019 914 dbSNP
rs1167089628 916 dbSNP
rs1400957504 917 dbSNP
rs1181628906 918 dbSNP
rs1448815813 918 dbSNP
rs1381338133 932 dbSNP
rs1482110740 937 dbSNP
rs1324316657 942 dbSNP
rs1225771232 945 dbSNP
rs1376816118 958 dbSNP
rs1310543761 960 dbSNP
rs1257763531 962 dbSNP
rs1413349543 962 dbSNP
rs1420166253 963 dbSNP
rs1261368399 964 dbSNP
rs1482988087 964 dbSNP
rs1169537911 965 dbSNP
rs1029051443 967 dbSNP
rs1258596072 974 dbSNP
rs76268450 979 dbSNP
rs1474326980 981 dbSNP
rs1192671827 982 dbSNP
rs1424019379 982 dbSNP
rs1448726225 982 dbSNP
rs878876756 982 dbSNP
rs878888921 982 dbSNP
rs1216765720 983 dbSNP
rs1422630335 984 dbSNP
rs112004931 990 dbSNP
rs1220812038 991 dbSNP
rs1486120765 994 dbSNP
rs1312106939 998 dbSNP
rs1259795424 1002 dbSNP
rs1208132903 1003 dbSNP
rs966189992 1017 dbSNP
rs780500623 1020 dbSNP
rs1274368557 1022 dbSNP
rs1015078104 1027 dbSNP
rs553585021 1028 dbSNP
rs12476475 1029 dbSNP
rs1424446924 1039 dbSNP
rs1277958663 1041 dbSNP
rs1177613701 1042 dbSNP
rs1234211111 1043 dbSNP
rs1026636589 1048 dbSNP
rs1298487772 1049 dbSNP
rs62152060 1050 dbSNP
rs1301612355 1051 dbSNP
rs543748813 1056 dbSNP
rs377647070 1057 dbSNP
rs1303527671 1058 dbSNP
rs542694294 1059 dbSNP
rs1239480007 1064 dbSNP
rs765975092 1066 dbSNP
rs541924182 1069 dbSNP
rs373510238 1073 dbSNP
rs1219993795 1075 dbSNP
rs1044841734 1102 dbSNP
rs987928244 1106 dbSNP
rs955359025 1109 dbSNP
rs1408128576 1113 dbSNP
rs768502400 1115 dbSNP
rs144492081 1120 dbSNP
rs1192803434 1124 dbSNP
rs553289161 1125 dbSNP
rs535263208 1126 dbSNP
rs1420326100 1137 dbSNP
rs878886495 1143 dbSNP
rs1381789869 1147 dbSNP
rs1052738261 1151 dbSNP
rs1180300281 1155 dbSNP
rs1322021343 1158 dbSNP
rs935245691 1170 dbSNP
rs1016576568 1175 dbSNP
rs773494868 1179 dbSNP
rs1005308526 1191 dbSNP
rs772483883 1194 dbSNP
rs536094785 1199 dbSNP
rs979433021 1201 dbSNP
rs886823955 1209 dbSNP
rs1257911590 1210 dbSNP
rs776701416 1212 dbSNP
rs1309999653 1213 dbSNP
rs1047957996 1217 dbSNP
rs1356130477 1227 dbSNP
rs1337356198 1236 dbSNP
rs1288912472 1239 dbSNP
rs1291100125 1246 dbSNP
rs537903316 1250 dbSNP
rs921986549 1251 dbSNP
rs577033997 1257 dbSNP
rs1239423292 1263 dbSNP
rs1442420507 1268 dbSNP
rs1162332124 1273 dbSNP
rs1439316627 1285 dbSNP
rs1406385365 1288 dbSNP
rs187042485 1289 dbSNP
rs1376085607 1310 dbSNP
rs966136837 1318 dbSNP
rs771052592 1329 dbSNP
rs537372626 1331 dbSNP
rs1057104230 1371 dbSNP
rs182050060 1377 dbSNP
rs1379149730 1379 dbSNP
rs1445889324 1387 dbSNP
rs952299676 1389 dbSNP
rs12476328 1396 dbSNP
rs1043676429 1397 dbSNP
rs1391982524 1402 dbSNP
rs1270537994 1412 dbSNP
rs535941854 1414 dbSNP
rs1199139916 1415 dbSNP
rs1259886221 1433 dbSNP
rs1459620803 1438 dbSNP
rs946838688 1451 dbSNP
rs373133825 1469 dbSNP
rs904869656 1470 dbSNP
rs1023342549 1486 dbSNP
rs145841286 1489 dbSNP
rs1465584931 1501 dbSNP
rs189702879 1504 dbSNP
rs896261220 1505 dbSNP
rs532291442 1531 dbSNP
rs1412909365 1532 dbSNP
rs1238133488 1553 dbSNP
rs1333519408 1556 dbSNP
rs1359965228 1558 dbSNP
rs748481682 1561 dbSNP
rs114813575 1564 dbSNP
rs116033554 1566 dbSNP
rs1280091563 1568 dbSNP
rs1342770647 1571 dbSNP
rs1199402484 1579 dbSNP
rs1278634292 1580 dbSNP
rs1443819748 1586 dbSNP
rs975755305 1589 dbSNP
rs779434468 1593 dbSNP
rs1261995948 1594 dbSNP
rs963956422 1607 dbSNP
rs921932557 1608 dbSNP
rs185236251 1612 dbSNP
rs1172095502 1613 dbSNP
rs944778527 1619 dbSNP
rs149854162 1621 dbSNP
rs951149090 1640 dbSNP
rs1025379805 1645 dbSNP
rs1400446202 1647 dbSNP
rs1299748706 1653 dbSNP
rs574828810 1660 dbSNP
rs952317511 1661 dbSNP
rs1274952817 1662 dbSNP
rs920824790 1669 dbSNP
rs1346573418 1670 dbSNP
rs980344407 1685 dbSNP
rs896658116 1692 dbSNP
rs1035168595 1703 dbSNP
rs1442989899 1713 dbSNP
rs1368595775 1727 dbSNP
rs1002869031 1728 dbSNP
rs1198834903 1730 dbSNP
rs970337201 1734 dbSNP
rs1479085272 1739 dbSNP
rs905438295 1743 dbSNP
rs1023288426 1751 dbSNP
rs1379931906 1762 dbSNP
rs1420466399 1766 dbSNP
rs1160271358 1772 dbSNP
rs1013288025 1774 dbSNP
rs1043748800 1782 dbSNP
rs1324174639 1783 dbSNP
rs1031170077 1786 dbSNP
rs1444016903 1801 dbSNP
rs946702889 1805 dbSNP
rs999331125 1810 dbSNP
rs1241803205 1818 dbSNP
rs903676227 1822 dbSNP
rs1292733765 1828 dbSNP
rs1354732921 1829 dbSNP
rs892580518 1833 dbSNP
rs1431119470 1841 dbSNP
rs1268735075 1842 dbSNP
rs1346033348 1855 dbSNP
rs1161503283 1858 dbSNP
rs2460258 1862 dbSNP
rs1379743444 1872 dbSNP
rs1043605274 1875 dbSNP
rs1174882776 1876 dbSNP
rs1052486913 1887 dbSNP
rs934067936 1895 dbSNP
rs1180802068 1903 dbSNP
rs559758980 1905 dbSNP
rs922430859 1908 dbSNP
rs773718617 1911 dbSNP
rs1163613464 1919 dbSNP
rs996028535 1921 dbSNP
rs1463960083 1922 dbSNP
rs1330115433 1924 dbSNP
rs1377055132 1931 dbSNP
rs1448307982 1939 dbSNP
rs765974276 1941 dbSNP
rs1190997602 1948 dbSNP
rs1486371262 1950 dbSNP
rs1287643553 1962 dbSNP
rs1339494179 1964 dbSNP
rs1244532929 1965 dbSNP
rs1266335121 1989 dbSNP
rs1337627411 1990 dbSNP
rs749401706 1992 dbSNP
rs900453003 1994 dbSNP
rs568752387 1997 dbSNP
rs1352410578 2004 dbSNP
rs866668899 2007 dbSNP
rs975239900 2010 dbSNP
rs1254408804 2012 dbSNP
rs942645674 2016 dbSNP
rs909796903 2018 dbSNP
rs1310378433 2021 dbSNP
rs1419692885 2022 dbSNP
rs1476703834 2027 dbSNP
rs944726194 2029 dbSNP
rs1214976013 2032 dbSNP
rs541170957 2039 dbSNP
rs35606673 2084 dbSNP
rs780996033 2084 dbSNP
rs1300337130 2091 dbSNP
rs1401060285 2094 dbSNP
rs1398370228 2099 dbSNP
rs1396212408 2100 dbSNP
rs1360054077 2106 dbSNP
rs1313913434 2112 dbSNP
rs1357813710 2113 dbSNP
rs983810333 2115 dbSNP
rs951012985 2116 dbSNP
rs1350972778 2117 dbSNP
rs1313566461 2119 dbSNP
rs960202615 2121 dbSNP
rs1025284009 2129 dbSNP
rs1376458715 2134 dbSNP
rs576996787 2137 dbSNP
rs1483058177 2142 dbSNP
rs755752311 2143 dbSNP
rs959775805 2144 dbSNP
rs183806971 2147 dbSNP
rs1002375325 2149 dbSNP
rs970284770 2154 dbSNP
rs866431172 2158 dbSNP
rs991801283 2169 dbSNP
rs558744175 2180 dbSNP
rs960659391 2182 dbSNP
rs571146288 2184 dbSNP
rs1466086701 2186 dbSNP
rs1022492152 2188 dbSNP
rs72823875 2190 dbSNP
rs150672820 2191 dbSNP
rs1212427280 2195 dbSNP
rs1481965624 2204 dbSNP
rs1052407857 2206 dbSNP
rs536283550 2211 dbSNP
rs192416609 2215 dbSNP
rs995977589 2216 dbSNP
rs1311715387 2217 dbSNP
rs900402194 2221 dbSNP
rs1205108580 2227 dbSNP
rs1282805333 2228 dbSNP
rs1040272038 2230 dbSNP
rs1309099681 2233 dbSNP
rs1039982702 2242 dbSNP
rs76884682 2243 dbSNP
rs74959968 2244 dbSNP
rs74445785 2245 dbSNP
rs942530530 2247 dbSNP
rs1217719456 2250 dbSNP
rs909828104 2251 dbSNP
rs1340140352 2261 dbSNP
rs547420597 2266 dbSNP
rs929852718 2267 dbSNP
rs538376182 2269 dbSNP
rs1418649781 2270 dbSNP
rs36099361 2277 dbSNP
rs960100999 2278 dbSNP
rs1302828868 2279 dbSNP
rs1034087236 2280 dbSNP
rs79154358 2281 dbSNP
rs2576777 2284 dbSNP
rs567607877 2289 dbSNP
rs549017002 2290 dbSNP
rs775469385 2292 dbSNP
rs1318545604 2293 dbSNP
rs530058633 2293 dbSNP
rs1219106222 2294 dbSNP
rs570672840 2299 dbSNP
rs948884727 2299 dbSNP
rs1031453192 2301 dbSNP
rs1194965107 2306 dbSNP
rs1235789039 2312 dbSNP
rs186645533 2325 dbSNP
rs1189585780 2346 dbSNP
rs770962812 2347 dbSNP
rs1402863811 2354 dbSNP
rs1163048667 2358 dbSNP
rs541482731 2361 dbSNP
rs901275471 2363 dbSNP
rs532506034 2366 dbSNP
rs1254853369 2371 dbSNP
rs1022068285 2387 dbSNP
rs1039777303 2396 dbSNP
rs1196379952 2397 dbSNP
rs1006949496 2399 dbSNP
rs10209781 2414 dbSNP
rs1197805495 2420 dbSNP
rs543652423 2421 dbSNP
rs1311668068 2423 dbSNP
rs1048216255 2424 dbSNP
rs1456980643 2428 dbSNP
rs968171652 2429 dbSNP
rs1022018084 2435 dbSNP
rs974507501 2442 dbSNP
rs964524275 2454 dbSNP
rs929883734 2460 dbSNP
rs1475722036 2463 dbSNP
rs576316893 2465 dbSNP
rs1009229324 2481 dbSNP
rs1465227144 2483 dbSNP
rs918506901 2485 dbSNP
rs1356503184 2506 dbSNP
rs1446024634 2515 dbSNP
rs1283409696 2520 dbSNP
rs1355909956 2521 dbSNP
rs1234895232 2529 dbSNP
rs1057227393 2530 dbSNP
rs938349150 2535 dbSNP
rs1218724727 2542 dbSNP
rs886383779 2544 dbSNP
rs1274441332 2555 dbSNP
rs555201511 2556 dbSNP
rs1209036487 2566 dbSNP
rs1237672491 2569 dbSNP
rs979895067 2574 dbSNP
rs1190505856 2575 dbSNP
rs1379789880 2585 dbSNP
rs1477745913 2597 dbSNP
rs1329855601 2601 dbSNP
rs1421686304 2610 dbSNP
rs1412798380 2616 dbSNP
rs878944667 2617 dbSNP
rs1465468485 2626 dbSNP
rs1333830954 2630 dbSNP
rs1376290966 2631 dbSNP
rs968400840 2633 dbSNP
rs915418524 2634 dbSNP
rs989600718 2642 dbSNP
rs1296055994 2646 dbSNP
rs764192918 2646 dbSNP
rs1431339099 2651 dbSNP
rs542953267 2662 dbSNP
rs2679884 2679 dbSNP
rs1271825870 2683 dbSNP
rs1342323769 2684 dbSNP
rs1218115937 2686 dbSNP
rs773372804 2689 dbSNP
rs371893069 2698 dbSNP
rs1349513761 2704 dbSNP
rs1031234947 2708 dbSNP
rs772213941 2717 dbSNP
rs965418926 2725 dbSNP
rs899225133 2734 dbSNP
rs1367463495 2735 dbSNP
rs571978419 2748 dbSNP
rs1018666220 2756 dbSNP
rs1181923568 2761 dbSNP
rs2576776 2762 dbSNP
rs888496772 2766 dbSNP
rs948816058 2771 dbSNP
rs1236320807 2774 dbSNP
rs538721598 2775 dbSNP
rs895983328 2780 dbSNP
rs1258991727 2791 dbSNP
rs1395938771 2799 dbSNP
rs1436768627 2810 dbSNP
rs1057343850 2821 dbSNP
rs934895314 2824 dbSNP
rs1382551299 2827 dbSNP
rs1320274823 2833 dbSNP
rs1048290206 2836 dbSNP
rs747893227 2837 dbSNP
rs75668800 2839 dbSNP
rs897095300 2843 dbSNP
rs946405093 2844 dbSNP
rs778997742 2848 dbSNP
rs914960330 2851 dbSNP
rs1057063644 2852 dbSNP
rs1207773026 2864 dbSNP
rs974458511 2867 dbSNP
rs964472061 2869 dbSNP
rs1265030821 2873 dbSNP
rs1239896156 2874 dbSNP
rs568870680 2877 dbSNP
rs36122701 2879 dbSNP
rs987351671 2884 dbSNP
rs779158603 2886 dbSNP
rs537998314 2890 dbSNP
rs374424405 2891 dbSNP
rs1044006089 2897 dbSNP
rs531798618 2899 dbSNP
rs1379906132 2902 dbSNP
rs914319683 2909 dbSNP
rs1325949918 2912 dbSNP
rs1160017081 2914 dbSNP
rs989630503 2922 dbSNP
rs755429531 2924 dbSNP
rs924075734 2930 dbSNP
rs977048901 2931 dbSNP
rs965973003 2935 dbSNP
rs1396078151 2937 dbSNP
rs1443904347 2938 dbSNP
rs1308167913 2940 dbSNP
rs1018281460 2946 dbSNP
rs1240227904 2966 dbSNP
rs1281589109 2972 dbSNP
rs1354903362 2978 dbSNP
rs1158969630 2980 dbSNP
rs985448984 2988 dbSNP
rs899155244 2995 dbSNP
rs1378427858 2996 dbSNP
rs749808925 2998 dbSNP
rs1469925065 3004 dbSNP
rs1196825008 3006 dbSNP
rs1250085924 3009 dbSNP
rs1419833020 3029 dbSNP
rs562769767 3031 dbSNP
rs1012987446 3051 dbSNP
rs1472323399 3054 dbSNP
rs1027061466 3061 dbSNP
rs999049857 3062 dbSNP
rs1396798519 3064 dbSNP
rs1392735109 3067 dbSNP
rs994226520 3068 dbSNP
rs1043320699 3069 dbSNP
rs903392072 3069 dbSNP
rs1294511741 3086 dbSNP
rs754922461 3089 dbSNP
rs1206116249 3090 dbSNP
rs1337499315 3090 dbSNP
rs947676291 3091 dbSNP
rs12474144 3094 dbSNP
rs914908124 3102 dbSNP
rs1038701374 3103 dbSNP
rs1284511225 3109 dbSNP
rs943112221 3113 dbSNP
rs897006624 3116 dbSNP
rs987686983 3119 dbSNP
rs1348668165 3125 dbSNP
rs1419960553 3136 dbSNP
rs1476773642 3139 dbSNP
rs567353883 3147 dbSNP
rs755666124 3150 dbSNP
rs1169177424 3151 dbSNP
rs759633306 3158 dbSNP
rs1276736137 3160 dbSNP
rs950583523 3164 dbSNP
rs1035893454 3169 dbSNP
rs1463052773 3178 dbSNP
rs1231293619 3180 dbSNP
rs1002801049 3186 dbSNP
rs1313807013 3188 dbSNP
rs72945003 3189 dbSNP
rs1318664622 3193 dbSNP
rs1295452888 3199 dbSNP
rs1044081231 3202 dbSNP
rs1229681036 3206 dbSNP
rs1254551062 3210 dbSNP
rs142435725 3219 dbSNP
rs1297496586 3227 dbSNP
rs1259309143 3231 dbSNP
rs779974109 3232 dbSNP
rs1185911269 3248 dbSNP
rs1262331035 3252 dbSNP
rs1429847584 3254 dbSNP
rs1196050060 3261 dbSNP
rs749978395 3265 dbSNP
rs1170332672 3273 dbSNP
rs1434898705 3277 dbSNP
rs1174691947 3284 dbSNP
rs1477464419 3286 dbSNP
rs1052814741 3292 dbSNP
rs1418226089 3302 dbSNP
rs566052040 3309 dbSNP
rs934381163 3314 dbSNP
rs1012935144 3318 dbSNP
rs1479004700 3332 dbSNP
rs1384013187 3337 dbSNP
rs1261553309 3341 dbSNP
rs924134240 3347 dbSNP
rs960085402 3357 dbSNP
rs977289294 3364 dbSNP
rs944335873 3367 dbSNP
rs139237155 3371 dbSNP
rs1280774911 3378 dbSNP
rs1214799479 3385 dbSNP
rs999394268 3386 dbSNP
rs1198819100 3388 dbSNP
rs985490001 3396 dbSNP
rs1251788172 3407 dbSNP
rs1454308052 3415 dbSNP
rs1195161156 3416 dbSNP
rs1378081761 3418 dbSNP
rs182053140 3420 dbSNP
rs1158745850 3430 dbSNP
rs1346332657 3432 dbSNP
rs1026965124 3444 dbSNP
rs972817186 3451 dbSNP
rs565075625 3458 dbSNP
rs1455773569 3466 dbSNP
rs543517376 3468 dbSNP
rs189415933 3484 dbSNP
rs1035563672 3488 dbSNP
rs1305988370 3494 dbSNP
rs1374865068 3495 dbSNP
rs1223014453 3498 dbSNP
rs73945097 3503 dbSNP
rs905803134 3507 dbSNP
rs1219330474 3510 dbSNP
rs1272448690 3514 dbSNP
rs1038646520 3541 dbSNP
rs943058168 3544 dbSNP
rs1277376746 3555 dbSNP
rs1415284107 3560 dbSNP
rs62155875 3562 dbSNP
rs1331561096 3563 dbSNP
rs63302162 3564 dbSNP
rs561343624 3566 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 2274.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            |||| ||| |   :|||||| 
Target 5' -gAACAGCCACU---GCACUCCa 3'
1 - 19
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            |||| ||| |   :|||||| 
Target 5' ugAACAGCCACU---GCACUCCa 3'
5 - 24
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000409177.1 | 3UTR | GAACAGCCACUGCACUCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000409177.1 | 3UTR | CCUGUGAACAGCCACUGCACUCCAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.784 2.9e-6 0.826 3.3e-7 24 Click to see details
GSE32688 Pancreatic cancer -0.627 6.2e-5 -0.482 2.6e-3 32 Click to see details
GSE21849 B cell lymphoma -0.478 4.4e-3 0.350 3.1e-2 29 Click to see details
GSE27834 Pluripotent stem cells 0.495 2.6e-2 0.441 4.4e-2 16 Click to see details
GSE38226 Liver fibrosis -0.347 6.2e-2 -0.429 2.6e-2 21 Click to see details
GSE28260 Renal cortex and medulla 0.448 6.2e-2 0.291 1.7e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.304 7.9e-2 -0.489 8.9e-3 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.266 9.9e-2 0.148 2.4e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.162 1.0e-1 -0.170 9.0e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.363 1.2e-1 0.392 1.0e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.269 1.3e-1 -0.021 4.6e-1 20 Click to see details
GSE17498 Multiple myeloma -0.157 1.7e-1 -0.147 1.8e-1 40 Click to see details
GSE17306 Multiple myeloma -0.123 2.0e-1 -0.020 4.5e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.083 2.2e-1 0.024 4.1e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.145 2.4e-1 0.119 2.9e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.349 2.5e-1 0.086 4.4e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells -0.006 4.9e-1 -0.112 3.0e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.961 0.09 0.500 0.33 3 Click to see details
STAD 0.507 0.1 0.333 0.21 8 Click to see details
LIHC -0.18 0.11 -0.074 0.31 49 Click to see details
THCA -0.238 0.35 -0.200 0.37 5 Click to see details
KICH 0.105 0.4 -0.071 0.43 8 Click to see details
KIRC -0.045 0.41 -0.036 0.43 29 Click to see details
CHOL 0.071 0.43 -0.017 0.48 9 Click to see details
KIRP -0.044 0.46 -0.100 0.4 9 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
ESCA 0.026 0.48 0.100 0.44 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
Your e-Mail*