miRTarBase - #MIRT475123 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IPPK   
Synonyms C9orf12, INSP5K2, IP5K, IPK1, bA476B13.1
Description inositol-pentakisphosphate 2-kinase
Transcript NM_022755   
Expression
Putative miRNA Targets on IPPK
3'UTR of IPPK
(miRNA target sites are highlighted)
>IPPK|NM_022755|3'UTR
   1 CTCTTTCCCTGCAGTGTCTTTGAAACTTGAACATAATGTGAAGGCTGAATGATAGAGATATTTTCTGTTGTGTTGGGTGA
  81 CCTTTGGTTGTGAATGTTTTTGCTTTTAACCCCTTTTGAGGTGGGATTGCCTCTTGGAGACATGGAATTGAAGAGCACTA
 161 GAAACAACTTCCTGGACAAGGAATGTAGGAAGTGAGTGCTGTGTCCCAGGAAGCTGCTCACACTCTTAAAATGGAAGTGT
 241 CCGTTAAGCCCTGGGAAGACGTTCTGGATAGTTCTTCTTTCCCAACCAGGGCTCATGTCTGATTCTCTAATGCGAAAAGC
 321 CTTATTCTAAGACCCAAGGTTTGGATCTGCTACCACCAGACTCCTAACATAGAAAACTTGAATTGTCACATACATTTTAC
 401 AGTTTGGACTTTTAAGAAAACATGGATACTACTGGAACTTCCCCCAGCTGAGTTACATGGTCACTTTTTCAGTGCAAGCC
 481 ACATATCAACACAGGTTTTTAGGTGGTTCCCTGCTGCACAGCGTGACCTCGTGGTCGCGCAGATGCCGATTCTGAGCAGT
 561 GTAGACTCAGGGTCCCTGTGGAGGTGCTGAAGCCCACAGTTCCACACAGGGCAGCAGGGAGCGCAAGGCTCAGGTCAGGA
 641 TGGACACCACTCATGCGAGCATTGACCTTTTTTTTTTTGCTTTACAATTTAATCTTTCACATGAGGGGGAGATGAGCTGT
 721 TCTTTCCCACTAAAAATTGCTGCTGTAGAAGTTGGAGGTGGAGCTGTGACTGGCTGAGCTGCTGTGGCCGGGCTGGGCAG
 801 TGTGCCCCAACAGCTCAGTGCTTTCCTGACACTCCAGTGTCTGGGGTGGTTGAGGAGCGAGTTCTCTCTTCCTCCCAGAC
 881 CAAGTTCCTCCCTCGGGTTTGCCTTGAGACGTGTTGCGTTTTTGGGCCCCGTGGCCTCTCCCTGTTAGGCTGCCACAGGC
 961 CCTGCTTCTGGAAGGTGAACAGCTCCTGGCTGCTGCCGAGAGGGTTCTCGTTGGGGTCACCAAAGTGTGCCCGGCTGCTA
1041 TGAAAAACGTTGGGAATCTTGGTTTCAGTTTTTTATTCTATGCTAGGTTGTACAGACTTATTTATATCATCGTTTTGAGG
1121 GACTAATGGAGGCTTATTGTAACATATAATATTAGTGAAACCATGGAATTATATGAAAATGATACATGAGAAATAAGGAA
1201 ACTATTTTGCTGATTGTAAATTTTTGTGGGAAATTTTGTGATAACTTGAGAATTATACTTGTTTGAATCAAGGCAACTCT
1281 TCTAGAATTTATTGTTCAATTCTGTCATATTTACTTCTAATTCTACTCTCAGAGGTGCAAAAAGATACTTATCTAACTGG
1361 ACACTTTTACTGTTTTCTTCTCACTTCCAATGACACCGTCTCATACACACGGGTCCTGTGTGCTGGGATGGGGGCTTTGG
1441 TGAAGTGCACGGAGCTCACGGACAAGCCGCAGGCTCTGGGAAGCGTGGAGGTAGTGGCCGTTGAGTACTGTCTTGACCCA
1521 AGGGAGTTCACTGTTGCTGGGCTGGGGCTGGGGCAGCCTGGTTTGGGATGATTTTGCCCATTGTCACGGTGTGTGGAGGA
1601 TGCTGGGTCCTGGGTTCAAGTGCACATGTGAGGGAACCCCAGTCCGTGGGAAGGTGGGCTGGGCTCCCTAGGTCCTTCAG
1681 GGCTGCAAGAGTTATTGCCTAGCACAGGGCCCAGACAGGGCTGGACTAGACACGATGAAAACAGCCTGTATTTGAGGGAG
1761 AAGAGAAAACAGATGGAGACCCCCACTCTGTCTGGTCTTGGCTCCCACCAGCCCGGGCTGTGAGGAGCCCCTGAGCCGCG
1841 GGTGCCACTGCTGTGGATGCGTTTCTGGCCCGTCTTGGAAACTGCTGCTGCTGCGTAGTCATGACGGCCCTGACTGGTTT
1921 GAGACAACACGCGTTCACAGATCTTAACAATGCTAAATGGGCGACTGATGAGGTCACGGTTCTTAAGGCACATCCGGGAC
2001 GATCGATATAGCACTTAGGCTATGCAGGGGGGTCTTTCTTTCATAAAGGACCTCATTCCTTGCGTCCCAGCCCAGGAACA
2081 GTGCTGTCTTTGCTGTCTTAGGCCATTCTTGTTATTAAGCTGACAGCTTCACTTTCTTGTGGAAGACCAAGAACAGCATG
2161 AGGACTTGCTGAGACTGCCTCACGGTGCCACCATGCGGACCGGGGGGAGGCAGGGAGTGAGGGTGTGGCTCCCCTGGGCT
2241 ACTAAGGACAGTTTAAAGATGAGGCGCCATAGGCATCCGTCTCCAGAGCCCCCAGGAGGCAGGAACCAGGATAAGGGTGG
2321 CTTCTCCCAGCTGAGTAATGTGGCCACCATGTCCAAGGTGGACTCGGTGTGAGGCTGCAGTGGGTGGGGGATGGATCCTC
2401 CCCACACATCTGAGGACACACAACCACTTGGTACATTTTCTCAGATGTTAAGCTTATTTTTATAAACCACATTGTACGTG
2481 TCACTTTTATTTGGCATTTTATACTTAACTAGTTGTATTTATTTTTCATGTCATGAGAGTTTCCATATAATGTGCCATAA
2561 CTGCATAGACAGCACGTCTTCAGGGTGTGGTTTCTAAGCAGAAAATAGCAAATGTTTATATTGAATAAAATTGCATGTTC
2641 CTCCACGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||:|  |  ||||||| 
Target 5' ttcccACTAAAAATTGCTGCTg 3'
724 - 745 149.00 -11.50
2
miRNA  3' gugUUUGGUAAUAC-ACGACGAu 5'
             ||||     || ||||||| 
Target 5' tggAAAC-----TGCTGCTGCTg 3'
1876 - 1893 146.00 -10.90
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:||| | ||||| | 
Target 5' aggAAACTATT-T-TGCTGATt 3'
1196 - 1215 133.00 -11.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30483234 3 COSMIC
COSN30468756 18 COSMIC
COSN30163402 29 COSMIC
COSN22013194 46 COSMIC
COSN31578162 57 COSMIC
COSN31592239 145 COSMIC
COSN31603301 259 COSMIC
COSN31536064 537 COSMIC
COSN31608940 934 COSMIC
COSN31607410 1048 COSMIC
COSN26640894 1216 COSMIC
COSN31549572 1250 COSMIC
COSN31529261 1344 COSMIC
COSN6399622 1383 COSMIC
COSN21058492 1466 COSMIC
COSN8336047 1838 COSMIC
COSN27107037 2000 COSMIC
COSN20832879 2042 COSMIC
COSN27535964 2327 COSMIC
COSN2333871 2356 COSMIC
COSN7812089 2423 COSMIC
COSN7812088 2431 COSMIC
COSN30115447 2456 COSMIC
COSN30168522 2555 COSMIC
COSN28096286 2558 COSMIC
COSN30530800 2609 COSMIC
COSN8811337 2646 COSMIC
COSN26970404 2647 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201916840 1 dbSNP
rs1190363465 3 dbSNP
rs746841324 5 dbSNP
rs779765078 6 dbSNP
rs758334027 7 dbSNP
rs377078371 14 dbSNP
rs1486059954 15 dbSNP
rs761992931 18 dbSNP
rs1244000673 22 dbSNP
rs1478330525 22 dbSNP
rs756263115 23 dbSNP
rs557308125 24 dbSNP
rs1482992901 32 dbSNP
rs1458610798 37 dbSNP
rs752691793 38 dbSNP
rs1385913778 39 dbSNP
rs774390603 39 dbSNP
rs753743419 45 dbSNP
rs1354767393 54 dbSNP
rs1172169078 55 dbSNP
rs1411968303 57 dbSNP
rs1224673217 61 dbSNP
rs780236906 65 dbSNP
rs535773552 74 dbSNP
rs1321929916 76 dbSNP
rs1210948174 79 dbSNP
rs1268415411 106 dbSNP
rs1164772670 108 dbSNP
rs1485358182 110 dbSNP
rs902375108 116 dbSNP
rs1042297969 119 dbSNP
rs1420024966 133 dbSNP
rs978828499 141 dbSNP
rs1451616801 155 dbSNP
rs1198691840 158 dbSNP
rs576128225 168 dbSNP
rs1427094654 181 dbSNP
rs112661654 184 dbSNP
rs1159581152 196 dbSNP
rs893096997 209 dbSNP
rs1225915156 215 dbSNP
rs1453348116 216 dbSNP
rs1482805110 223 dbSNP
rs1233664675 224 dbSNP
rs1392973976 233 dbSNP
rs1206944541 234 dbSNP
rs1054871657 237 dbSNP
rs1288906934 239 dbSNP
rs118177985 242 dbSNP
rs986871280 243 dbSNP
rs1285846466 246 dbSNP
rs1316645458 250 dbSNP
rs775012241 257 dbSNP
rs771825963 261 dbSNP
rs1359603660 270 dbSNP
rs1221058815 274 dbSNP
rs918790249 278 dbSNP
rs973007589 280 dbSNP
rs546605360 284 dbSNP
rs1016568287 287 dbSNP
rs990906578 290 dbSNP
rs1157279604 296 dbSNP
rs959089361 305 dbSNP
rs1034753303 314 dbSNP
rs1163043142 324 dbSNP
rs1003325857 345 dbSNP
rs1325652564 347 dbSNP
rs1299179781 356 dbSNP
rs1373146163 357 dbSNP
rs528133994 361 dbSNP
rs1462369613 365 dbSNP
rs1390020716 368 dbSNP
rs1314489290 369 dbSNP
rs1359665156 390 dbSNP
rs570451334 394 dbSNP
rs1244731440 396 dbSNP
rs1397306139 402 dbSNP
rs1288984387 408 dbSNP
rs552252219 413 dbSNP
rs1418549725 423 dbSNP
rs1408874756 432 dbSNP
rs902342453 438 dbSNP
rs759250350 441 dbSNP
rs1250685041 444 dbSNP
rs1479565390 445 dbSNP
rs1183350249 446 dbSNP
rs1021209955 449 dbSNP
rs1445493434 455 dbSNP
rs1477181127 455 dbSNP
rs1383471916 458 dbSNP
rs1245847777 461 dbSNP
rs137892086 467 dbSNP
rs1469696991 470 dbSNP
rs893727455 471 dbSNP
rs1460821399 480 dbSNP
rs1054436845 483 dbSNP
rs942687180 485 dbSNP
rs1208080903 486 dbSNP
rs1301686210 493 dbSNP
rs563118503 515 dbSNP
rs539497655 516 dbSNP
rs1366820068 517 dbSNP
rs889813601 522 dbSNP
rs1294821888 527 dbSNP
rs1305729787 529 dbSNP
rs1308553475 530 dbSNP
rs1051118599 531 dbSNP
rs1263544329 532 dbSNP
rs934116788 536 dbSNP
rs1303763527 537 dbSNP
rs773765920 538 dbSNP
rs1442091188 540 dbSNP
rs544430599 543 dbSNP
rs1241519134 547 dbSNP
rs1397196607 548 dbSNP
rs147435929 557 dbSNP
rs1453707209 578 dbSNP
rs1418840248 581 dbSNP
rs1345822868 585 dbSNP
rs1178796523 597 dbSNP
rs1365394419 599 dbSNP
rs142863634 599 dbSNP
rs1469606945 607 dbSNP
rs1334348976 609 dbSNP
rs941594553 613 dbSNP
rs1430961247 622 dbSNP
rs79211883 623 dbSNP
rs1394690053 628 dbSNP
rs1194546821 631 dbSNP
rs750994486 638 dbSNP
rs770256709 645 dbSNP
rs991114887 648 dbSNP
rs959017442 651 dbSNP
rs1221445382 653 dbSNP
rs1034720687 656 dbSNP
rs981816304 657 dbSNP
rs1241606095 658 dbSNP
rs183340727 662 dbSNP
rs1202309640 667 dbSNP
rs1020757247 668 dbSNP
rs74359951 678 dbSNP
rs1400946217 679 dbSNP
rs1414586261 679 dbSNP
rs1480341613 679 dbSNP
rs1185818842 680 dbSNP
rs1486154041 684 dbSNP
rs1261907133 699 dbSNP
rs375540192 705 dbSNP
rs1303741085 709 dbSNP
rs1344772510 713 dbSNP
rs1402980297 751 dbSNP
rs1290006036 755 dbSNP
rs1351048339 760 dbSNP
rs1224546126 765 dbSNP
rs748699021 767 dbSNP
rs1315259393 769 dbSNP
rs1311170711 774 dbSNP
rs1224787244 777 dbSNP
rs1280563221 781 dbSNP
rs575320681 789 dbSNP
rs1373589661 790 dbSNP
rs1295908214 792 dbSNP
rs1234967541 796 dbSNP
rs1470716979 799 dbSNP
rs1007466734 808 dbSNP
rs1382091139 814 dbSNP
rs1363285637 816 dbSNP
rs375170901 817 dbSNP
rs889782241 821 dbSNP
rs1163699335 822 dbSNP
rs1364350606 832 dbSNP
rs1051049442 834 dbSNP
rs1309698902 837 dbSNP
rs1336197997 839 dbSNP
rs1441190354 852 dbSNP
rs1300041682 858 dbSNP
rs1291207376 859 dbSNP
rs1445909654 865 dbSNP
rs998192426 867 dbSNP
rs1358737493 870 dbSNP
rs897247085 872 dbSNP
rs1275709751 873 dbSNP
rs1438810059 874 dbSNP
rs572118644 876 dbSNP
rs557173565 883 dbSNP
rs910083500 888 dbSNP
rs1183757761 894 dbSNP
rs1169496985 895 dbSNP
rs1384075445 903 dbSNP
rs117004058 910 dbSNP
rs117314703 911 dbSNP
rs1180083716 917 dbSNP
rs1397096135 918 dbSNP
rs1485048029 924 dbSNP
rs938244848 929 dbSNP
rs1407955835 930 dbSNP
rs1454786538 931 dbSNP
rs1257634759 947 dbSNP
rs1212531845 955 dbSNP
rs116290984 956 dbSNP
rs774707231 963 dbSNP
rs1249917596 964 dbSNP
rs1214929404 974 dbSNP
rs1195679459 983 dbSNP
rs1271338215 988 dbSNP
rs77697263 996 dbSNP
rs534552493 997 dbSNP
rs913622258 998 dbSNP
rs1442291491 1003 dbSNP
rs1194655438 1004 dbSNP
rs3802383 1009 dbSNP
rs551952390 1010 dbSNP
rs1166020349 1011 dbSNP
rs958104505 1017 dbSNP
rs1354857329 1018 dbSNP
rs1337701495 1032 dbSNP
rs1313565023 1033 dbSNP
rs1394473599 1040 dbSNP
rs750621355 1041 dbSNP
rs1327036104 1042 dbSNP
rs192359227 1048 dbSNP
rs1268927522 1049 dbSNP
rs1326165608 1050 dbSNP
rs1224484334 1058 dbSNP
rs3802382 1062 dbSNP
rs1297884927 1063 dbSNP
rs1206470052 1068 dbSNP
rs1462274898 1069 dbSNP
rs1261825097 1072 dbSNP
rs1445915494 1080 dbSNP
rs1191007959 1088 dbSNP
rs1431327279 1100 dbSNP
rs1480665204 1101 dbSNP
rs954637544 1101 dbSNP
rs1162543527 1107 dbSNP
rs1464740919 1107 dbSNP
rs550751347 1111 dbSNP
rs1029592083 1112 dbSNP
rs757005516 1117 dbSNP
rs1417872521 1119 dbSNP
rs998161174 1129 dbSNP
rs759211287 1133 dbSNP
rs897179643 1139 dbSNP
rs1481820939 1147 dbSNP
rs1005673363 1149 dbSNP
rs1037515057 1149 dbSNP
rs1310741599 1151 dbSNP
rs1196059424 1152 dbSNP
rs1260935844 1153 dbSNP
rs776396775 1153 dbSNP
rs34522501 1156 dbSNP
rs1253480386 1174 dbSNP
rs1349393262 1175 dbSNP
rs1202825660 1200 dbSNP
rs755270502 1201 dbSNP
rs1270366546 1207 dbSNP
rs888571326 1208 dbSNP
rs1490500832 1213 dbSNP
rs1198531618 1214 dbSNP
rs796298863 1216 dbSNP
rs138686834 1217 dbSNP
rs1184318213 1226 dbSNP
rs1364575522 1227 dbSNP
rs938213919 1228 dbSNP
rs1294496179 1232 dbSNP
rs928219836 1238 dbSNP
rs1235206737 1243 dbSNP
rs1303074667 1248 dbSNP
rs1425851373 1248 dbSNP
rs1348748782 1249 dbSNP
rs1393482148 1256 dbSNP
rs529490764 1256 dbSNP
rs1307318131 1257 dbSNP
rs1334838385 1260 dbSNP
rs1237451014 1261 dbSNP
rs1293341062 1277 dbSNP
rs1359447694 1278 dbSNP
rs914165434 1286 dbSNP
rs988467451 1294 dbSNP
rs1306530549 1299 dbSNP
rs561996259 1300 dbSNP
rs1481519707 1306 dbSNP
rs1177536627 1307 dbSNP
rs372483137 1307 dbSNP
rs753794358 1325 dbSNP
rs778913793 1326 dbSNP
rs945022811 1331 dbSNP
rs913602864 1335 dbSNP
rs1395109719 1348 dbSNP
rs1167100625 1351 dbSNP
rs1471307970 1352 dbSNP
rs1299124446 1354 dbSNP
rs764028614 1361 dbSNP
rs1182032228 1367 dbSNP
rs546896729 1372 dbSNP
rs757041514 1376 dbSNP
rs1382955084 1380 dbSNP
rs756003381 1380 dbSNP
rs957814999 1385 dbSNP
rs567927876 1390 dbSNP
rs140824196 1397 dbSNP
rs995748186 1398 dbSNP
rs1205071434 1410 dbSNP
rs985942398 1423 dbSNP
rs1456274423 1430 dbSNP
rs564529652 1434 dbSNP
rs1245178177 1435 dbSNP
rs1461861596 1440 dbSNP
rs1183102039 1447 dbSNP
rs376863092 1447 dbSNP
rs548627776 1447 dbSNP
rs1430827833 1451 dbSNP
rs1171658356 1452 dbSNP
rs1348571152 1459 dbSNP
rs545908800 1460 dbSNP
rs988762270 1463 dbSNP
rs1036949791 1464 dbSNP
rs575680608 1467 dbSNP
rs1406310852 1469 dbSNP
rs72754496 1479 dbSNP
rs896522308 1484 dbSNP
rs1030188444 1485 dbSNP
rs1056881052 1497 dbSNP
rs938086746 1498 dbSNP
rs187011148 1499 dbSNP
rs574689246 1500 dbSNP
rs1225088497 1501 dbSNP
rs1015596855 1510 dbSNP
rs1439890055 1512 dbSNP
rs1006013914 1516 dbSNP
rs888551373 1518 dbSNP
rs1033824225 1519 dbSNP
rs7024536 1520 dbSNP
rs1477068125 1527 dbSNP
rs1179068365 1547 dbSNP
rs1430357069 1549 dbSNP
rs1173434929 1555 dbSNP
rs906727619 1555 dbSNP
rs1346522440 1580 dbSNP
rs1178431579 1581 dbSNP
rs1046675918 1584 dbSNP
rs534932767 1587 dbSNP
rs892086852 1588 dbSNP
rs1338381038 1595 dbSNP
rs914153036 1598 dbSNP
rs577090702 1607 dbSNP
rs1283704897 1608 dbSNP
rs936390614 1619 dbSNP
rs988415296 1625 dbSNP
rs570112917 1630 dbSNP
rs1383529766 1633 dbSNP
rs377714762 1638 dbSNP
rs1158653677 1642 dbSNP
rs934300949 1645 dbSNP
rs374993473 1646 dbSNP
rs1375563954 1650 dbSNP
rs1192657567 1657 dbSNP
rs1216546483 1658 dbSNP
rs1285346572 1662 dbSNP
rs1454088267 1666 dbSNP
rs1202151079 1676 dbSNP
rs551466106 1678 dbSNP
rs1477903019 1688 dbSNP
rs1189147735 1694 dbSNP
rs986887313 1695 dbSNP
rs1400888685 1697 dbSNP
rs79610873 1701 dbSNP
rs1445782968 1703 dbSNP
rs1283583487 1704 dbSNP
rs972351131 1707 dbSNP
rs1028496133 1709 dbSNP
rs1426482239 1710 dbSNP
rs961992375 1716 dbSNP
rs1278422260 1718 dbSNP
rs1433995205 1720 dbSNP
rs1233908789 1724 dbSNP
rs1015979485 1733 dbSNP
rs1305361680 1734 dbSNP
rs984157029 1736 dbSNP
rs1224491614 1739 dbSNP
rs1285410920 1742 dbSNP
rs7020985 1749 dbSNP
rs1033750272 1763 dbSNP
rs1293123546 1772 dbSNP
rs962544245 1775 dbSNP
rs1325772440 1776 dbSNP
rs569407417 1782 dbSNP
rs1451434623 1785 dbSNP
rs111989047 1789 dbSNP
rs1015454310 1790 dbSNP
rs1004058432 1795 dbSNP
rs1234912745 1795 dbSNP
rs1318971274 1796 dbSNP
rs1383379848 1797 dbSNP
rs896425778 1804 dbSNP
rs906698156 1806 dbSNP
rs1025152008 1813 dbSNP
rs1010200181 1814 dbSNP
rs867025037 1815 dbSNP
rs892731875 1818 dbSNP
rs1403493525 1819 dbSNP
rs1330660545 1820 dbSNP
rs1354839465 1826 dbSNP
rs1034988775 1827 dbSNP
rs1053842201 1828 dbSNP
rs1308796954 1830 dbSNP
rs1374839621 1831 dbSNP
rs777007038 1837 dbSNP
rs888812221 1838 dbSNP
rs769270073 1839 dbSNP
rs1044238242 1840 dbSNP
rs933072188 1849 dbSNP
rs1396002084 1857 dbSNP
rs565774487 1860 dbSNP
rs1474667015 1861 dbSNP
rs892667211 1863 dbSNP
rs1242041524 1870 dbSNP
rs188461734 1871 dbSNP
rs940578133 1872 dbSNP
rs909113311 1881 dbSNP
rs944915451 1882 dbSNP
rs985139631 1884 dbSNP
rs1420047036 1887 dbSNP
rs912131419 1888 dbSNP
rs373378181 1892 dbSNP
rs926650752 1894 dbSNP
rs775684626 1895 dbSNP
rs970809838 1895 dbSNP
rs1334945587 1899 dbSNP
rs868184080 1904 dbSNP
rs1339882266 1905 dbSNP
rs1282805620 1906 dbSNP
rs376424903 1913 dbSNP
rs568328624 1916 dbSNP
rs921006200 1921 dbSNP
rs1270670697 1930 dbSNP
rs546859688 1931 dbSNP
rs553445199 1932 dbSNP
rs1025535941 1933 dbSNP
rs1440190454 1936 dbSNP
rs1311752550 1943 dbSNP
rs1195313904 1949 dbSNP
rs564663753 1954 dbSNP
rs1015357785 1963 dbSNP
rs1168300289 1968 dbSNP
rs1431083649 1972 dbSNP
rs1471082322 1976 dbSNP
rs1032583880 1977 dbSNP
rs1401663868 1983 dbSNP
rs982582378 1988 dbSNP
rs1394347380 1989 dbSNP
rs1408545979 1992 dbSNP
rs960579408 1995 dbSNP
rs1035383229 1996 dbSNP
rs1399877374 2000 dbSNP
rs1276709631 2001 dbSNP
rs1002206749 2004 dbSNP
rs1255036699 2009 dbSNP
rs1168951740 2016 dbSNP
rs1342325137 2025 dbSNP
rs547369049 2031 dbSNP
rs901617507 2032 dbSNP
rs1187290556 2033 dbSNP
rs1270860748 2034 dbSNP
rs764040970 2048 dbSNP
rs1036544929 2052 dbSNP
rs1199908459 2054 dbSNP
rs1377248373 2055 dbSNP
rs533808872 2060 dbSNP
rs1022365507 2063 dbSNP
rs1010966552 2064 dbSNP
rs892570171 2065 dbSNP
rs1361186805 2066 dbSNP
rs757056539 2068 dbSNP
rs1009076243 2079 dbSNP
rs1419634399 2082 dbSNP
rs552536458 2094 dbSNP
rs1296885215 2097 dbSNP
rs909071351 2101 dbSNP
rs530858542 2108 dbSNP
rs1486075811 2111 dbSNP
rs1300213900 2125 dbSNP
rs16908474 2138 dbSNP
rs937244182 2139 dbSNP
rs1309356784 2148 dbSNP
rs926577559 2153 dbSNP
rs1436965311 2156 dbSNP
rs932323727 2158 dbSNP
rs1293823539 2173 dbSNP
rs542354304 2175 dbSNP
rs550885853 2177 dbSNP
rs1209050678 2178 dbSNP
rs1264946150 2181 dbSNP
rs749150496 2183 dbSNP
rs1184171593 2184 dbSNP
rs1381073406 2189 dbSNP
rs970778837 2195 dbSNP
rs879361271 2196 dbSNP
rs908307426 2197 dbSNP
rs1032964967 2200 dbSNP
rs982572685 2201 dbSNP
rs118009466 2202 dbSNP
rs1375577074 2202 dbSNP
rs997118689 2206 dbSNP
rs1277390359 2208 dbSNP
rs1316478156 2217 dbSNP
rs1322284906 2226 dbSNP
rs1243904656 2233 dbSNP
rs1263464344 2249 dbSNP
rs1441059723 2254 dbSNP
rs927884375 2265 dbSNP
rs373554873 2266 dbSNP
rs1239000026 2268 dbSNP
rs1354272520 2270 dbSNP
rs1176888875 2273 dbSNP
rs185270401 2275 dbSNP
rs1036103980 2276 dbSNP
rs1005078439 2278 dbSNP
rs1022693861 2279 dbSNP
rs1170994678 2298 dbSNP
rs887580581 2316 dbSNP
rs1049376583 2319 dbSNP
rs1338153913 2328 dbSNP
rs1379182186 2332 dbSNP
rs1395454376 2334 dbSNP
rs1310474547 2346 dbSNP
rs1010912624 2348 dbSNP
rs1309091177 2350 dbSNP
rs1218982906 2354 dbSNP
rs540901325 2360 dbSNP
rs1031123545 2365 dbSNP
rs114087903 2366 dbSNP
rs1196909454 2369 dbSNP
rs558623868 2380 dbSNP
rs1475563288 2384 dbSNP
rs890649315 2390 dbSNP
rs1045703518 2397 dbSNP
rs41305489 2400 dbSNP
rs996810035 2403 dbSNP
rs79658975 2405 dbSNP
rs554208425 2406 dbSNP
rs935419801 2425 dbSNP
rs925443170 2431 dbSNP
rs1469819754 2435 dbSNP
rs1233188678 2436 dbSNP
rs1037966572 2437 dbSNP
rs767088903 2441 dbSNP
rs1308988120 2442 dbSNP
rs1364027266 2463 dbSNP
rs1467023700 2470 dbSNP
rs1400482701 2473 dbSNP
rs953568520 2474 dbSNP
rs1338140304 2477 dbSNP
rs1217094830 2480 dbSNP
rs1280967768 2482 dbSNP
rs908297945 2489 dbSNP
rs1209540978 2508 dbSNP
rs1254273213 2509 dbSNP
rs1489562201 2528 dbSNP
rs1194951762 2529 dbSNP
rs1046820758 2530 dbSNP
rs1214303293 2532 dbSNP
rs1263009700 2536 dbSNP
rs939185416 2539 dbSNP
rs754492049 2543 dbSNP
rs1029187062 2546 dbSNP
rs927757755 2561 dbSNP
rs980648005 2563 dbSNP
rs969668847 2564 dbSNP
rs1281566597 2566 dbSNP
rs1222790876 2568 dbSNP
rs535960836 2575 dbSNP
rs989472364 2576 dbSNP
rs565469263 2578 dbSNP
rs1369305346 2581 dbSNP
rs1325762668 2585 dbSNP
rs1004602976 2587 dbSNP
rs562036179 2609 dbSNP
rs1462455624 2621 dbSNP
rs75861111 2630 dbSNP
rs767816355 2635 dbSNP
rs1236195586 2639 dbSNP
rs373734749 2640 dbSNP
rs1383174883 2644 dbSNP
rs1365306781 2645 dbSNP
rs41312236 2646 dbSNP
rs372370836 2647 dbSNP
rs764108042 2647 dbSNP
rs780250106 2650 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||:|  |  ||||||| 
Target 5' uucccACUAAAAAUUGCUGCUg 3'
5 - 26
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000287996.3 | 3UTR | UUCUUUCCCACUAAAAAUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.63 6.4e-4 0.570 2.3e-3 23 Click to see details
GSE17498 Multiple myeloma -0.355 1.2e-2 -0.354 1.3e-2 40 Click to see details
GSE14794 Lymphoblastoid cells -0.208 2.5e-2 -0.224 1.7e-2 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.366 3.6e-2 0.464 9.7e-3 25 Click to see details
GSE38226 Liver fibrosis -0.361 5.4e-2 -0.470 1.6e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.342 1.3e-1 -0.291 1.7e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.302 1.3e-1 0.312 1.2e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.209 1.6e-1 0.040 4.2e-1 25 Click to see details
GSE19536 Breast cancer 0.093 1.8e-1 0.114 1.3e-1 100 Click to see details
GSE32688 Pancreatic cancer 0.155 2.0e-1 0.337 3.0e-2 32 Click to see details
GSE19783 ER- ER- breast cancer 0.083 2.3e-1 0.155 8.6e-2 79 Click to see details
GSE17306 Multiple myeloma -0.106 2.3e-1 -0.053 3.6e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.223 2.4e-1 -0.371 1.2e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.101 3.4e-1 -0.186 2.2e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.097 3.4e-1 0.320 8.4e-2 20 Click to see details
GSE21849 B cell lymphoma -0.072 3.6e-1 -0.099 3.0e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.033 4.0e-1 -0.156 1.1e-1 64 Click to see details
GSE28544 Breast cancer 0.029 4.5e-1 0.187 1.9e-1 24 Click to see details
GSE21032 Prostate cancer -0.003 4.9e-1 0.014 4.5e-1 83 Click to see details
GSE26953 Aortic valvular endothelial cells 0.001 5.0e-1 0.028 4.5e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.001 5.0e-1 0.028 4.5e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.374 0 -0.352 0 84 Click to see details
HNSC 0.412 0 0.470 0 42 Click to see details
PAAD 0.901 0.05 1.000 0.5 4 Click to see details
STAD 0.27 0.07 0.214 0.12 32 Click to see details
KIRC 0.181 0.07 0.177 0.07 68 Click to see details
BLCA 0.355 0.07 0.511 0.02 18 Click to see details
THCA -0.166 0.1 -0.189 0.08 59 Click to see details
PRAD 0.176 0.11 0.151 0.15 50 Click to see details
CHOL -0.407 0.14 -0.667 0.02 9 Click to see details
KIRP 0.17 0.18 0.070 0.35 32 Click to see details
KICH -0.162 0.22 -0.244 0.12 25 Click to see details
PCPG -0.766 0.22 -1.000 0.5 3 Click to see details
LUAD 0.24 0.23 0.042 0.45 12 Click to see details
COAD 0.259 0.27 0.214 0.31 8 Click to see details
UCEC 0.109 0.33 0.165 0.25 19 Click to see details
CESC 0.396 0.37 0.500 0.33 3 Click to see details
ESCA 0.076 0.41 0.036 0.46 11 Click to see details
LIHC 0.026 0.43 0.010 0.47 49 Click to see details
LUSC 0.016 0.46 -0.016 0.46 38 Click to see details
LUSC 0.016 0.46 -0.016 0.46 38 Click to see details
LUSC 0.016 0.46 -0.016 0.46 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*