miRTarBase - #MIRT473872 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAFK   
Synonyms NFE2U, P18
Description MAF bZIP transcription factor K
Transcript NM_002360   
Expression
Putative miRNA Targets on MAFK
3'UTR of MAFK
(miRNA target sites are highlighted)
>MAFK|NM_002360|3'UTR
   1 TGCCGGCCGGGGGCGGGGGGTGGCGGGCGGCGGGCGGCGGGCAGGCGGGTGGGGGCACACCCCTCGTACCTGTCACTGGG
  81 ATGCAGACTCTCGACATCCGAGTCCAAGCGCAGGCCCCTCGGGCGCAGGCAGCTCACACCAGGAAGAGACTGTATTGCAG
 161 GGTGAAGAGTGGGCTCCCGTGGGCCCAGAGCTGCACGCCGGTCCACAGACACACTCACGCCCGCCACCTGCTCCCCGCAG
 241 GATGTGTCTGTGTGTGGGAATTGGTATCTTGCACCCGTGGGAGTCGGGACATATAATGGAAAGGCCCTCGGGAAGTTCCG
 321 CGTCCTCTGTGGGGGCTGCCGGAAGACACGGCCCCAGGAGTCAGGCCCCTGTGGTCAGGTCTAGCATGGGGCTTGTTTTC
 401 CACTCCTGCTGTAAGCAGCCTTCGACACCTGTCCTGCCACGGCCTCCCAGCCGGTGCGGGAGCCCCTCACTGCCCTGACC
 481 GACTCCGCAGTCCCCGGGGAGGAGCATGGATGGTGTGTCGGCAGCTCCGTCCTTCCAGCTGTCCCGTTGCAGTGCCCGTG
 561 ATCCGCGTCTGCCTTAGCAGGGGCCTGCGTGAGTGGGCACGGTGTGGGAGGTCGCCTGCGTGGGGTGGTGTCTGTGTGTG
 641 TGCACGCACGCCTGCCATCAAAGCAGCAGGGCTGAGGGGGTGCAGCTTGCTGGTGTTCACTGGGGGAGGGCCTGTGGGCA
 721 CACATGGCAGAGAGAGTGGCTCACACGTCGTGAGGTCTCCCCTGTGCTCTGGTGACCCGAGGAGGTCGTGCAGCACAGCG
 801 CAGAAGCCCCTGCCCACGGGATCCGGCCCCCCAGACACCGACCCCACAGGCCGTCCCGGATCTCAGCGGACACAGGCAGG
 881 AGCGCCCCATCATTTGACGGTGAGCAGGACTCAGGCTGTGTGTCCTGGAGCTACTTCTCACCAACTGTGGTCAGTGCAGG
 961 GGGAACGAGGAGGTCTTTTGGGGGCCTGGCGAGGGGAAGGGCTGCTGCAGTCTAGGGAGAGGGGGTGCAGCCTGGGGGAT
1041 GTTGGTGGACATGGATGTGGAGGTGGAAGGAGGAGGACGTTGCGTGGAGTGGTGGGAGGAGGCGGGAGCCGTGTGCGAGA
1121 GCAGGTGGAAAGCCTTGAGGGGCAGGACCAGGATGCAGCTGGCTTGTAGAAGAGCTCAGGAGTGAGCCTGGCACTCCAGA
1201 GGGCGCGGCGGGTGGGGAGGCAGCAGGCACCAGTCCAGGAGAGCTTCGTGGACGTGGCTCCTGCGCGCACACCCCCAGGA
1281 GCACAGCCACGGGCTGCAGGTGTGGCTGGCCTCAGCACTCAGTCCTCACCCGGAGCCTTTGCCTGCTCCTCCTTCCAAGA
1361 GCACTGAGGCACCAGTGGGCTTGGCACTCCACCTTGGGCTTCCTTTTCCTGGAGAGCCGCCTTGAGGGTCCCTCCTGTGA
1441 CTGGGGTCTCTGCAGCGAGAGCCGCGGGGGTTGCGGAGCCCCTGCCTGGGGGAGCTGGCGGAATGTGAGCCGCCGGCCGG
1521 GGGCCGCCACATAAGACCTGCAAGGTGGTGCCTGGGGCCCTGGCTCCTTCTCGGCTGCCCCTGCCCACCCAGTAACAGCC
1601 CCCACCAGCTACAGAGCCCAGGCGGGTGCCAGCCACGCTGGGAGGGCAGAGGACAGACAGCCCCGGGGCTGCGACTTGGT
1681 TCTGTGTCTACTGTTAGAAGTTGAGTGGGAAGCTGCAGGCCCGCCAGGACCACTGGGTCCCTACAGAGCAAAGGCCTGCG
1761 TGTTCCCAAACAGCCGTTGCCCCCGTGGCCGTGGTAGGTAATCCATATTGGATGTCATAAGGACCAGGGGGATATTTAAA
1841 GAGAGAAACAGAAAATATATAGAGATATAAAATTATATTCACAGTTTATCTACAGATTTTTCGTAACAATCTTTCTTTTC
1921 CAGTTTGATACTGTAAATCTATCAGAGCAGAGCCGGGGGCACGGGCACAGGTGGGAGTTGGGAGCAAAGCGGAGGCCCGG
2001 GCTGCCCGCCGTCCCCCTTCATCTCCCCACGGACTGTACCAGGCAGCTGGGCCCCGCAGGACAGGCCGCAGCGGGTGGCC
2081 GGTTCTGTCCCGTCTTGGGGTTCTTGGTGTCCACGTCTTGTGGGCCGTGGGCTTCTACCTGCCCTTGGCCTGCAGTGCTT
2161 TGCTGGAGAAGGGACTCCCTGGTCCCCAGGGTGGACGGAGCCGCTGTCACCGCCCAGAGCTGGGCCGGGGAAGCACGGTG
2241 TGTTCTGCTTTTCTTTTCAGATTGTTGAAATTTCATTGTCATGATTTAATATATGGATTTTTTTATTTAAGAAAAAGACG
2321 AGGGACTCTTTGTCACGTGGGTTTGTTTTCTGTCTCCGTGCCTCCGGCTTCCCAAAGAGATCCAGGTCTTTGCGTTTCCA
2401 GGGCGTGGGGACCCCGGCCCCCTATGCCGCCACGCCGCCACACCGCCTCACCCTGGCTTCTGTGCTACTTGGCAGTTCCA
2481 TTTCATTATTTATTTTTTGTGCTGCTTTTTATCATGATATAAATTATTGAAAACAGATCACATGTGGGCCCGTGTCTGGC
2561 CGCCGCCGCCCTGCCCCGTCCCTGCGGCCACCACCTAATTTATTGCCGTGCGTCCTGCTGCTGTGACTGCTTTTGTACCT
2641 TTGCAATAAAGAATTTTCTGGTTTCAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC----AGUGUGAGGu 5'
            ::||||| ||    | :|||||| 
Target 5' gaGGCACCAGTGGGCTTGGCACTCCa 3'
1366 - 1391 146.00 -20.80
2
miRNA  3' guuuguGGUAACAGUGUGAGgu 5'
                |||  | |||||||  
Target 5' gccggtCCACAGACACACTCac 3'
197 - 218 136.00 -13.50
3
miRNA  3' guuuGUGGUAAC----AGUGUGAGGu 5'
              ||  | ||    | :|||||| 
Target 5' agctCAGGAGTGAGCCTGGCACTCCa 3'
1173 - 1198 128.00 -17.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31524544 16 COSMIC
COSN30709439 56 COSMIC
COSN17470017 238 COSMIC
COSN20817893 332 COSMIC
COSN28741127 382 COSMIC
COSN31546202 424 COSMIC
COSN31543680 491 COSMIC
COSN28201137 564 COSMIC
COSN7657830 568 COSMIC
COSN21345078 594 COSMIC
COSN2212747 688 COSMIC
COSN31487720 724 COSMIC
COSN30161544 750 COSMIC
COSN31517332 780 COSMIC
COSN31487595 885 COSMIC
COSN14775205 911 COSMIC
COSN28725504 926 COSMIC
COSN31611024 956 COSMIC
COSN28733334 968 COSMIC
COSN15662542 976 COSMIC
COSN26637469 1026 COSMIC
COSN26641404 1064 COSMIC
COSN8516162 1096 COSMIC
COSN26575162 1114 COSMIC
COSN25069227 1180 COSMIC
COSN15226314 1261 COSMIC
COSN32057063 1527 COSMIC
COSN19722630 1532 COSMIC
COSN31588186 1792 COSMIC
COSN31567911 1855 COSMIC
COSN31589991 1934 COSMIC
COSN30173075 1940 COSMIC
COSN31579447 2041 COSMIC
COSN9980298 2171 COSMIC
COSN24830696 2320 COSMIC
COSN31588646 2378 COSMIC
COSN32063592 2417 COSMIC
COSN19343226 2472 COSMIC
COSN5652953 2489 COSMIC
COSN24301975 2492 COSMIC
COSN26637470 2566 COSMIC
COSN31543374 2566 COSMIC
COSN18723737 2568 COSMIC
COSN27045118 2608 COSMIC
COSN26640038 2636 COSMIC
rs3735656 911 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766450561 4 dbSNP
rs753620957 5 dbSNP
rs559668774 6 dbSNP
rs1230145609 7 dbSNP
rs764971305 9 dbSNP
rs372751056 10 dbSNP
rs777974954 11 dbSNP
rs1202087490 12 dbSNP
rs757896570 13 dbSNP
rs1160642108 15 dbSNP
rs374770359 15 dbSNP
rs746555332 16 dbSNP
rs1427687440 17 dbSNP
rs747183610 18 dbSNP
rs771233474 18 dbSNP
rs781671062 20 dbSNP
rs1210565892 22 dbSNP
rs1485295138 22 dbSNP
rs574234247 22 dbSNP
rs879087043 22 dbSNP
rs1460509492 24 dbSNP
rs746216163 25 dbSNP
rs770208378 26 dbSNP
rs1406641464 29 dbSNP
rs994750779 30 dbSNP
rs1447786075 31 dbSNP
rs775748199 32 dbSNP
rs1244989884 33 dbSNP
rs749520912 33 dbSNP
rs1400297614 36 dbSNP
rs1478561415 36 dbSNP
rs1279681949 37 dbSNP
rs1427530602 39 dbSNP
rs181353243 40 dbSNP
rs1459555976 42 dbSNP
rs1262451278 44 dbSNP
rs774255082 47 dbSNP
rs1265478473 48 dbSNP
rs1357704233 49 dbSNP
rs896227952 51 dbSNP
rs1388415762 55 dbSNP
rs1298543569 61 dbSNP
rs1364772099 61 dbSNP
rs1437383965 64 dbSNP
rs1380589418 66 dbSNP
rs999999344 67 dbSNP
rs1166482855 75 dbSNP
rs1334427445 83 dbSNP
rs1390431652 85 dbSNP
rs1031520827 89 dbSNP
rs1241985069 92 dbSNP
rs913380196 93 dbSNP
rs955970547 94 dbSNP
rs992627815 96 dbSNP
rs1350557185 99 dbSNP
rs916901386 100 dbSNP
rs1230226715 101 dbSNP
rs1248275322 103 dbSNP
rs1286351157 105 dbSNP
rs1342537301 105 dbSNP
rs1349753634 109 dbSNP
rs969658598 110 dbSNP
rs979746472 111 dbSNP
rs1283649585 112 dbSNP
rs1043270054 113 dbSNP
rs920818434 115 dbSNP
rs1014423795 118 dbSNP
rs1280997073 121 dbSNP
rs926183203 122 dbSNP
rs1371491012 123 dbSNP
rs548138375 125 dbSNP
rs1422347026 126 dbSNP
rs1163302798 127 dbSNP
rs908063160 131 dbSNP
rs1362005438 137 dbSNP
rs1180913555 138 dbSNP
rs1253684083 141 dbSNP
rs1483298457 141 dbSNP
rs944779627 142 dbSNP
rs1489911183 144 dbSNP
rs1289374631 147 dbSNP
rs1252713047 157 dbSNP
rs924720311 169 dbSNP
rs1358491735 170 dbSNP
rs1040502039 175 dbSNP
rs900583881 179 dbSNP
rs931933600 180 dbSNP
rs1043757859 188 dbSNP
rs1351550468 189 dbSNP
rs904415640 195 dbSNP
rs1000144443 197 dbSNP
rs562117228 198 dbSNP
rs530882473 200 dbSNP
rs1014509619 201 dbSNP
rs897642304 204 dbSNP
rs1382132965 206 dbSNP
rs1024024228 212 dbSNP
rs369744704 213 dbSNP
rs1478579912 214 dbSNP
rs994781052 214 dbSNP
rs551070921 215 dbSNP
rs979715375 219 dbSNP
rs373141825 220 dbSNP
rs186206516 222 dbSNP
rs1282229304 223 dbSNP
rs749068603 223 dbSNP
rs983754184 224 dbSNP
rs1411109042 230 dbSNP
rs953248996 235 dbSNP
rs1306134178 236 dbSNP
rs570128063 237 dbSNP
rs944853456 238 dbSNP
rs965522660 239 dbSNP
rs1342971788 241 dbSNP
rs977226864 243 dbSNP
rs1457270312 247 dbSNP
rs760949840 248 dbSNP
rs1174111829 249 dbSNP
rs976661895 254 dbSNP
rs1425608583 255 dbSNP
rs921979884 256 dbSNP
rs763611457 257 dbSNP
rs1192058891 259 dbSNP
rs1479116965 263 dbSNP
rs932070929 265 dbSNP
rs1275592032 267 dbSNP
rs1043726765 268 dbSNP
rs903891250 271 dbSNP
rs935916185 273 dbSNP
rs1270579920 275 dbSNP
rs967968417 276 dbSNP
rs1053004460 277 dbSNP
rs891717407 278 dbSNP
rs376127098 281 dbSNP
rs751432485 286 dbSNP
rs552496312 287 dbSNP
rs926214197 292 dbSNP
rs1201632914 294 dbSNP
rs905603183 295 dbSNP
rs1477889206 298 dbSNP
rs1001266863 307 dbSNP
rs1172685769 308 dbSNP
rs1334697425 309 dbSNP
rs1027267961 310 dbSNP
rs757252936 311 dbSNP
rs983525123 312 dbSNP
rs1395122620 313 dbSNP
rs1168121624 315 dbSNP
rs1036506192 316 dbSNP
rs780953176 317 dbSNP
rs1249964494 318 dbSNP
rs897551832 319 dbSNP
rs1325407277 320 dbSNP
rs966706676 322 dbSNP
rs1329182737 323 dbSNP
rs1048893347 325 dbSNP
rs778601930 325 dbSNP
rs1228681301 328 dbSNP
rs1343755409 329 dbSNP
rs1007472872 331 dbSNP
rs1298647959 331 dbSNP
rs1379846617 332 dbSNP
rs1018302795 333 dbSNP
rs901150916 341 dbSNP
rs566019667 342 dbSNP
rs998173162 343 dbSNP
rs1392142903 344 dbSNP
rs1162803191 346 dbSNP
rs1250888795 347 dbSNP
rs922117445 348 dbSNP
rs1415171473 349 dbSNP
rs1212195754 350 dbSNP
rs1482318698 351 dbSNP
rs534923263 352 dbSNP
rs1251530451 370 dbSNP
rs554218271 372 dbSNP
rs1483817167 373 dbSNP
rs1468339665 379 dbSNP
rs755890707 380 dbSNP
rs747766733 381 dbSNP
rs574393322 384 dbSNP
rs1451001938 386 dbSNP
rs1186271708 387 dbSNP
rs958982236 388 dbSNP
rs979553696 393 dbSNP
rs925363700 396 dbSNP
rs992139084 402 dbSNP
rs1411385716 407 dbSNP
rs1372665410 408 dbSNP
rs1291943984 410 dbSNP
rs916947757 411 dbSNP
rs779145453 414 dbSNP
rs935314452 416 dbSNP
rs1052877452 424 dbSNP
rs138698752 425 dbSNP
rs1023588854 428 dbSNP
rs1388437735 429 dbSNP
rs1208804847 430 dbSNP
rs191905624 432 dbSNP
rs577021246 434 dbSNP
rs1048957319 435 dbSNP
rs888936381 441 dbSNP
rs950034052 442 dbSNP
rs1045530359 444 dbSNP
rs546031038 447 dbSNP
rs943288640 449 dbSNP
rs905738182 453 dbSNP
rs1001235830 454 dbSNP
rs369405233 458 dbSNP
rs887533047 459 dbSNP
rs1020243727 463 dbSNP
rs903317145 467 dbSNP
rs1004523056 469 dbSNP
rs1455677929 471 dbSNP
rs1015021557 472 dbSNP
rs1033170030 473 dbSNP
rs1160486175 475 dbSNP
rs966300999 481 dbSNP
rs772691050 482 dbSNP
rs1376267444 487 dbSNP
rs573154061 493 dbSNP
rs1268968124 494 dbSNP
rs1186149206 496 dbSNP
rs542140638 497 dbSNP
rs991651480 500 dbSNP
rs1209889651 502 dbSNP
rs1210506566 504 dbSNP
rs1024993543 505 dbSNP
rs971640913 508 dbSNP
rs561900730 520 dbSNP
rs1184456390 521 dbSNP
rs1305845337 529 dbSNP
rs530968333 530 dbSNP
rs10714927 533 dbSNP
rs1364467689 533 dbSNP
rs979604454 534 dbSNP
rs1188941792 542 dbSNP
rs1384395221 546 dbSNP
rs1466829022 547 dbSNP
rs925329090 547 dbSNP
rs930407076 549 dbSNP
rs1166254377 550 dbSNP
rs984518289 555 dbSNP
rs910279199 556 dbSNP
rs544356830 558 dbSNP
rs988142823 559 dbSNP
rs1390615337 563 dbSNP
rs943209662 565 dbSNP
rs917941981 566 dbSNP
rs923182858 567 dbSNP
rs949988480 574 dbSNP
rs142847928 579 dbSNP
rs1341603023 586 dbSNP
rs532335843 586 dbSNP
rs1403136434 588 dbSNP
rs114852016 589 dbSNP
rs565881423 590 dbSNP
rs770257652 593 dbSNP
rs903179485 594 dbSNP
rs1334019511 600 dbSNP
rs1000260687 601 dbSNP
rs528364464 602 dbSNP
rs1229587267 614 dbSNP
rs548477386 615 dbSNP
rs1367837539 616 dbSNP
rs1290728331 620 dbSNP
rs567943352 621 dbSNP
rs1048894473 624 dbSNP
rs1013511189 633 dbSNP
rs1215469576 633 dbSNP
rs778061674 633 dbSNP
rs887510575 635 dbSNP
rs1259787893 642 dbSNP
rs1483339626 645 dbSNP
rs537098686 646 dbSNP
rs1036014279 647 dbSNP
rs1197638343 648 dbSNP
rs901546873 650 dbSNP
rs993749534 651 dbSNP
rs1389473293 655 dbSNP
rs1485042142 656 dbSNP
rs1246145158 657 dbSNP
rs1026007427 666 dbSNP
rs12671303 670 dbSNP
rs879826662 671 dbSNP
rs1286817785 675 dbSNP
rs1409558254 676 dbSNP
rs1370811084 677 dbSNP
rs1330409750 681 dbSNP
rs556773911 686 dbSNP
rs1389386366 692 dbSNP
rs1029216037 700 dbSNP
rs1182873473 701 dbSNP
rs1414035836 705 dbSNP
rs1476127367 710 dbSNP
rs1409607131 711 dbSNP
rs1181209580 713 dbSNP
rs146094890 714 dbSNP
rs1158025230 715 dbSNP
rs1252817718 719 dbSNP
rs1206884318 721 dbSNP
rs1377971424 722 dbSNP
rs747502968 726 dbSNP
rs1301283306 729 dbSNP
rs1211003577 736 dbSNP
rs528358447 746 dbSNP
rs1410460484 747 dbSNP
rs1228180633 748 dbSNP
rs1310419551 750 dbSNP
rs766422603 751 dbSNP
rs1330056652 756 dbSNP
rs1001013017 757 dbSNP
rs1323677302 758 dbSNP
rs771612234 767 dbSNP
rs796302928 768 dbSNP
rs1032537741 775 dbSNP
rs577929484 779 dbSNP
rs964452780 780 dbSNP
rs976358869 788 dbSNP
rs923123481 789 dbSNP
rs1314305413 790 dbSNP
rs537523946 793 dbSNP
rs1194363397 797 dbSNP
rs1024971526 800 dbSNP
rs971095235 801 dbSNP
rs1208650733 802 dbSNP
rs980745441 804 dbSNP
rs1205206827 806 dbSNP
rs1253898552 809 dbSNP
rs1479587264 813 dbSNP
rs927181865 816 dbSNP
rs925178821 818 dbSNP
rs754134167 819 dbSNP
rs1434677010 820 dbSNP
rs140001708 825 dbSNP
rs1275012719 826 dbSNP
rs979008690 830 dbSNP
rs894568924 832 dbSNP
rs1430521548 833 dbSNP
rs909066501 836 dbSNP
rs1013002551 837 dbSNP
rs1170513835 838 dbSNP
rs1346786947 840 dbSNP
rs1336070262 841 dbSNP
rs1046347367 845 dbSNP
rs907349214 846 dbSNP
rs1424739714 850 dbSNP
rs940443150 852 dbSNP
rs994046011 853 dbSNP
rs776029527 854 dbSNP
rs901602019 857 dbSNP
rs373339790 858 dbSNP
rs573118960 859 dbSNP
rs1208475556 861 dbSNP
rs1050106961 868 dbSNP
rs117730393 869 dbSNP
rs1300807457 874 dbSNP
rs1339515777 876 dbSNP
rs1296184494 878 dbSNP
rs1001148255 884 dbSNP
rs376966808 885 dbSNP
rs1300951209 886 dbSNP
rs556052802 887 dbSNP
rs567840641 888 dbSNP
rs1447022221 890 dbSNP
rs764481404 892 dbSNP
rs1305257085 893 dbSNP
rs116976138 894 dbSNP
rs1265901520 895 dbSNP
rs970848146 899 dbSNP
rs748568283 901 dbSNP
rs1489344306 902 dbSNP
rs1429134738 903 dbSNP
rs1422271319 904 dbSNP
rs1191475234 909 dbSNP
rs3735656 911 dbSNP
rs1033664792 913 dbSNP
rs1258628639 915 dbSNP
rs1190719203 918 dbSNP
rs564480799 931 dbSNP
rs966588526 932 dbSNP
rs1273405404 938 dbSNP
rs1204625514 940 dbSNP
rs1308680546 943 dbSNP
rs762518594 946 dbSNP
rs1417542258 954 dbSNP
rs1310570242 962 dbSNP
rs984705516 964 dbSNP
rs112812160 967 dbSNP
rs977868045 968 dbSNP
rs940486380 974 dbSNP
rs1407725984 975 dbSNP
rs1368960727 977 dbSNP
rs1307578063 980 dbSNP
rs971936851 981 dbSNP
rs922991414 985 dbSNP
rs1325587839 986 dbSNP
rs143615402 991 dbSNP
rs1435453841 992 dbSNP
rs1471782221 997 dbSNP
rs1050077008 1001 dbSNP
rs1359274271 1004 dbSNP
rs1177422919 1005 dbSNP
rs1213411639 1008 dbSNP
rs888820059 1026 dbSNP
rs559553950 1031 dbSNP
rs1220800903 1032 dbSNP
rs773910538 1033 dbSNP
rs1054405520 1035 dbSNP
rs892725095 1037 dbSNP
rs1349645580 1038 dbSNP
rs1010118134 1052 dbSNP
rs948839351 1053 dbSNP
rs1375667441 1054 dbSNP
rs1272362727 1055 dbSNP
rs528327413 1060 dbSNP
rs907250788 1062 dbSNP
rs1395874284 1065 dbSNP
rs548186949 1074 dbSNP
rs568385725 1076 dbSNP
rs1047887077 1078 dbSNP
rs1159450074 1079 dbSNP
rs150895606 1080 dbSNP
rs375933520 1084 dbSNP
rs1264783991 1096 dbSNP
rs1033632235 1097 dbSNP
rs888067818 1100 dbSNP
rs1254881857 1101 dbSNP
rs1164834254 1102 dbSNP
rs1389916620 1104 dbSNP
rs1328275790 1110 dbSNP
rs115035215 1112 dbSNP
rs1319888121 1113 dbSNP
rs761718659 1117 dbSNP
rs111601093 1118 dbSNP
rs997567565 1134 dbSNP
rs966830566 1140 dbSNP
rs1433503543 1145 dbSNP
rs977900490 1146 dbSNP
rs535212367 1150 dbSNP
rs1455628555 1151 dbSNP
rs957983673 1152 dbSNP
rs570135771 1155 dbSNP
rs1174905803 1157 dbSNP
rs183229226 1163 dbSNP
rs1231449004 1169 dbSNP
rs1396338780 1186 dbSNP
rs972291006 1193 dbSNP
rs923161157 1197 dbSNP
rs1464410758 1202 dbSNP
rs1262281625 1204 dbSNP
rs552685747 1205 dbSNP
rs1482115437 1206 dbSNP
rs985920111 1207 dbSNP
rs910308363 1208 dbSNP
rs936286082 1210 dbSNP
rs566701030 1211 dbSNP
rs928738762 1213 dbSNP
rs988778106 1214 dbSNP
rs370456550 1215 dbSNP
rs929373034 1217 dbSNP
rs911941007 1219 dbSNP
rs374061657 1221 dbSNP
rs887932291 1224 dbSNP
rs1211055713 1231 dbSNP
rs1376853051 1232 dbSNP
rs942284880 1235 dbSNP
rs945671929 1240 dbSNP
rs1484726684 1248 dbSNP
rs1195234885 1249 dbSNP
rs1187887862 1254 dbSNP
rs575853503 1255 dbSNP
rs767691957 1258 dbSNP
rs1157144784 1261 dbSNP
rs997201464 1262 dbSNP
rs1030374092 1265 dbSNP
rs538157453 1266 dbSNP
rs750499437 1267 dbSNP
rs1055100550 1268 dbSNP
rs888544434 1270 dbSNP
rs1376809153 1271 dbSNP
rs1305724344 1272 dbSNP
rs1356990311 1272 dbSNP
rs1408932330 1273 dbSNP
rs1005942291 1284 dbSNP
rs1169629427 1285 dbSNP
rs756311585 1289 dbSNP
rs1023558093 1291 dbSNP
rs971010799 1292 dbSNP
rs1312202850 1293 dbSNP
rs1259885621 1297 dbSNP
rs1350987871 1298 dbSNP
rs1180267753 1299 dbSNP
rs1197587087 1301 dbSNP
rs189233879 1301 dbSNP
rs1354889317 1303 dbSNP
rs1273040217 1306 dbSNP
rs962259352 1308 dbSNP
rs993464434 1311 dbSNP
rs1030169247 1312 dbSNP
rs928617814 1316 dbSNP
rs950805708 1323 dbSNP
rs954490024 1325 dbSNP
rs1286134663 1328 dbSNP
rs578080312 1332 dbSNP
rs377278610 1333 dbSNP
rs139402822 1338 dbSNP
rs1384521589 1345 dbSNP
rs560617133 1349 dbSNP
rs957827752 1355 dbSNP
rs989530270 1358 dbSNP
rs1165482308 1359 dbSNP
rs766092208 1365 dbSNP
rs913596378 1366 dbSNP
rs922213580 1369 dbSNP
rs933568597 1370 dbSNP
rs1469844136 1373 dbSNP
rs1233617060 1374 dbSNP
rs1184092895 1375 dbSNP
rs1051475922 1376 dbSNP
rs902176985 1379 dbSNP
rs111764525 1390 dbSNP
rs1345828965 1394 dbSNP
rs1210206577 1395 dbSNP
rs1350975998 1399 dbSNP
rs1280871554 1403 dbSNP
rs1230448360 1404 dbSNP
rs1046682942 1409 dbSNP
rs1326548302 1410 dbSNP
rs1253198444 1412 dbSNP
rs893520626 1414 dbSNP
rs538214080 1419 dbSNP
rs190852165 1420 dbSNP
rs1408989968 1422 dbSNP
rs1160507333 1428 dbSNP
rs764119857 1443 dbSNP
rs1394535349 1444 dbSNP
rs777974625 1447 dbSNP
rs1470246594 1448 dbSNP
rs970702676 1449 dbSNP
rs1215541025 1454 dbSNP
rs541970164 1458 dbSNP
rs561740066 1464 dbSNP
rs530805753 1466 dbSNP
rs1005665038 1467 dbSNP
rs1184691945 1472 dbSNP
rs983421909 1475 dbSNP
rs754873584 1476 dbSNP
rs963420240 1480 dbSNP
rs1346731893 1481 dbSNP
rs1326758782 1483 dbSNP
rs1320588784 1486 dbSNP
rs974980379 1493 dbSNP
rs922087401 1500 dbSNP
rs117548665 1501 dbSNP
rs1455602004 1505 dbSNP
rs10226620 1507 dbSNP
rs532794089 1508 dbSNP
rs182310645 1512 dbSNP
rs1233816114 1513 dbSNP
rs890389679 1515 dbSNP
rs935003823 1516 dbSNP
rs1341557039 1518 dbSNP
rs1280525977 1519 dbSNP
rs186576927 1520 dbSNP
rs1339438604 1522 dbSNP
rs893596249 1523 dbSNP
rs1215067173 1525 dbSNP
rs1017470300 1526 dbSNP
rs535206487 1532 dbSNP
rs1355078988 1536 dbSNP
rs1313645743 1538 dbSNP
rs958014495 1540 dbSNP
rs1436740610 1542 dbSNP
rs544988060 1545 dbSNP
rs747946345 1549 dbSNP
rs989279339 1551 dbSNP
rs1021036557 1557 dbSNP
rs906339638 1572 dbSNP
rs150069281 1573 dbSNP
rs569370389 1574 dbSNP
rs1257870511 1580 dbSNP
rs1189606795 1588 dbSNP
rs1479400148 1589 dbSNP
rs113587702 1599 dbSNP
rs928197319 1601 dbSNP
rs1309211302 1613 dbSNP
rs1271133893 1617 dbSNP
rs1232464436 1618 dbSNP
rs938289584 1624 dbSNP
rs1294202106 1625 dbSNP
rs1004889926 1628 dbSNP
rs1371401132 1631 dbSNP
rs1297699870 1637 dbSNP
rs1442944791 1639 dbSNP
rs990936134 1650 dbSNP
rs1163388726 1653 dbSNP
rs1461311864 1659 dbSNP
rs1418990649 1662 dbSNP
rs746504491 1664 dbSNP
rs1416962744 1666 dbSNP
rs910089612 1673 dbSNP
rs1405766380 1674 dbSNP
rs867292875 1677 dbSNP
rs558520116 1684 dbSNP
rs1481293764 1685 dbSNP
rs770381969 1688 dbSNP
rs1212982395 1693 dbSNP
rs975221227 1694 dbSNP
rs1236569214 1706 dbSNP
rs1315358671 1710 dbSNP
rs1306492437 1718 dbSNP
rs1224464386 1720 dbSNP
rs941442613 1723 dbSNP
rs1037081013 1724 dbSNP
rs1440790597 1727 dbSNP
rs1440530169 1729 dbSNP
rs1328381935 1732 dbSNP
rs1298592137 1736 dbSNP
rs1362874382 1737 dbSNP
rs897241968 1742 dbSNP
rs578054092 1744 dbSNP
rs534228297 1750 dbSNP
rs1192979976 1753 dbSNP
rs987620812 1760 dbSNP
rs776152453 1761 dbSNP
rs1270159906 1776 dbSNP
rs560256315 1777 dbSNP
rs1007508825 1783 dbSNP
rs574034027 1785 dbSNP
rs542779508 1786 dbSNP
rs1356009589 1787 dbSNP
rs145347546 1791 dbSNP
rs575384797 1792 dbSNP
rs368835704 1818 dbSNP
rs1020667353 1825 dbSNP
rs1261917592 1826 dbSNP
rs544081901 1830 dbSNP
rs966881315 1832 dbSNP
rs1190339045 1840 dbSNP
rs981725934 1846 dbSNP
rs1371980117 1848 dbSNP
rs1373204138 1850 dbSNP
rs191164663 1850 dbSNP
rs1172485417 1852 dbSNP
rs939191459 1858 dbSNP
rs1167005998 1860 dbSNP
rs138130049 1862 dbSNP
rs776496247 1862 dbSNP
rs1190933723 1869 dbSNP
rs959608750 1872 dbSNP
rs1427748422 1873 dbSNP
rs887065646 1876 dbSNP
rs991073532 1877 dbSNP
rs750094942 1878 dbSNP
rs1321473640 1887 dbSNP
rs371792473 1892 dbSNP
rs1016304880 1903 dbSNP
rs746378437 1904 dbSNP
rs941506209 1906 dbSNP
rs973326092 1910 dbSNP
rs1225831975 1911 dbSNP
rs1029496906 1914 dbSNP
rs918653801 1916 dbSNP
rs1296763211 1933 dbSNP
rs934086399 1937 dbSNP
rs371602175 1939 dbSNP
rs560858322 1942 dbSNP
rs1031119850 1945 dbSNP
rs1166139431 1955 dbSNP
rs1434873525 1955 dbSNP
rs747570386 1955 dbSNP
rs889825251 1956 dbSNP
rs1291959326 1960 dbSNP
rs142578618 1962 dbSNP
rs559895233 1963 dbSNP
rs1038928861 1964 dbSNP
rs1260971659 1974 dbSNP
rs1187489262 1979 dbSNP
rs893721219 1985 dbSNP
rs1258320121 1988 dbSNP
rs915469305 1991 dbSNP
rs144263130 1992 dbSNP
rs980430161 1999 dbSNP
rs1485705478 2000 dbSNP
rs1292341827 2002 dbSNP
rs1189999293 2005 dbSNP
rs147798572 2009 dbSNP
rs939113466 2011 dbSNP
rs902248149 2012 dbSNP
rs886929884 2024 dbSNP
rs941283785 2026 dbSNP
rs1003280890 2031 dbSNP
rs1416853730 2032 dbSNP
rs1164538189 2034 dbSNP
rs1475668966 2035 dbSNP
rs1370373437 2041 dbSNP
rs1234611219 2045 dbSNP
rs1034647763 2047 dbSNP
rs569416337 2048 dbSNP
rs958994283 2055 dbSNP
rs879650991 2056 dbSNP
rs1011877743 2057 dbSNP
rs796713524 2059 dbSNP
rs996580888 2067 dbSNP
rs1403069789 2068 dbSNP
rs367917142 2069 dbSNP
rs1028991082 2071 dbSNP
rs890568480 2073 dbSNP
rs762124325 2074 dbSNP
rs1335826404 2079 dbSNP
rs10276767 2081 dbSNP
rs918776611 2082 dbSNP
rs1309660308 2083 dbSNP
rs955431584 2090 dbSNP
rs1315503110 2091 dbSNP
rs986921318 2093 dbSNP
rs1259723154 2097 dbSNP
rs1347979791 2098 dbSNP
rs911312111 2108 dbSNP
rs956887391 2115 dbSNP
rs767757142 2116 dbSNP
rs942642757 2121 dbSNP
rs1011001483 2122 dbSNP
rs1252847607 2123 dbSNP
rs1255346579 2127 dbSNP
rs1054876565 2128 dbSNP
rs1485330840 2128 dbSNP
rs915145535 2131 dbSNP
rs1204154747 2136 dbSNP
rs946654878 2138 dbSNP
rs1310840590 2144 dbSNP
rs1231381511 2145 dbSNP
rs1370159103 2149 dbSNP
rs1042215603 2160 dbSNP
rs1482311682 2169 dbSNP
rs1438434051 2180 dbSNP
rs902394968 2184 dbSNP
rs1003336351 2185 dbSNP
rs1022978396 2188 dbSNP
rs11544235 2191 dbSNP
rs1316566292 2196 dbSNP
rs768347471 2197 dbSNP
rs1056109943 2198 dbSNP
rs894912680 2203 dbSNP
rs141094326 2204 dbSNP
rs1417066094 2209 dbSNP
rs1017034429 2212 dbSNP
rs962977949 2213 dbSNP
rs571930804 2215 dbSNP
rs534501089 2221 dbSNP
rs554183174 2227 dbSNP
rs761262669 2228 dbSNP
rs534494825 2231 dbSNP
rs1447250319 2234 dbSNP
rs1374898301 2236 dbSNP
rs184925068 2237 dbSNP
rs1208114751 2238 dbSNP
rs1300404969 2238 dbSNP
rs1346520955 2243 dbSNP
rs1038168667 2244 dbSNP
rs911279517 2260 dbSNP
rs1220855724 2261 dbSNP
rs932575345 2263 dbSNP
rs536735429 2264 dbSNP
rs1050884751 2269 dbSNP
rs1431110153 2276 dbSNP
rs766948264 2280 dbSNP
rs556411500 2284 dbSNP
rs890442865 2291 dbSNP
rs1236010041 2293 dbSNP
rs914591462 2294 dbSNP
rs1177483906 2296 dbSNP
rs1346512853 2298 dbSNP
rs1205200169 2315 dbSNP
rs143452198 2320 dbSNP
rs544041187 2321 dbSNP
rs1052485327 2325 dbSNP
rs1253374772 2327 dbSNP
rs892518020 2329 dbSNP
rs1485088756 2330 dbSNP
rs1011032680 2331 dbSNP
rs1022460054 2337 dbSNP
rs557539077 2338 dbSNP
rs1215005545 2340 dbSNP
rs1252864662 2341 dbSNP
rs1042661576 2351 dbSNP
rs970079019 2357 dbSNP
rs923869466 2358 dbSNP
rs939160175 2359 dbSNP
rs56780119 2363 dbSNP
rs894878128 2366 dbSNP
rs1490256802 2368 dbSNP
rs947822388 2369 dbSNP
rs1038031315 2373 dbSNP
rs982418089 2376 dbSNP
rs1163168245 2378 dbSNP
rs1474694783 2384 dbSNP
rs898192749 2386 dbSNP
rs1189644618 2387 dbSNP
rs993850692 2394 dbSNP
rs1026280960 2395 dbSNP
rs1479365011 2399 dbSNP
rs891397360 2405 dbSNP
rs540158147 2406 dbSNP
rs560057809 2410 dbSNP
rs1008375736 2413 dbSNP
rs974345240 2416 dbSNP
rs1271060332 2417 dbSNP
rs1018483897 2422 dbSNP
rs1051038467 2426 dbSNP
rs964116991 2429 dbSNP
rs527779220 2430 dbSNP
rs1448200324 2434 dbSNP
rs1324307896 2435 dbSNP
rs944716548 2435 dbSNP
rs1397102458 2436 dbSNP
rs766179267 2437 dbSNP
rs1427375652 2438 dbSNP
rs528913173 2442 dbSNP
rs1300786191 2443 dbSNP
rs1406578322 2444 dbSNP
rs1178662809 2445 dbSNP
rs1441499246 2446 dbSNP
rs542683052 2457 dbSNP
rs1044517 2458 dbSNP
rs542819255 2464 dbSNP
rs923838333 2465 dbSNP
rs1224025534 2476 dbSNP
rs758659499 2481 dbSNP
rs905343252 2486 dbSNP
rs1240881998 2493 dbSNP
rs1379781202 2494 dbSNP
rs1273657660 2503 dbSNP
rs1440719569 2515 dbSNP
rs1368708877 2518 dbSNP
rs991938330 2526 dbSNP
rs1002762172 2535 dbSNP
rs1212070180 2541 dbSNP
rs1451203631 2546 dbSNP
rs116258531 2551 dbSNP
rs551960123 2552 dbSNP
rs1038486256 2553 dbSNP
rs764374615 2562 dbSNP
rs1428483912 2563 dbSNP
rs751855463 2565 dbSNP
rs1420542916 2566 dbSNP
rs1046781992 2567 dbSNP
rs962480073 2568 dbSNP
rs147989683 2569 dbSNP
rs1278865975 2575 dbSNP
rs1028466448 2576 dbSNP
rs757357421 2578 dbSNP
rs527958861 2579 dbSNP
rs55961916 2583 dbSNP
rs548143137 2585 dbSNP
rs899961470 2586 dbSNP
rs1011757057 2587 dbSNP
rs1373060888 2588 dbSNP
rs1172424918 2589 dbSNP
rs781140274 2590 dbSNP
rs1044528 2591 dbSNP
rs1379233982 2591 dbSNP
rs1168081045 2592 dbSNP
rs1044529 2594 dbSNP
rs746381685 2596 dbSNP
rs977809490 2597 dbSNP
rs1489339630 2599 dbSNP
rs1035680221 2602 dbSNP
rs960602316 2608 dbSNP
rs532461313 2609 dbSNP
rs1044533 2612 dbSNP
rs556609445 2613 dbSNP
rs1317676761 2617 dbSNP
rs1043837120 2619 dbSNP
rs1353140433 2620 dbSNP
rs1332940308 2622 dbSNP
rs570011761 2623 dbSNP
rs11544234 2628 dbSNP
rs916499334 2631 dbSNP
rs938203533 2631 dbSNP
rs1404340858 2640 dbSNP
rs1240498518 2650 dbSNP
rs1485576512 2652 dbSNP
rs1189281815 2654 dbSNP
rs947845324 2656 dbSNP
rs1057028815 2657 dbSNP
rs3177192 2659 dbSNP
rs3180965 2668 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' ---------------CACUCCa 3'
1 - 7
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' ---------------CACUCCa 3'
1 - 7
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*