Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiRNA_195808006613.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 581

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 583

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 585

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_195808006613.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 954

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 969

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 970

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_195808006613.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 979

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_195808006613-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_195808006613-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_195808006613-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: Invalid argument supplied for foreach() in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1399

Warning: array_push() expects parameter 1 to be array, null given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1422

Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT469090 [miRNA, hsa-miR-15a-5p :: RNF168, target gene]
miRTarBase - #MIRT469090 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RNF168   
Synonyms hRNF168
Description ring finger protein 168
Transcript NM_152617   
Putative miRNA Targets on RNF168
3'UTR of RNF168
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30473443 4 COSMIC
COSN8488999 11 COSMIC
COSN30476780 13 COSMIC
COSN30491968 25 COSMIC
COSN30145643 63 COSMIC
COSN27208576 98 COSMIC
COSN28716652 157 COSMIC
COSN21941101 209 COSMIC
COSN27311175 527 COSMIC
COSN27253488 528 COSMIC
COSN9543423 903 COSMIC
COSN29397368 1075 COSMIC
COSN23930883 1163 COSMIC
COSN25022175 1195 COSMIC
COSN23438698 1733 COSMIC
COSN17037628 2387 COSMIC
COSN26315626 2414 COSMIC
COSN15700624 2569 COSMIC
COSN7600158 2588 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1437183389 3 dbSNP
rs953263152 12 dbSNP
rs1294795215 15 dbSNP
rs368549020 17 dbSNP
rs1228973962 21 dbSNP
rs147594250 23 dbSNP
rs201276057 26 dbSNP
rs758638798 36 dbSNP
rs1313693803 39 dbSNP
rs1429759170 40 dbSNP
rs1226284463 45 dbSNP
rs1374999137 49 dbSNP
rs774595245 50 dbSNP
rs766719778 51 dbSNP
rs1364358640 56 dbSNP
rs1214743097 59 dbSNP
rs1302103259 88 dbSNP
rs546134516 92 dbSNP
rs1345038392 94 dbSNP
rs116405320 100 dbSNP
rs1281651622 108 dbSNP
rs1047557729 111 dbSNP
rs1214053642 113 dbSNP
rs1466993589 115 dbSNP
rs1244107366 126 dbSNP
rs1254415694 130 dbSNP
rs1213942114 138 dbSNP
rs1393361924 138 dbSNP
rs1477187518 140 dbSNP
rs553453287 148 dbSNP
rs1455632780 149 dbSNP
rs1446126468 155 dbSNP
rs4916497 157 dbSNP
rs1225009705 169 dbSNP
rs770324353 178 dbSNP
rs145107078 179 dbSNP
rs1346706734 189 dbSNP
rs887676776 192 dbSNP
rs555824003 195 dbSNP
rs537689090 199 dbSNP
rs570309581 200 dbSNP
rs1045312502 205 dbSNP
rs1328109030 206 dbSNP
rs781363861 208 dbSNP
rs1350566357 213 dbSNP
rs755241675 217 dbSNP
rs558431368 225 dbSNP
rs1437445552 226 dbSNP
rs578135772 238 dbSNP
rs1286785092 246 dbSNP
rs1057184108 252 dbSNP
rs780249766 253 dbSNP
rs933533428 268 dbSNP
rs9869734 274 dbSNP
rs1194311231 279 dbSNP
rs1237588697 281 dbSNP
rs1385527331 283 dbSNP
rs1156678090 284 dbSNP
rs566088638 285 dbSNP
rs977354085 293 dbSNP
rs1163851500 294 dbSNP
rs988258669 296 dbSNP
rs758397245 306 dbSNP
rs914802066 312 dbSNP
rs925342924 318 dbSNP
rs1452276171 321 dbSNP
rs556707389 324 dbSNP
rs1351932710 326 dbSNP
rs1233017916 330 dbSNP
rs750398751 331 dbSNP
rs1194101928 335 dbSNP
rs765186929 340 dbSNP
rs980858834 341 dbSNP
rs757134336 342 dbSNP
rs1217251723 359 dbSNP
rs766561077 369 dbSNP
rs953596665 374 dbSNP
rs1186936049 375 dbSNP
rs1030504567 376 dbSNP
rs975866295 381 dbSNP
rs1165119850 383 dbSNP
rs1395213335 387 dbSNP
rs1287290009 391 dbSNP
rs547502788 392 dbSNP
rs1014614192 397 dbSNP
rs1346420055 398 dbSNP
rs1013596351 400 dbSNP
rs1005855160 401 dbSNP
rs1306039105 401 dbSNP
rs1220223007 419 dbSNP
rs887425135 421 dbSNP
rs1023574683 430 dbSNP
rs1269815969 431 dbSNP
rs1012573332 443 dbSNP
rs1197598243 451 dbSNP
rs896353415 455 dbSNP
rs766250494 456 dbSNP
rs1026263550 457 dbSNP
rs1483356462 459 dbSNP
rs545103289 469 dbSNP
rs9850946 481 dbSNP
rs187725453 484 dbSNP
rs903253124 486 dbSNP
rs760520268 487 dbSNP
rs538193844 494 dbSNP
rs1312413638 495 dbSNP
rs1007274148 498 dbSNP
rs1396540811 507 dbSNP
rs1434646351 509 dbSNP
rs1311534705 510 dbSNP
rs868805704 515 dbSNP
rs1377711300 516 dbSNP
rs888866126 519 dbSNP
rs1432781284 520 dbSNP
rs573947609 522 dbSNP
rs1377244736 523 dbSNP
rs1176495121 524 dbSNP
rs1270880620 525 dbSNP
rs1409179889 526 dbSNP
rs1416901130 527 dbSNP
rs1187910963 528 dbSNP
rs1051373554 529 dbSNP
rs1475424812 530 dbSNP
rs1200794138 531 dbSNP
rs1444955788 531 dbSNP
rs550297451 531 dbSNP
rs1256182058 539 dbSNP
rs1172392545 540 dbSNP
rs1390266696 540 dbSNP
rs1481835030 540 dbSNP
rs1397396522 542 dbSNP
rs1185254079 543 dbSNP
rs139164628 544 dbSNP
rs1283110744 545 dbSNP
rs1211209912 551 dbSNP
rs1307286274 554 dbSNP
rs1271075331 556 dbSNP
rs368097694 561 dbSNP
rs1438759731 562 dbSNP
rs936940128 562 dbSNP
rs150768389 564 dbSNP
rs1292715637 565 dbSNP
rs1259930619 567 dbSNP
rs1413066919 568 dbSNP
rs1206589327 571 dbSNP
rs1357235318 573 dbSNP
rs1303391995 574 dbSNP
rs1467671748 575 dbSNP
rs1441127425 580 dbSNP
rs1352561493 583 dbSNP
rs1252361715 584 dbSNP
rs1254284737 585 dbSNP
rs1198572388 586 dbSNP
rs1158936815 587 dbSNP
rs1172346844 588 dbSNP
rs925448054 589 dbSNP
rs1393988109 590 dbSNP
rs1416774406 591 dbSNP
rs1438911958 593 dbSNP
rs1328042550 597 dbSNP
rs1371734114 604 dbSNP
rs1162107276 605 dbSNP
rs1475918588 607 dbSNP
rs1258788329 610 dbSNP
rs1182961732 611 dbSNP
rs1480624008 612 dbSNP
rs1231525192 613 dbSNP
rs1207113748 615 dbSNP
rs1318842671 617 dbSNP
rs1272813517 618 dbSNP
rs1231489917 619 dbSNP
rs1337048381 620 dbSNP
rs1313272986 621 dbSNP
rs1390739069 622 dbSNP
rs1167292128 623 dbSNP
rs1177198558 623 dbSNP
rs1183375968 623 dbSNP
rs1203177692 623 dbSNP
rs1206413498 623 dbSNP
rs1231090482 623 dbSNP
rs1248991179 623 dbSNP
rs1249058090 623 dbSNP
rs1288788372 623 dbSNP
rs1294734434 623 dbSNP
rs1297581107 623 dbSNP
rs1308503245 623 dbSNP
rs1316079264 623 dbSNP
rs1321834092 623 dbSNP
rs1352233467 623 dbSNP
rs1354517425 623 dbSNP
rs1411532577 623 dbSNP
rs1417541223 623 dbSNP
rs1421297664 623 dbSNP
rs1460075460 623 dbSNP
rs1461542484 623 dbSNP
rs1481923076 623 dbSNP
rs1488490540 623 dbSNP
rs57647149 623 dbSNP
rs796761799 623 dbSNP
rs1184938606 624 dbSNP
rs1213441219 624 dbSNP
rs1213582477 624 dbSNP
rs1229857336 624 dbSNP
rs1238363471 624 dbSNP
rs1275184965 624 dbSNP
rs1280236654 624 dbSNP
rs1292829234 624 dbSNP
rs1304274883 624 dbSNP
rs1308688176 624 dbSNP
rs1412700041 624 dbSNP
rs1484919517 624 dbSNP
rs1485683675 624 dbSNP
rs1421763133 625 dbSNP
rs1450156236 625 dbSNP
rs201038544 625 dbSNP
rs1169222333 626 dbSNP
rs555350071 632 dbSNP
rs527948020 634 dbSNP
rs1299643178 639 dbSNP
rs560814402 646 dbSNP
rs59487085 647 dbSNP
rs574085803 649 dbSNP
rs57716900 656 dbSNP
rs202151046 662 dbSNP
rs1346372433 665 dbSNP
rs372998729 666 dbSNP
rs576644427 667 dbSNP
rs111444359 668 dbSNP
rs1418973414 669 dbSNP
rs533967931 670 dbSNP
rs1213995170 672 dbSNP
rs1406487334 674 dbSNP
rs1465435682 687 dbSNP
rs1193107312 691 dbSNP
rs1251171732 692 dbSNP
rs573089844 699 dbSNP
rs1192791773 705 dbSNP
rs554842490 706 dbSNP
rs981355460 707 dbSNP
rs535900902 708 dbSNP
rs141974763 709 dbSNP
rs9872866 715 dbSNP
rs1397484471 719 dbSNP
rs951382422 722 dbSNP
rs1315001312 728 dbSNP
rs112208042 729 dbSNP
rs183926583 730 dbSNP
rs149584580 731 dbSNP
rs1270357036 744 dbSNP
rs1330116535 746 dbSNP
rs1213221726 762 dbSNP
rs1301043939 763 dbSNP
rs951784274 767 dbSNP
rs191646865 768 dbSNP
rs1453389111 772 dbSNP
rs963633325 773 dbSNP
rs560662517 774 dbSNP
rs548859100 775 dbSNP
rs1016057157 777 dbSNP
rs1247180962 780 dbSNP
rs1391088116 794 dbSNP
rs1287768458 795 dbSNP
rs1469481216 796 dbSNP
rs397957235 796 dbSNP
rs58900283 796 dbSNP
rs867918822 796 dbSNP
rs1324831353 798 dbSNP
rs1406600972 798 dbSNP
rs1007842061 802 dbSNP
rs1451011445 804 dbSNP
rs1343879277 807 dbSNP
rs71323727 808 dbSNP
rs1351420526 812 dbSNP
rs138295050 813 dbSNP
rs1291662477 829 dbSNP
rs1051486774 830 dbSNP
rs1185000782 833 dbSNP
rs1012172943 835 dbSNP
rs772141306 847 dbSNP
rs892109727 849 dbSNP
rs1202857327 867 dbSNP
rs1253725229 869 dbSNP
rs1394832407 875 dbSNP
rs11719920 886 dbSNP
rs1052546020 887 dbSNP
rs1163362844 888 dbSNP
rs1034834729 894 dbSNP
rs1418077769 895 dbSNP
rs763729040 903 dbSNP
rs999287658 904 dbSNP
rs1049831880 908 dbSNP
rs543925819 910 dbSNP
rs1041831366 914 dbSNP
rs111798974 915 dbSNP
rs1371630665 915 dbSNP
rs893173648 916 dbSNP
rs1217222670 917 dbSNP
rs774991646 919 dbSNP
rs917987530 920 dbSNP
rs992219407 924 dbSNP
rs1050825705 931 dbSNP
rs1347113305 937 dbSNP
rs564977429 942 dbSNP
rs1209867982 944 dbSNP
rs767101206 949 dbSNP
rs1331267508 950 dbSNP
rs918561620 954 dbSNP
rs932268174 956 dbSNP
rs1241071446 965 dbSNP
rs923486025 970 dbSNP
rs1447124658 974 dbSNP
rs1379986976 976 dbSNP
rs1178550702 977 dbSNP
rs1171077701 986 dbSNP
rs540095717 990 dbSNP
rs976316707 994 dbSNP
rs1434590722 996 dbSNP
rs940861495 1006 dbSNP
rs572993531 1018 dbSNP
rs1396842773 1021 dbSNP
rs984589094 1040 dbSNP
rs951852513 1047 dbSNP
rs916250594 1057 dbSNP
rs554573791 1061 dbSNP
rs1299802829 1062 dbSNP
rs1172145254 1064 dbSNP
rs181151313 1066 dbSNP
rs1233384482 1068 dbSNP
rs1378387347 1075 dbSNP
rs1346842106 1076 dbSNP
rs1283079941 1082 dbSNP
rs1192781390 1088 dbSNP
rs1463198271 1089 dbSNP
rs1189965623 1091 dbSNP
rs116149898 1098 dbSNP
rs1034931000 1099 dbSNP
rs556567237 1100 dbSNP
rs369578454 1101 dbSNP
rs538219679 1102 dbSNP
rs570888493 1110 dbSNP
rs1194561863 1113 dbSNP
rs1458977311 1116 dbSNP
rs1321339148 1118 dbSNP
rs1030627973 1126 dbSNP
rs1299095907 1130 dbSNP
rs1022542455 1140 dbSNP
rs1233672846 1141 dbSNP
rs1000979412 1146 dbSNP
rs552628229 1149 dbSNP
rs1045758040 1150 dbSNP
rs868658752 1157 dbSNP
rs534173850 1160 dbSNP
rs1201898990 1162 dbSNP
rs1278849956 1163 dbSNP
rs567007195 1165 dbSNP
rs1434171304 1167 dbSNP
rs548608215 1168 dbSNP
rs1410169315 1170 dbSNP
rs1473701357 1176 dbSNP
rs1355762766 1177 dbSNP
rs893173202 1181 dbSNP
rs1160158398 1182 dbSNP
rs1050460461 1185 dbSNP
rs1393921199 1186 dbSNP
rs1056653694 1190 dbSNP
rs1291762998 1197 dbSNP
rs930006151 1199 dbSNP
rs1387238664 1201 dbSNP
rs1306028977 1206 dbSNP
rs996205216 1206 dbSNP
rs1250364645 1207 dbSNP
rs1229912037 1211 dbSNP
rs901825655 1213 dbSNP
rs1288585768 1216 dbSNP
rs1333571427 1227 dbSNP
rs879112465 1231 dbSNP
rs918703973 1232 dbSNP
rs974091270 1241 dbSNP
rs1040686358 1245 dbSNP
rs1195667347 1246 dbSNP
rs940914034 1248 dbSNP
rs1250132481 1254 dbSNP
rs1484236262 1255 dbSNP
rs1183210829 1260 dbSNP
rs530302163 1261 dbSNP
rs1263866949 1262 dbSNP
rs1422233896 1270 dbSNP
rs112385327 1271 dbSNP
rs1369065060 1274 dbSNP
rs190194728 1276 dbSNP
rs1307324783 1277 dbSNP
rs1368550502 1278 dbSNP
rs1411396301 1287 dbSNP
rs1308312135 1291 dbSNP
rs185822211 1301 dbSNP
rs1393893703 1302 dbSNP
rs1049654982 1304 dbSNP
rs564879913 1314 dbSNP
rs1321776282 1316 dbSNP
rs1030090156 1327 dbSNP
rs1311630978 1329 dbSNP
rs1273067020 1331 dbSNP
rs1398107982 1333 dbSNP
rs1344816253 1341 dbSNP
rs1403335126 1346 dbSNP
rs180876617 1347 dbSNP
rs1460657339 1356 dbSNP
rs1482401591 1357 dbSNP
rs572964717 1361 dbSNP
rs1257021734 1371 dbSNP
rs1427992170 1375 dbSNP
rs1167929910 1382 dbSNP
rs1171403064 1383 dbSNP
rs1474924345 1389 dbSNP
rs1255270664 1390 dbSNP
rs1189561726 1403 dbSNP
rs1388225826 1406 dbSNP
rs916287966 1409 dbSNP
rs990573370 1412 dbSNP
rs112580347 1413 dbSNP
rs1193923389 1416 dbSNP
rs1458803237 1420 dbSNP
rs1258314920 1433 dbSNP
rs1232112453 1437 dbSNP
rs866434173 1439 dbSNP
rs1332063810 1440 dbSNP
rs950527128 1441 dbSNP
rs1294702833 1442 dbSNP
rs1368009785 1447 dbSNP
rs1247590247 1452 dbSNP
rs1341661522 1457 dbSNP
rs1310795102 1468 dbSNP
rs1212594548 1473 dbSNP
rs1031202840 1478 dbSNP
rs960386336 1478 dbSNP
rs927632822 1479 dbSNP
rs1485613419 1480 dbSNP
rs1328588410 1481 dbSNP
rs978014712 1484 dbSNP
rs1189074725 1487 dbSNP
rs1424280210 1490 dbSNP
rs1412508825 1491 dbSNP
rs542963818 1496 dbSNP
rs1359401800 1498 dbSNP
rs1332336006 1508 dbSNP
rs113836578 1511 dbSNP
rs1402095541 1515 dbSNP
rs1317962611 1522 dbSNP
rs1460940485 1525 dbSNP
rs1415739415 1529 dbSNP
rs1022133201 1530 dbSNP
rs1011125068 1532 dbSNP
rs1473081537 1534 dbSNP
rs188451441 1538 dbSNP
rs1179322526 1540 dbSNP
rs34210753 1549 dbSNP
rs1029513336 1559 dbSNP
rs996258836 1568 dbSNP
rs1328789459 1583 dbSNP
rs901878038 1584 dbSNP
rs1040363611 1585 dbSNP
rs28625638 1586 dbSNP
rs1465395777 1588 dbSNP
rs903492785 1589 dbSNP
rs886665952 1590 dbSNP
rs1476970926 1601 dbSNP
rs1023312617 1605 dbSNP
rs1049243588 1609 dbSNP
rs544655104 1610 dbSNP
rs577164952 1615 dbSNP
rs1390290341 1620 dbSNP
rs1056643334 1629 dbSNP
rs1323538743 1632 dbSNP
rs1212661528 1634 dbSNP
rs1466892609 1635 dbSNP
rs182204830 1639 dbSNP
rs1439175780 1640 dbSNP
rs1294497320 1645 dbSNP
rs930161764 1646 dbSNP
rs1290408070 1649 dbSNP
rs897223935 1654 dbSNP
rs1227828229 1655 dbSNP
rs939098123 1658 dbSNP
rs1223598301 1660 dbSNP
rs879860356 1661 dbSNP
rs1357601405 1662 dbSNP
rs1179620633 1663 dbSNP
rs1279493898 1665 dbSNP
rs1472686928 1666 dbSNP
rs1162164607 1667 dbSNP
rs534257115 1669 dbSNP
rs1410905099 1674 dbSNP
rs1238379561 1682 dbSNP
rs1379603484 1683 dbSNP
rs927642723 1690 dbSNP
rs1038884094 1696 dbSNP
rs1370409793 1703 dbSNP
rs1408359854 1709 dbSNP
rs1310513186 1710 dbSNP
rs1440406119 1715 dbSNP
rs1348422075 1716 dbSNP
rs977691192 1719 dbSNP
rs1325590292 1733 dbSNP
rs1447485334 1737 dbSNP
rs945315715 1738 dbSNP
rs1384066433 1742 dbSNP
rs911185396 1750 dbSNP
rs1292403972 1767 dbSNP
rs1389392591 1780 dbSNP
rs1202778102 1781 dbSNP
rs146896171 1785 dbSNP
rs1438076313 1786 dbSNP
rs931861137 1795 dbSNP
rs1235290687 1798 dbSNP
rs115585522 1807 dbSNP
rs1164404794 1812 dbSNP
rs1390120318 1825 dbSNP
rs1380651643 1830 dbSNP
rs1428312237 1831 dbSNP
rs1192851581 1838 dbSNP
rs1170913573 1840 dbSNP
rs954051755 1841 dbSNP
rs1371507895 1843 dbSNP
rs975882324 1847 dbSNP
rs956778288 1848 dbSNP
rs1028148566 1850 dbSNP
rs1452172949 1853 dbSNP
rs974830409 1857 dbSNP
rs536434943 1860 dbSNP
rs1448830577 1861 dbSNP
rs569250061 1862 dbSNP
rs1198871381 1876 dbSNP
rs63681561 1878 dbSNP
rs768382428 1878 dbSNP
rs781388537 1879 dbSNP
rs1339799357 1882 dbSNP
rs1199558208 1884 dbSNP
rs1284123160 1885 dbSNP
rs1018974326 1890 dbSNP
rs1004858631 1894 dbSNP
rs1443732918 1898 dbSNP
rs1183678824 1902 dbSNP
rs1246837531 1907 dbSNP
rs550859598 1912 dbSNP
rs967829594 1913 dbSNP
rs532016590 1926 dbSNP
rs1374034559 1930 dbSNP
rs1477903273 1931 dbSNP
rs1215057488 1939 dbSNP
rs1415186394 1941 dbSNP
rs1320008540 1943 dbSNP
rs1386478445 1944 dbSNP
rs377097455 1951 dbSNP
rs1356515695 1952 dbSNP
rs190093307 1958 dbSNP
rs1326871380 1961 dbSNP
rs1232283670 1965 dbSNP
rs1028346977 1971 dbSNP
rs995098031 1978 dbSNP
rs1272797473 1980 dbSNP
rs34837354 1983 dbSNP
rs1346725826 1987 dbSNP
rs895339532 2005 dbSNP
rs1266996080 2006 dbSNP
rs1463137759 2009 dbSNP
rs1365681630 2011 dbSNP
rs1211196135 2020 dbSNP
rs1055189179 2027 dbSNP
rs1433055174 2029 dbSNP
rs1437229026 2030 dbSNP
rs939109393 2031 dbSNP
rs906271207 2041 dbSNP
rs1296471678 2048 dbSNP
rs1421440567 2049 dbSNP
rs185099173 2051 dbSNP
rs528162595 2055 dbSNP
rs1172722699 2074 dbSNP
rs994318262 2077 dbSNP
rs945058741 2090 dbSNP
rs914907441 2094 dbSNP
rs1385592785 2098 dbSNP
rs1386108380 2114 dbSNP
rs989836701 2118 dbSNP
rs1321371336 2119 dbSNP
rs570493991 2122 dbSNP
rs1432636094 2124 dbSNP
rs1223792557 2126 dbSNP
rs1287319735 2127 dbSNP
rs932550616 2133 dbSNP
rs1426782879 2142 dbSNP
rs1191435449 2144 dbSNP
rs1474905374 2148 dbSNP
rs1260733365 2151 dbSNP
rs1239829300 2166 dbSNP
rs1195296777 2175 dbSNP
rs921100398 2191 dbSNP
rs1488457814 2194 dbSNP
rs1208523087 2196 dbSNP
rs897291116 2201 dbSNP
rs1490605850 2229 dbSNP
rs1181810374 2249 dbSNP
rs976558286 2252 dbSNP
rs867059523 2255 dbSNP
rs1159969730 2262 dbSNP
rs1367919510 2264 dbSNP
rs1038548933 2266 dbSNP
rs1006017184 2273 dbSNP
rs966130220 2295 dbSNP
rs560798206 2296 dbSNP
rs747317915 2301 dbSNP
rs1264545004 2304 dbSNP
rs879227844 2310 dbSNP
rs192214151 2313 dbSNP
rs983516818 2323 dbSNP
rs950817454 2324 dbSNP
rs1307117763 2329 dbSNP
rs878905744 2333 dbSNP
rs1027648918 2343 dbSNP
rs995506240 2345 dbSNP
rs1310838192 2353 dbSNP
rs1049714985 2357 dbSNP
rs1307111446 2359 dbSNP
rs934030027 2363 dbSNP
rs187007882 2364 dbSNP
rs895362848 2367 dbSNP
rs1040293666 2368 dbSNP
rs1339060276 2371 dbSNP
rs1360684057 2373 dbSNP
rs1276373675 2375 dbSNP
rs1033830040 2381 dbSNP
rs563617838 2386 dbSNP
rs1204904443 2391 dbSNP
rs1340980148 2395 dbSNP
rs935274905 2403 dbSNP
rs1003640902 2414 dbSNP
rs979289621 2418 dbSNP
rs906690329 2422 dbSNP
rs1360660837 2445 dbSNP
rs1042156650 2451 dbSNP
rs1009309015 2453 dbSNP
rs1425149542 2466 dbSNP
rs916368505 2477 dbSNP
rs990470953 2480 dbSNP
rs1463244405 2487 dbSNP
rs369946146 2491 dbSNP
rs1298360628 2494 dbSNP
rs1053416978 2502 dbSNP
rs758576848 2511 dbSNP
rs112769058 2512 dbSNP
rs79696328 2519 dbSNP
rs558876013 2524 dbSNP
rs1477863487 2526 dbSNP
rs540391343 2529 dbSNP
rs1438364042 2530 dbSNP
rs1272998421 2531 dbSNP
rs1187888220 2535 dbSNP
rs184128319 2540 dbSNP
rs908373177 2541 dbSNP
rs1255617426 2546 dbSNP
rs1482366611 2546 dbSNP
rs1482587985 2555 dbSNP
rs1239579039 2561 dbSNP
rs767999772 2561 dbSNP
rs1187823596 2564 dbSNP
rs1388131958 2579 dbSNP
rs141985772 2579 dbSNP
rs1170776968 2586 dbSNP
rs1358227603 2597 dbSNP
rs950798612 2600 dbSNP
rs375915758 2607 dbSNP
rs973407391 2618 dbSNP
rs1338163001 2624 dbSNP
rs1406149855 2629 dbSNP
rs562942201 2636 dbSNP
rs1296045019 2640 dbSNP
rs1364597375 2643 dbSNP
rs73213995 2644 dbSNP
rs1300939490 2646 dbSNP
rs1310698576 2647 dbSNP
rs1003745814 2655 dbSNP
rs1049832548 2659 dbSNP
rs544717206 2662 dbSNP
rs757187390 2672 dbSNP
rs1381331554 2673 dbSNP
rs1021043846 2674 dbSNP
rs753770069 2675 dbSNP
rs1009732939 2677 dbSNP
rs893531719 2678 dbSNP
rs1303196257 2679 dbSNP
rs1424150883 2685 dbSNP
rs1431146976 2686 dbSNP
rs73891247 2692 dbSNP
rs1456236794 2699 dbSNP
rs1317890631 2700 dbSNP
rs1347467667 2705 dbSNP
rs1397589429 2707 dbSNP
rs996554036 2710 dbSNP
rs1465641930 2719 dbSNP
rs1053055078 2720 dbSNP
rs899481671 2728 dbSNP
rs1162172495 2735 dbSNP
rs1422571776 2737 dbSNP
rs1041023615 2740 dbSNP
rs1226661307 2747 dbSNP
rs1286346175 2761 dbSNP
rs935204248 2764 dbSNP
rs1216388992 2773 dbSNP
rs902465792 2777 dbSNP
rs1487381830 2778 dbSNP
rs1201212099 2779 dbSNP
rs191121223 2781 dbSNP
rs1043940571 2788 dbSNP
rs943929810 2797 dbSNP
rs1156358439 2801 dbSNP
rs946599853 2804 dbSNP
rs1182739489 2808 dbSNP
rs1409471719 2820 dbSNP
rs1401845050 2823 dbSNP
rs1164653252 2858 dbSNP
rs1439507645 2858 dbSNP
rs1348570237 2859 dbSNP
rs1236531963 2864 dbSNP
rs916314661 2881 dbSNP
rs1304067496 2883 dbSNP
rs1458414752 2887 dbSNP
rs1408185326 2892 dbSNP
rs34151348 2900 dbSNP
rs1281399650 2901 dbSNP
rs187607381 2902 dbSNP
rs990544497 2903 dbSNP
rs1224339154 2906 dbSNP
rs755841621 2910 dbSNP
rs939095807 2917 dbSNP
rs1357119425 2926 dbSNP
rs1219538441 2933 dbSNP
rs1046856423 2934 dbSNP
rs1292180982 2939 dbSNP
rs1323370423 2945 dbSNP
rs927581359 2947 dbSNP
rs555610746 2956 dbSNP
rs920664223 2975 dbSNP
rs546600513 2979 dbSNP
rs1222951249 2983 dbSNP
rs758918109 2984 dbSNP
rs1164641492 2994 dbSNP
rs972430123 3017 dbSNP
rs1311241778 3022 dbSNP
rs961927912 3023 dbSNP
rs1331131580 3026 dbSNP
rs959402451 3030 dbSNP
rs1336495188 3036 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000318037.3 | 3UTR | AAUCUUCAUCCAUGUGUCAUUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.796 1.3e-5 0.863 4.9e-7 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.51 4.6e-3 -0.447 1.3e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.477 1.1e-2 0.460 1.4e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.388 1.4e-2 0.190 1.5e-1 32 Click to see details
GSE21032 Prostate cancer 0.236 1.6e-2 0.174 5.8e-2 83 Click to see details
GSE21849 B cell lymphoma 0.361 2.7e-2 0.241 1.0e-1 29 Click to see details
GSE28544 Breast cancer -0.331 5.7e-2 -0.770 5.4e-6 24 Click to see details
GSE19536 Breast cancer -0.125 1.1e-1 -0.107 1.4e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.147 1.2e-1 -0.160 1.0e-1 64 Click to see details
GSE17306 Multiple myeloma -0.134 1.8e-1 -0.183 1.0e-1 49 Click to see details
GSE28260 Renal cortex and medulla -0.272 1.8e-1 0.027 4.7e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.09 2.0e-1 0.142 9.1e-2 90 Click to see details
GSE19783 ER- ER- breast cancer -0.084 2.3e-1 -0.066 2.8e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.078 3.6e-1 0.181 1.9e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.084 3.8e-1 0.018 4.7e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.037 4.5e-1 -0.147 3.2e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.021 4.6e-1 0.047 4.1e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.013 4.8e-1 0.140 2.8e-1 20 Click to see details
GSE38226 Liver fibrosis -0.01 4.8e-1 -0.088 3.5e-1 21 Click to see details
GSE38226 Liver fibrosis -0.01 4.8e-1 -0.088 3.5e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.952 0.02 0.800 0.1 4 Click to see details
KIRP -0.328 0.03 -0.335 0.03 32 Click to see details
CHOL -0.631 0.03 -0.550 0.06 9 Click to see details
BLCA 0.38 0.06 0.509 0.02 18 Click to see details
THCA -0.176 0.09 -0.247 0.03 59 Click to see details
BRCA 0.109 0.16 0.158 0.08 84 Click to see details
LUAD 0.301 0.17 0.329 0.15 12 Click to see details
ESCA -0.301 0.18 -0.345 0.15 11 Click to see details
COAD 0.314 0.22 0.190 0.33 8 Click to see details
HNSC 0.118 0.23 0.182 0.12 42 Click to see details
CESC 0.705 0.25 0.500 0.33 3 Click to see details
KICH 0.12 0.28 0.116 0.29 25 Click to see details
LIHC 0.071 0.31 0.058 0.35 49 Click to see details
STAD -0.056 0.38 -0.061 0.37 32 Click to see details
KIRC 0.027 0.41 0.046 0.35 68 Click to see details
UCEC 0.028 0.45 -0.100 0.34 19 Click to see details
PCPG -0.141 0.45 -0.500 0.33 3 Click to see details
PRAD -0.007 0.48 -0.035 0.4 50 Click to see details
LUSC -0.008 0.48 0.058 0.36 38 Click to see details
LUSC -0.008 0.48 0.058 0.36 38 Click to see details
LUSC -0.008 0.48 0.058 0.36 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
Your e-Mail*