miRTarBase - #MIRT466008 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM189   
Synonyms KUA
Description transmembrane protein 189
Transcript NM_001162505   
Other Transcripts NM_199129   
Expression
Putative miRNA Targets on TMEM189
3'UTR of TMEM189
(miRNA target sites are highlighted)
>TMEM189|NM_001162505|3'UTR
   1 CTTCTCCGAGCCTGCTACCTGGTTGCCAACCTTCCCTAGCCCCCAAACCGAAGCCATCTGCCAAATTCCAGCCTCTTTGA
  81 GCTGGCCCCTCCAGATGGAGAGGACATCTCCTGGGCTGGGCCCAGGTACCCCAGCCCACCCCTCATGACACAGAATACTT
 161 GAGCCACTGATTTTTCATTTCTTTTTTTTTTTTTTCCTCGGCCCCTCCTCAGCCACCTGAGTTGCTCTATCTGCAAGCCT
 241 GACTCTGCCAGCCTCCCCTGGTAGAGAGGAGGTTTACCCACTCCCTGCACGCCTGCCGTCCCTGCCCCGCTGGGCAGCCC
 321 TTCAGTGTGGCTGGCGTTGGGGCCAGTGAGTTGCCTCTTTCCCTCCTTGTCTGGCCCCAGTGGTCTGGGGAGCCCCCAGG
 401 CACACCTAAGCGTCGTGGAGCATTGTTCTGCCACAGCCCTGCATACTGACCCCGGGAGGCTGGGCAGGTGGACAGCCCCA
 481 GCCACCACCTTCAGCCTAGCCTGTCCCCCAAGGATGGTGAAGCTCAGCAGGGGTCTGAGGGTAGCCGGCCAGAAGAGGCT
 561 GGAACCTCCTGCTCAAGTCTAGACCCCTACTTCTCTGCTGCCCCCACCCTGCCAGAGCTGATGTTTCCAATACCAAGATG
 641 TCTTCACAGGGCACAGCCCCTGCAGAGCATCTTGGTCATTTGGAAGAGGACACGGTATCCCCTCTGGCCAGAGTATGTCA
 721 GAGAAGGAAGAGTAGGGCTTTTTTGTTTTGTTTTTTTTTAAAGGTGCTTGCTTGTTTAATGTAAATAATAGAAAGCCTTA
 801 ATATCTTTTCTGTAACACGGAGTAATATTTTAATGTCATGTTTTGGATGTACATAATATATTTATAACAAAGCAGCAAGA
 881 GTCTACTTAACCTTGGCTGCCTCGTGGTGTTTCCTGGCTGGGTGGGGTGGGGGGTATCAAGGAGCCTGGGACGTGAGGCC
 961 CCACTCTCGCCCCATTCCCAGCTCCCCCCAACCCTGGCCTCAGGATGAGAGCTGTCACCTGAGACAGTGAATTAATGTTG
1041 ACATCTGCTCCAAAGCCTTTTGGAGGGGATTGGGTGAGGACAGTGGTCTTTCCTGTTGATCATGATGATAAAGTAATGAT
1121 GGCTGATCCCTATTTGTGACTTCCTTCAGCAAATATTCACTGGCACCTGGTGTGTGCCAGGCTCTGTCCTGTACACAGGT
1201 ACAGCGGTGAAAGAACCAACAAAGACCTATCCTGGTGGAGCTGACCTCCTGGGAAAAGAGTCAATAAACAAATAAATGCA
1281 CATGGAAATTCAGGTGGTGATTTGTGAAGAAAATCAAACAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGG---U-AAUACACGACGau 5'
            :|:|||   | || | ||||||  
Target 5' tcTAGACCCCTACTTCTCTGCTGCcc 3'
578 - 603 136.00 -11.10
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |::|::  |  | ||||| 
Target 5' aagAGGCTGGAACCTCCTGCTc 3'
553 - 574 115.00 -11.00
3
miRNA  3' guguuugguaaUACACG-ACGAu 5'
                     | |||| |||| 
Target 5' tttttttttaaAGGTGCTTGCTt 3'
751 - 773 115.00 -8.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31509828 7 COSMIC
COSN30183613 35 COSMIC
COSN30491650 41 COSMIC
COSN30508076 43 COSMIC
COSN30511146 50 COSMIC
COSN30456444 55 COSMIC
COSN30620891 57 COSMIC
COSN30148949 58 COSMIC
COSN30463798 91 COSMIC
COSN31605593 111 COSMIC
COSN26574664 114 COSMIC
COSN19321535 138 COSMIC
COSN31589009 148 COSMIC
COSN30146895 165 COSMIC
COSN27264034 181 COSMIC
COSN31599301 181 COSMIC
COSN18742974 182 COSMIC
COSN20047758 182 COSMIC
COSN21480204 330 COSMIC
COSN7095533 415 COSMIC
COSN9141747 507 COSMIC
COSN9141746 623 COSMIC
COSN31564526 707 COSMIC
COSN20116542 750 COSMIC
COSN26506798 760 COSMIC
COSN25669758 801 COSMIC
COSN31535053 805 COSMIC
COSN26583634 819 COSMIC
COSN26564448 837 COSMIC
COSN29160578 1513 COSMIC
COSN22558046 1556 COSMIC
COSN29410492 1591 COSMIC
COSN10017291 1756 COSMIC
COSN1875016 1775 COSMIC
COSN18766404 1790 COSMIC
COSN20892610 1853 COSMIC
COSN29342557 1925 COSMIC
COSN20889666 2595 COSMIC
COSN22189436 3395 COSMIC
COSN4970419 3920 COSMIC
COSN7095532 4037 COSMIC
COSN20985664 4105 COSMIC
COSN25447551 4266 COSMIC
COSN24155668 4360 COSMIC
COSN27703811 4902 COSMIC
COSN21031935 4971 COSMIC
COSN7095531 4975 COSMIC
COSN16807796 5055 COSMIC
COSN16555584 5233 COSMIC
COSN9141744 5370 COSMIC
COSN30055748 5854 COSMIC
COSN9141743 6408 COSMIC
COSN29119822 6430 COSMIC
COSN18918180 6471 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs147320578 1 dbSNP
rs781258735 4 dbSNP
rs1329636863 6 dbSNP
rs200935124 7 dbSNP
rs746792344 8 dbSNP
rs757456130 11 dbSNP
rs1275587019 16 dbSNP
rs1438714879 17 dbSNP
rs1329506982 21 dbSNP
rs754039658 29 dbSNP
rs375681783 34 dbSNP
rs765855555 40 dbSNP
rs756201026 41 dbSNP
rs752833813 43 dbSNP
rs767979413 46 dbSNP
rs751901988 49 dbSNP
rs117150702 50 dbSNP
rs878934642 62 dbSNP
rs935573885 63 dbSNP
rs775439033 72 dbSNP
rs372971405 78 dbSNP
rs1378235523 79 dbSNP
rs200095641 83 dbSNP
rs1321306892 89 dbSNP
rs1021687087 95 dbSNP
rs764846288 96 dbSNP
rs1225736491 97 dbSNP
rs139346170 102 dbSNP
rs1287882074 108 dbSNP
rs1406015517 112 dbSNP
rs576928224 130 dbSNP
rs1347952013 133 dbSNP
rs1270892491 136 dbSNP
rs1444198797 139 dbSNP
rs1188906528 140 dbSNP
rs910922138 142 dbSNP
rs1443196935 145 dbSNP
rs957926757 163 dbSNP
rs1457744234 181 dbSNP
rs983883563 182 dbSNP
rs952686506 183 dbSNP
rs1025461873 184 dbSNP
rs1393763651 186 dbSNP
rs972666739 190 dbSNP
rs376759377 195 dbSNP
rs1345015471 196 dbSNP
rs1366212377 196 dbSNP
rs1405213245 196 dbSNP
rs764210921 196 dbSNP
rs80063255 197 dbSNP
rs112331719 198 dbSNP
rs1003514171 199 dbSNP
rs1201065306 199 dbSNP
rs905281084 200 dbSNP
rs1460327204 204 dbSNP
rs1249018660 211 dbSNP
rs11698092 217 dbSNP
rs879072355 228 dbSNP
rs1210976734 229 dbSNP
rs1249105115 236 dbSNP
rs1031233963 237 dbSNP
rs1024180690 241 dbSNP
rs777046985 248 dbSNP
rs1192089636 251 dbSNP
rs1370956250 255 dbSNP
rs999482090 265 dbSNP
rs1478742999 267 dbSNP
rs1010985698 273 dbSNP
rs1172606921 273 dbSNP
rs764563832 276 dbSNP
rs893995568 277 dbSNP
rs1189444197 278 dbSNP
rs11555105 280 dbSNP
rs1381407372 281 dbSNP
rs761253337 282 dbSNP
rs1052535262 287 dbSNP
rs573185641 290 dbSNP
rs890373250 291 dbSNP
rs1051438182 298 dbSNP
rs188930736 308 dbSNP
rs995805314 309 dbSNP
rs1464762708 311 dbSNP
rs1203717180 320 dbSNP
rs1259260597 323 dbSNP
rs900269513 325 dbSNP
rs1198961895 327 dbSNP
rs1037483338 336 dbSNP
rs34417961 351 dbSNP
rs910880336 361 dbSNP
rs984305257 365 dbSNP
rs1299775852 369 dbSNP
rs554945105 374 dbSNP
rs1393151218 377 dbSNP
rs1387629007 378 dbSNP
rs1302764676 379 dbSNP
rs1343770737 385 dbSNP
rs1386752565 391 dbSNP
rs1411708380 407 dbSNP
rs931057547 408 dbSNP
rs1363074590 411 dbSNP
rs941755015 412 dbSNP
rs1267539420 414 dbSNP
rs759263359 415 dbSNP
rs6125909 423 dbSNP
rs1267709962 428 dbSNP
rs150797656 439 dbSNP
rs1157726498 444 dbSNP
rs980014838 453 dbSNP
rs772313211 454 dbSNP
rs928851654 459 dbSNP
rs1179568430 460 dbSNP
rs1023623657 469 dbSNP
rs1458198937 470 dbSNP
rs770601125 475 dbSNP
rs10268 478 dbSNP
rs970053707 501 dbSNP
rs1431732221 502 dbSNP
rs1011432490 512 dbSNP
rs1373255694 515 dbSNP
rs914545687 532 dbSNP
rs1315426371 533 dbSNP
rs745897509 545 dbSNP
rs1262084211 546 dbSNP
rs557802428 547 dbSNP
rs956316981 552 dbSNP
rs1247672791 559 dbSNP
rs1206683849 576 dbSNP
rs1251451160 584 dbSNP
rs901347506 585 dbSNP
rs1175457891 587 dbSNP
rs774765520 591 dbSNP
rs538744942 592 dbSNP
rs184947393 604 dbSNP
rs1383631818 606 dbSNP
rs1308616923 607 dbSNP
rs1030231408 617 dbSNP
rs1298125147 629 dbSNP
rs996080255 629 dbSNP
rs1460512064 634 dbSNP
rs771155674 647 dbSNP
rs1226693280 650 dbSNP
rs1048033615 652 dbSNP
rs931066655 656 dbSNP
rs1367785305 657 dbSNP
rs536779787 659 dbSNP
rs918303697 660 dbSNP
rs1452992088 665 dbSNP
rs1306455086 676 dbSNP
rs1016338851 688 dbSNP
rs1006002092 689 dbSNP
rs142195337 690 dbSNP
rs1461667960 693 dbSNP
rs938537195 694 dbSNP
rs886153866 703 dbSNP
rs1466079553 708 dbSNP
rs1189510981 713 dbSNP
rs980045544 715 dbSNP
rs1426850920 728 dbSNP
rs1300570797 732 dbSNP
rs969983363 739 dbSNP
rs1465432330 743 dbSNP
rs575709905 745 dbSNP
rs1373595371 755 dbSNP
rs916587591 755 dbSNP
rs1436238549 756 dbSNP
rs1212308423 760 dbSNP
rs140191444 760 dbSNP
rs989467999 760 dbSNP
rs775575190 763 dbSNP
rs1047888238 777 dbSNP
rs958371988 778 dbSNP
rs1323623296 785 dbSNP
rs1389375992 789 dbSNP
rs148693779 790 dbSNP
rs750943317 796 dbSNP
rs999557497 804 dbSNP
rs907477622 805 dbSNP
rs1254105837 810 dbSNP
rs1044658651 818 dbSNP
rs747962281 819 dbSNP
rs781028304 820 dbSNP
rs1481225191 827 dbSNP
rs1480137148 830 dbSNP
rs948967355 836 dbSNP
rs1174954337 847 dbSNP
rs965546106 877 dbSNP
rs1458115062 878 dbSNP
rs1019722322 879 dbSNP
rs1344243715 885 dbSNP
rs1341882028 892 dbSNP
rs1007570659 893 dbSNP
rs1345651789 897 dbSNP
rs754671534 903 dbSNP
rs74440508 904 dbSNP
rs554365738 909 dbSNP
rs1331075765 915 dbSNP
rs530798464 921 dbSNP
rs374411362 929 dbSNP
rs1224115719 930 dbSNP
rs896823906 931 dbSNP
rs1036817954 933 dbSNP
rs1254612721 935 dbSNP
rs1394977186 935 dbSNP
rs924653556 936 dbSNP
rs1406316047 938 dbSNP
rs1396637206 939 dbSNP
rs977940141 946 dbSNP
rs536005539 952 dbSNP
rs1030151006 953 dbSNP
rs1423481370 959 dbSNP
rs1300668049 964 dbSNP
rs928477767 967 dbSNP
rs1044214802 968 dbSNP
rs551556945 969 dbSNP
rs1473872102 971 dbSNP
rs1358921763 975 dbSNP
rs193205326 985 dbSNP
rs779916476 986 dbSNP
rs1366974023 987 dbSNP
rs990469716 988 dbSNP
rs757950225 989 dbSNP
rs1419725229 991 dbSNP
rs1006261187 994 dbSNP
rs1385492680 996 dbSNP
rs6063474 1003 dbSNP
rs1443698883 1016 dbSNP
rs1161265247 1024 dbSNP
rs1398068819 1025 dbSNP
rs370082606 1027 dbSNP
rs1328133709 1032 dbSNP
rs1483019229 1038 dbSNP
rs2664558 1050 dbSNP
rs1225213405 1056 dbSNP
rs1357976031 1057 dbSNP
rs1263283361 1061 dbSNP
rs1243670689 1062 dbSNP
rs1002563804 1066 dbSNP
rs1381762456 1070 dbSNP
rs907405806 1071 dbSNP
rs1335815770 1073 dbSNP
rs778601438 1074 dbSNP
rs949032600 1079 dbSNP
rs1289748870 1083 dbSNP
rs1214024180 1086 dbSNP
rs547240951 1095 dbSNP
rs1019752127 1098 dbSNP
rs1054466002 1099 dbSNP
rs753370407 1102 dbSNP
rs1242979341 1107 dbSNP
rs954442665 1108 dbSNP
rs1181410577 1117 dbSNP
rs868561456 1117 dbSNP
rs1162876908 1155 dbSNP
rs1454565479 1162 dbSNP
rs188754867 1166 dbSNP
rs232748 1167 dbSNP
rs1417302308 1168 dbSNP
rs6063473 1180 dbSNP
rs1337298805 1181 dbSNP
rs1405147405 1182 dbSNP
rs1450149104 1184 dbSNP
rs758998529 1185 dbSNP
rs1327199013 1196 dbSNP
rs373766200 1199 dbSNP
rs964660637 1205 dbSNP
rs143855797 1206 dbSNP
rs984486038 1208 dbSNP
rs370697841 1219 dbSNP
rs1347194892 1220 dbSNP
rs556917753 1221 dbSNP
rs368080839 1229 dbSNP
rs1450214849 1242 dbSNP
rs948541978 1251 dbSNP
rs1263424580 1258 dbSNP
rs1025919292 1259 dbSNP
rs150683247 1261 dbSNP
rs796952709 1261 dbSNP
rs1192020409 1269 dbSNP
rs1368311097 1269 dbSNP
rs1239921233 1278 dbSNP
rs1350948381 1282 dbSNP
rs374143589 1291 dbSNP
rs774923315 1300 dbSNP
rs1269428982 1306 dbSNP
rs1481120372 1320 dbSNP
rs892951475 1321 dbSNP
rs1226074916 1322 dbSNP
rs544737575 1326 dbSNP
rs184633516 1335 dbSNP
rs537930125 1336 dbSNP
rs774569392 1346 dbSNP
rs534866321 1349 dbSNP
rs771118218 1350 dbSNP
rs1013465149 1351 dbSNP
rs893409284 1354 dbSNP
rs567555199 1365 dbSNP
rs978032744 1368 dbSNP
rs1382936713 1371 dbSNP
rs1405586767 1376 dbSNP
rs555608517 1398 dbSNP
rs1344110127 1402 dbSNP
rs200358143 1408 dbSNP
rs1156979514 1414 dbSNP
rs1456743150 1416 dbSNP
rs1350393655 1417 dbSNP
rs1204234883 1419 dbSNP
rs1281661159 1421 dbSNP
rs999105650 1422 dbSNP
rs903222837 1441 dbSNP
rs954274256 1458 dbSNP
rs1268116669 1461 dbSNP
rs76645558 1465 dbSNP
rs934070009 1466 dbSNP
rs192245223 1470 dbSNP
rs1364211487 1476 dbSNP
rs961598654 1477 dbSNP
rs773265842 1491 dbSNP
rs1038885166 1497 dbSNP
rs551764216 1498 dbSNP
rs1002505841 1499 dbSNP
rs906955372 1504 dbSNP
rs373894142 1512 dbSNP
rs1393707028 1513 dbSNP
rs909032386 1515 dbSNP
rs1335589015 1516 dbSNP
rs1237287453 1518 dbSNP
rs1022746773 1525 dbSNP
rs1361084841 1528 dbSNP
rs1013068402 1532 dbSNP
rs1290492972 1537 dbSNP
rs533215109 1538 dbSNP
rs780004419 1540 dbSNP
rs550135809 1546 dbSNP
rs1251099904 1547 dbSNP
rs1418304955 1551 dbSNP
rs867085209 1555 dbSNP
rs1179324149 1556 dbSNP
rs1387316053 1558 dbSNP
rs1445537440 1559 dbSNP
rs918957757 1562 dbSNP
rs1463563797 1564 dbSNP
rs1299274710 1573 dbSNP
rs372009948 1580 dbSNP
rs981039919 1587 dbSNP
rs971123491 1588 dbSNP
rs771990633 1592 dbSNP
rs1342805879 1593 dbSNP
rs1383988445 1604 dbSNP
rs1273980457 1606 dbSNP
rs1013100759 1608 dbSNP
rs566177389 1610 dbSNP
rs1228907440 1621 dbSNP
rs188386215 1627 dbSNP
rs112558817 1633 dbSNP
rs999140543 1636 dbSNP
rs6512610 1637 dbSNP
rs764261968 1640 dbSNP
rs1051096881 1643 dbSNP
rs998163532 1646 dbSNP
rs912547529 1648 dbSNP
rs899927606 1649 dbSNP
rs1336250259 1655 dbSNP
rs1463973022 1657 dbSNP
rs149463450 1659 dbSNP
rs941434972 1664 dbSNP
rs909079414 1665 dbSNP
rs1373020825 1669 dbSNP
rs1169039718 1674 dbSNP
rs111808574 1678 dbSNP
rs530841820 1680 dbSNP
rs1407366583 1681 dbSNP
rs563474465 1699 dbSNP
rs756192712 1700 dbSNP
rs929233055 1705 dbSNP
rs1295746160 1708 dbSNP
rs752764101 1719 dbSNP
rs1237498437 1720 dbSNP
rs919137413 1723 dbSNP
rs1391366845 1729 dbSNP
rs372648112 1731 dbSNP
rs544985706 1732 dbSNP
rs1324027528 1740 dbSNP
rs1202753045 1747 dbSNP
rs7263257 1752 dbSNP
rs915567881 1759 dbSNP
rs1187314673 1763 dbSNP
rs182442472 1770 dbSNP
rs13043106 1771 dbSNP
rs1344018383 1774 dbSNP
rs1295215208 1775 dbSNP
rs922433199 1776 dbSNP
rs1469618585 1777 dbSNP
rs1383816290 1778 dbSNP
rs1174661378 1780 dbSNP
rs1285979365 1781 dbSNP
rs1347306982 1782 dbSNP
rs1015815321 1787 dbSNP
rs74479463 1788 dbSNP
rs1289055456 1790 dbSNP
rs1397533259 1790 dbSNP
rs35699141 1790 dbSNP
rs540416166 1790 dbSNP
rs796422245 1790 dbSNP
rs1222684788 1793 dbSNP
rs1276311291 1798 dbSNP
rs991673161 1801 dbSNP
rs1255321104 1814 dbSNP
rs957134190 1816 dbSNP
rs1289895883 1821 dbSNP
rs1216818870 1824 dbSNP
rs1260317579 1825 dbSNP
rs573869318 1837 dbSNP
rs1358707106 1841 dbSNP
rs1040851605 1845 dbSNP
rs1033602161 1858 dbSNP
rs1270255592 1859 dbSNP
rs971115678 1870 dbSNP
rs117573130 1871 dbSNP
rs1410673267 1884 dbSNP
rs537308190 1890 dbSNP
rs1420027818 1892 dbSNP
rs1029889995 1902 dbSNP
rs1199768647 1905 dbSNP
rs1159408268 1907 dbSNP
rs1344196153 1932 dbSNP
rs1432243788 1932 dbSNP
rs1417324200 1949 dbSNP
rs35497359 1951 dbSNP
rs1023035641 1961 dbSNP
rs1365642008 1973 dbSNP
rs1012685926 1985 dbSNP
rs1428655454 1988 dbSNP
rs1404327034 1994 dbSNP
rs998425428 1997 dbSNP
rs1414111455 2000 dbSNP
rs1183275467 2003 dbSNP
rs1224095920 2004 dbSNP
rs957318226 2016 dbSNP
rs1351714015 2018 dbSNP
rs1032851434 2022 dbSNP
rs1292682745 2024 dbSNP
rs1490198610 2030 dbSNP
rs998604712 2035 dbSNP
rs899853980 2043 dbSNP
rs1040304606 2056 dbSNP
rs1176916133 2056 dbSNP
rs569047308 2057 dbSNP
rs1437495181 2059 dbSNP
rs1165077026 2069 dbSNP
rs1385355903 2077 dbSNP
rs1423427036 2082 dbSNP
rs1182805879 2086 dbSNP
rs1321544936 2088 dbSNP
rs6122876 2089 dbSNP
rs1006084523 2090 dbSNP
rs1272140624 2095 dbSNP
rs1297452201 2097 dbSNP
rs1374381095 2100 dbSNP
rs888504847 2101 dbSNP
rs910616803 2108 dbSNP
rs932765636 2109 dbSNP
rs1275727387 2112 dbSNP
rs1438839514 2115 dbSNP
rs1204423270 2116 dbSNP
rs1236802266 2123 dbSNP
rs11416444 2124 dbSNP
rs1185099539 2124 dbSNP
rs1248493709 2124 dbSNP
rs1280982175 2124 dbSNP
rs397798905 2124 dbSNP
rs1410530982 2126 dbSNP
rs986604977 2127 dbSNP
rs1397910012 2131 dbSNP
rs1226878508 2135 dbSNP
rs1048884582 2141 dbSNP
rs919972730 2148 dbSNP
rs1337674944 2150 dbSNP
rs929118462 2160 dbSNP
rs1038550559 2163 dbSNP
rs558216435 2166 dbSNP
rs940211022 2174 dbSNP
rs1045656088 2178 dbSNP
rs1378527231 2181 dbSNP
rs539801937 2185 dbSNP
rs756553490 2186 dbSNP
rs1349207328 2187 dbSNP
rs991136102 2191 dbSNP
rs1307768305 2196 dbSNP
rs1405897407 2197 dbSNP
rs981713462 2204 dbSNP
rs1326127134 2209 dbSNP
rs972032200 2214 dbSNP
rs566091597 2218 dbSNP
rs935750227 2223 dbSNP
rs1403309654 2224 dbSNP
rs1441549569 2230 dbSNP
rs549558794 2233 dbSNP
rs535954298 2234 dbSNP
rs1159274997 2243 dbSNP
rs1192885435 2253 dbSNP
rs1473503460 2259 dbSNP
rs1249565723 2277 dbSNP
rs774132153 2279 dbSNP
rs1176814865 2280 dbSNP
rs1181430776 2289 dbSNP
rs1413046398 2299 dbSNP
rs1320495235 2303 dbSNP
rs568070829 2309 dbSNP
rs957145036 2318 dbSNP
rs1488678301 2319 dbSNP
rs1276887639 2325 dbSNP
rs1248311525 2333 dbSNP
rs1032760530 2334 dbSNP
rs967567024 2342 dbSNP
rs1029816764 2357 dbSNP
rs998552157 2359 dbSNP
rs567426480 2380 dbSNP
rs977039795 2383 dbSNP
rs768208577 2388 dbSNP
rs967215138 2397 dbSNP
rs1268803720 2399 dbSNP
rs1230342758 2402 dbSNP
rs964320977 2402 dbSNP
rs1018718000 2406 dbSNP
rs1215179836 2408 dbSNP
rs1288242307 2426 dbSNP
rs760108927 2428 dbSNP
rs527848409 2437 dbSNP
rs137990978 2440 dbSNP
rs560772200 2449 dbSNP
rs1385887965 2450 dbSNP
rs1419191760 2460 dbSNP
rs898494019 2470 dbSNP
rs1367529562 2478 dbSNP
rs1348963508 2482 dbSNP
rs1320591513 2483 dbSNP
rs1038498723 2486 dbSNP
rs1280932427 2496 dbSNP
rs372214740 2498 dbSNP
rs111496658 2499 dbSNP
rs1045541285 2509 dbSNP
rs55677905 2510 dbSNP
rs894351804 2517 dbSNP
rs1055883623 2522 dbSNP
rs1449681979 2524 dbSNP
rs1183628385 2525 dbSNP
rs1426941812 2526 dbSNP
rs540680215 2538 dbSNP
rs935649769 2546 dbSNP
rs925595819 2552 dbSNP
rs1157052226 2561 dbSNP
rs1041511975 2562 dbSNP
rs945775976 2563 dbSNP
rs1293494092 2564 dbSNP
rs925606082 2566 dbSNP
rs1393516067 2597 dbSNP
rs922799271 2599 dbSNP
rs976884840 2601 dbSNP
rs1488257506 2604 dbSNP
rs769874727 2613 dbSNP
rs1239026760 2614 dbSNP
rs190568294 2620 dbSNP
rs1360999817 2624 dbSNP
rs139195963 2630 dbSNP
rs1210872901 2632 dbSNP
rs984542330 2643 dbSNP
rs1197484241 2646 dbSNP
rs1251026942 2655 dbSNP
rs775250297 2658 dbSNP
rs543995594 2659 dbSNP
rs1457139927 2673 dbSNP
rs1233509492 2677 dbSNP
rs576591211 2680 dbSNP
rs771794354 2682 dbSNP
rs952773769 2688 dbSNP
rs377647749 2699 dbSNP
rs558393224 2707 dbSNP
rs1164102205 2710 dbSNP
rs953324309 2729 dbSNP
rs1464039025 2735 dbSNP
rs745806220 2741 dbSNP
rs1168966012 2748 dbSNP
rs1025583982 2749 dbSNP
rs1400087832 2751 dbSNP
rs539762795 2753 dbSNP
rs994253534 2762 dbSNP
rs994758359 2765 dbSNP
rs1384453626 2772 dbSNP
rs1396116925 2777 dbSNP
rs1311478381 2782 dbSNP
rs572421646 2795 dbSNP
rs578184369 2796 dbSNP
rs1317104317 2798 dbSNP
rs887156550 2800 dbSNP
rs1265248143 2804 dbSNP
rs1366423987 2805 dbSNP
rs537527536 2812 dbSNP
rs1254217883 2813 dbSNP
rs950300995 2814 dbSNP
rs1423480809 2815 dbSNP
rs1178955783 2825 dbSNP
rs1464395869 2825 dbSNP
rs554215809 2830 dbSNP
rs1287796583 2832 dbSNP
rs1055744208 2841 dbSNP
rs1376374389 2847 dbSNP
rs1383375324 2848 dbSNP
rs535890899 2851 dbSNP
rs1000502451 2854 dbSNP
rs1360861925 2866 dbSNP
rs925641793 2868 dbSNP
rs977030228 2869 dbSNP
rs904227862 2877 dbSNP
rs911602995 2889 dbSNP
rs187243312 2892 dbSNP
rs1217341527 2894 dbSNP
rs1263115819 2899 dbSNP
rs113921044 2909 dbSNP
rs922308829 2911 dbSNP
rs537234988 2912 dbSNP
rs748582393 2919 dbSNP
rs1432920854 2920 dbSNP
rs1447886570 2920 dbSNP
rs1247429426 2922 dbSNP
rs368637234 2923 dbSNP
rs150247533 2928 dbSNP
rs1454906469 2929 dbSNP
rs1298341794 2933 dbSNP
rs564755910 2945 dbSNP
rs769508469 2954 dbSNP
rs1210103838 2957 dbSNP
rs1343317050 2960 dbSNP
rs551625774 2963 dbSNP
rs1218386212 2972 dbSNP
rs1004176762 2974 dbSNP
rs1318895811 2977 dbSNP
rs984415386 2978 dbSNP
rs1241126906 2983 dbSNP
rs1230086094 2985 dbSNP
rs1362617172 2988 dbSNP
rs1294189628 2990 dbSNP
rs1487338111 2997 dbSNP
rs887102482 2998 dbSNP
rs1247762945 2999 dbSNP
rs1189783296 3002 dbSNP
rs1410606441 3005 dbSNP
rs1024841345 3006 dbSNP
rs952964564 3008 dbSNP
rs918623283 3009 dbSNP
rs781700835 3010 dbSNP
rs1304911574 3012 dbSNP
rs1370862020 3016 dbSNP
rs1055946360 3017 dbSNP
rs970803556 3020 dbSNP
rs1309158167 3021 dbSNP
rs1291626620 3023 dbSNP
rs1375249333 3024 dbSNP
rs1024984181 3031 dbSNP
rs1012730568 3035 dbSNP
rs1351646538 3037 dbSNP
rs1248185094 3041 dbSNP
rs1389816724 3042 dbSNP
rs1041368043 3060 dbSNP
rs945755949 3061 dbSNP
rs747786698 3067 dbSNP
rs958589169 3073 dbSNP
rs1034594816 3074 dbSNP
rs1178887654 3078 dbSNP
rs533061470 3091 dbSNP
rs1000149984 3103 dbSNP
rs904405925 3108 dbSNP
rs558883367 3116 dbSNP
rs1413865153 3129 dbSNP
rs1404757482 3132 dbSNP
rs921773916 3146 dbSNP
rs1009883772 3149 dbSNP
rs973227308 3151 dbSNP
rs183247956 3152 dbSNP
rs1374877065 3155 dbSNP
rs528905290 3170 dbSNP
rs1284926487 3173 dbSNP
rs116454852 3176 dbSNP
rs890002080 3179 dbSNP
rs1049034634 3180 dbSNP
rs931574984 3185 dbSNP
rs1198334457 3186 dbSNP
rs1257043662 3195 dbSNP
rs1024289673 3202 dbSNP
rs543190353 3203 dbSNP
rs1014774790 3210 dbSNP
rs755327133 3211 dbSNP
rs576548733 3213 dbSNP
rs1392685863 3220 dbSNP
rs1180079489 3221 dbSNP
rs1034941758 3231 dbSNP
rs1000283527 3233 dbSNP
rs918813676 3246 dbSNP
rs1203495735 3247 dbSNP
rs192506935 3253 dbSNP
rs1312734399 3255 dbSNP
rs546476858 3256 dbSNP
rs917891532 3257 dbSNP
rs572764713 3261 dbSNP
rs112416912 3267 dbSNP
rs535826000 3269 dbSNP
rs1034193957 3270 dbSNP
rs1218543475 3270 dbSNP
rs1326059485 3270 dbSNP
rs1341614961 3270 dbSNP
rs1201849149 3275 dbSNP
rs1278845562 3282 dbSNP
rs574775134 3289 dbSNP
rs968641365 3294 dbSNP
rs1414024138 3301 dbSNP
rs556586601 3306 dbSNP
rs1010145078 3309 dbSNP
rs187153533 3311 dbSNP
rs1421275805 3319 dbSNP
rs1478858220 3327 dbSNP
rs1407729871 3333 dbSNP
rs1395566818 3348 dbSNP
rs1173406444 3360 dbSNP
rs181031269 3369 dbSNP
rs1412848382 3374 dbSNP
rs907693491 3375 dbSNP
rs1459646963 3383 dbSNP
rs1366735396 3388 dbSNP
rs983389076 3395 dbSNP
rs1399970678 3402 dbSNP
rs1006677181 3405 dbSNP
rs190668143 3410 dbSNP
rs1048571737 3411 dbSNP
rs1333226427 3413 dbSNP
rs931450507 3414 dbSNP
rs992811058 3416 dbSNP
rs1343932056 3417 dbSNP
rs959048203 3420 dbSNP
rs1473184168 3425 dbSNP
rs1488319982 3429 dbSNP
rs1215837545 3440 dbSNP
rs1260881486 3442 dbSNP
rs1453116422 3444 dbSNP
rs766773307 3445 dbSNP
rs1254559531 3446 dbSNP
rs1160644263 3447 dbSNP
rs758544634 3459 dbSNP
rs1381050423 3469 dbSNP
rs949634394 3470 dbSNP
rs536495741 3474 dbSNP
rs1157392214 3475 dbSNP
rs1034478502 3486 dbSNP
rs1482927746 3489 dbSNP
rs539290939 3493 dbSNP
rs917957661 3497 dbSNP
rs1329680333 3500 dbSNP
rs565636909 3503 dbSNP
rs1000229490 3504 dbSNP
rs1310936217 3510 dbSNP
rs1353835149 3539 dbSNP
rs1268573112 3543 dbSNP
rs547319564 3544 dbSNP
rs1209991612 3547 dbSNP
rs1238705224 3547 dbSNP
rs528845943 3549 dbSNP
rs968887997 3557 dbSNP
rs938111440 3559 dbSNP
rs925336386 3567 dbSNP
rs1449630120 3568 dbSNP
rs1238951837 3569 dbSNP
rs1439182660 3573 dbSNP
rs1176918352 3574 dbSNP
rs1263109797 3577 dbSNP
rs1010456644 3578 dbSNP
rs978604634 3579 dbSNP
rs533494392 3580 dbSNP
rs890678110 3583 dbSNP
rs567982291 3591 dbSNP
rs1389054351 3592 dbSNP
rs770240161 3603 dbSNP
rs1332954450 3606 dbSNP
rs1377107085 3607 dbSNP
rs1445563133 3616 dbSNP
rs549797752 3618 dbSNP
rs750463698 3619 dbSNP
rs1341704214 3638 dbSNP
rs1020112219 3641 dbSNP
rs1323984969 3642 dbSNP
rs531313891 3648 dbSNP
rs1388886074 3650 dbSNP
rs1037481472 3654 dbSNP
rs1325533187 3655 dbSNP
rs1457818632 3662 dbSNP
rs1414360733 3666 dbSNP
rs1457540649 3671 dbSNP
rs988768894 3673 dbSNP
rs1196950382 3684 dbSNP
rs1424422615 3688 dbSNP
rs941741285 3691 dbSNP
rs1367162939 3694 dbSNP
rs965667597 3699 dbSNP
rs1047568705 3706 dbSNP
rs1470074693 3714 dbSNP
rs765551448 3718 dbSNP
rs1378509526 3720 dbSNP
rs1201488282 3726 dbSNP
rs1403743962 3727 dbSNP
rs1452931447 3731 dbSNP
rs6095772 3743 dbSNP
rs1311943801 3759 dbSNP
rs917805407 3762 dbSNP
rs889554856 3763 dbSNP
rs1212733527 3764 dbSNP
rs73910389 3768 dbSNP
rs1202722896 3786 dbSNP
rs937393230 3792 dbSNP
rs995197927 3803 dbSNP
rs1483623946 3811 dbSNP
rs1206678399 3814 dbSNP
rs1349901123 3815 dbSNP
rs897366682 3818 dbSNP
rs1037152539 3819 dbSNP
rs367894796 3824 dbSNP
rs527914633 3825 dbSNP
rs896690895 3833 dbSNP
rs1477017438 3837 dbSNP
rs978840512 3844 dbSNP
rs968750631 3846 dbSNP
rs1436182200 3847 dbSNP
rs1055151542 3852 dbSNP
rs1466220709 3860 dbSNP
rs1020417365 3861 dbSNP
rs1390837262 3863 dbSNP
rs937981082 3865 dbSNP
rs1400583326 3875 dbSNP
rs776763171 3881 dbSNP
rs767326945 3884 dbSNP
rs768023712 3895 dbSNP
rs1313056598 3896 dbSNP
rs560751853 3900 dbSNP
rs955042425 3920 dbSNP
rs117661848 3927 dbSNP
rs1355921009 3928 dbSNP
rs1394917523 3930 dbSNP
rs996816448 3934 dbSNP
rs900187305 3936 dbSNP
rs1449712398 3938 dbSNP
rs1268491009 3939 dbSNP
rs1433451793 3946 dbSNP
rs1249292415 3954 dbSNP
rs1190440402 3959 dbSNP
rs1392752913 3963 dbSNP
rs913104955 3966 dbSNP
rs1159188497 3982 dbSNP
rs1359759916 3988 dbSNP
rs1005987036 3994 dbSNP
rs1295134765 4002 dbSNP
rs1367998117 4007 dbSNP
rs1445957964 4017 dbSNP
rs1279220465 4024 dbSNP
rs575745129 4026 dbSNP
rs1301463967 4029 dbSNP
rs965328085 4031 dbSNP
rs1279351983 4038 dbSNP
rs1315733594 4063 dbSNP
rs1224389990 4077 dbSNP
rs58408829 4079 dbSNP
rs6012846 4081 dbSNP
rs1295443816 4082 dbSNP
rs896301876 4083 dbSNP
rs556286738 4088 dbSNP
rs1441020083 4091 dbSNP
rs148172089 4094 dbSNP
rs937908922 4095 dbSNP
rs117634790 4096 dbSNP
rs978698182 4119 dbSNP
rs1350275449 4122 dbSNP
rs1413331366 4125 dbSNP
rs953865875 4129 dbSNP
rs1026603275 4135 dbSNP
rs181111965 4140 dbSNP
rs1324137404 4159 dbSNP
rs1169649022 4161 dbSNP
rs913357994 4164 dbSNP
rs961076607 4167 dbSNP
rs1371248105 4168 dbSNP
rs558675645 4172 dbSNP
rs553924998 4173 dbSNP
rs1014147380 4177 dbSNP
rs1321505006 4184 dbSNP
rs1212151727 4185 dbSNP
rs1184461610 4190 dbSNP
rs1474788880 4195 dbSNP
rs1237620873 4198 dbSNP
rs56756656 4202 dbSNP
rs1055814051 4203 dbSNP
rs1256476665 4204 dbSNP
rs769373212 4205 dbSNP
rs1474765064 4206 dbSNP
rs1002442424 4213 dbSNP
rs975039279 4215 dbSNP
rs1402163175 4216 dbSNP
rs148547339 4216 dbSNP
rs903893233 4224 dbSNP
rs58346684 4225 dbSNP
rs945452698 4235 dbSNP
rs1271117976 4236 dbSNP
rs567405290 4244 dbSNP
rs1214263418 4245 dbSNP
rs1052961373 4248 dbSNP
rs886105939 4263 dbSNP
rs571498919 4264 dbSNP
rs912376560 4268 dbSNP
rs1271801470 4271 dbSNP
rs1435572026 4275 dbSNP
rs780951864 4277 dbSNP
rs1286033587 4284 dbSNP
rs985819518 4292 dbSNP
rs1446402058 4297 dbSNP
rs1355418625 4306 dbSNP
rs1185686229 4309 dbSNP
rs953977592 4310 dbSNP
rs919600372 4322 dbSNP
rs1478003118 4333 dbSNP
rs973670309 4334 dbSNP
rs1417570410 4335 dbSNP
rs1416372384 4336 dbSNP
rs189080655 4339 dbSNP
rs568005546 4340 dbSNP
rs1013740141 4342 dbSNP
rs755443331 4344 dbSNP
rs1413521999 4360 dbSNP
rs1167876944 4365 dbSNP
rs549500292 4376 dbSNP
rs1341551167 4378 dbSNP
rs115434991 4382 dbSNP
rs1269242608 4387 dbSNP
rs1337104708 4392 dbSNP
rs1413817512 4395 dbSNP
rs1164514022 4396 dbSNP
rs1278775242 4398 dbSNP
rs1346458701 4402 dbSNP
rs1002141251 4404 dbSNP
rs1015269210 4407 dbSNP
rs903740247 4412 dbSNP
rs1240142027 4422 dbSNP
rs570430649 4425 dbSNP
rs1417034776 4426 dbSNP
rs1043620777 4429 dbSNP
rs1361669070 4430 dbSNP
rs1400621733 4439 dbSNP
rs1316763768 4443 dbSNP
rs913222128 4444 dbSNP
rs114876645 4447 dbSNP
rs527852684 4448 dbSNP
rs923475730 4450 dbSNP
rs1483905596 4470 dbSNP
rs374365104 4481 dbSNP
rs1281941419 4486 dbSNP
rs1204010992 4490 dbSNP
rs1453064324 4491 dbSNP
rs1199886678 4492 dbSNP
rs747304289 4495 dbSNP
rs904072544 4496 dbSNP
rs1180651760 4497 dbSNP
rs1022310531 4498 dbSNP
rs780676481 4514 dbSNP
rs1231499906 4515 dbSNP
rs1157292062 4519 dbSNP
rs560688754 4532 dbSNP
rs985035952 4534 dbSNP
rs1406251368 4540 dbSNP
rs1334328318 4552 dbSNP
rs892456810 4553 dbSNP
rs1040503052 4558 dbSNP
rs944805829 4559 dbSNP
rs1438260409 4561 dbSNP
rs1200893741 4563 dbSNP
rs1238268460 4565 dbSNP
rs780249485 4566 dbSNP
rs542495297 4576 dbSNP
rs72366762 4576 dbSNP
rs1491353515 4577 dbSNP
rs11472820 4578 dbSNP
rs1277655275 4578 dbSNP
rs397688948 4578 dbSNP
rs758380617 4578 dbSNP
rs890985769 4580 dbSNP
rs1297982626 4585 dbSNP
rs200362752 4586 dbSNP
rs1025967328 4595 dbSNP
rs1440954869 4611 dbSNP
rs530336899 4622 dbSNP
rs960708694 4624 dbSNP
rs1049544941 4630 dbSNP
rs1033520050 4634 dbSNP
rs1370647167 4638 dbSNP
rs758817462 4640 dbSNP
rs1325159664 4641 dbSNP
rs868815399 4643 dbSNP
rs1416600262 4644 dbSNP
rs750880947 4657 dbSNP
rs1396627866 4661 dbSNP
rs939719188 4662 dbSNP
rs1326782692 4670 dbSNP
rs184706624 4677 dbSNP
rs1405447032 4683 dbSNP
rs1233818825 4687 dbSNP
rs992358062 4701 dbSNP
rs1332383545 4704 dbSNP
rs1229860421 4713 dbSNP
rs1009418273 4714 dbSNP
rs1220729523 4717 dbSNP
rs1252043415 4730 dbSNP
rs1480356913 4731 dbSNP
rs960480792 4745 dbSNP
rs1034272998 4753 dbSNP
rs1478257175 4755 dbSNP
rs202060526 4759 dbSNP
rs374801545 4760 dbSNP
rs59829432 4760 dbSNP
rs1187837081 4761 dbSNP
rs1478982639 4761 dbSNP
rs1461160057 4762 dbSNP
rs1053498510 4763 dbSNP
rs933426799 4763 dbSNP
rs1353337586 4764 dbSNP
rs980925973 4764 dbSNP
rs968310337 4767 dbSNP
rs1401554948 4771 dbSNP
rs1022527578 4779 dbSNP
rs1009801474 4786 dbSNP
rs143352560 4786 dbSNP
rs1225481238 4790 dbSNP
rs1307205263 4790 dbSNP
rs1348627324 4790 dbSNP
rs1350523987 4790 dbSNP
rs143148043 4790 dbSNP
rs1373622899 4792 dbSNP
rs923312188 4793 dbSNP
rs1289274371 4797 dbSNP
rs892507805 4798 dbSNP
rs752830682 4808 dbSNP
rs140545063 4810 dbSNP
rs1268858700 4812 dbSNP
rs1009402337 4813 dbSNP
rs1380771491 4815 dbSNP
rs1303630442 4840 dbSNP
rs1371818671 4844 dbSNP
rs1211066944 4848 dbSNP
rs1233582065 4853 dbSNP
rs1278263505 4865 dbSNP
rs889166112 4866 dbSNP
rs146812522 4868 dbSNP
rs932458272 4877 dbSNP
rs1485068904 4891 dbSNP
rs1184411605 4892 dbSNP
rs909369738 4901 dbSNP
rs898321139 4910 dbSNP
rs1038274459 4922 dbSNP
rs1392692973 4923 dbSNP
rs558614267 4925 dbSNP
rs908251942 4926 dbSNP
rs1220143050 4930 dbSNP
rs1370237743 4931 dbSNP
rs991805195 4932 dbSNP
rs1305152985 4933 dbSNP
rs866779057 4934 dbSNP
rs1438340366 4935 dbSNP
rs200909524 4943 dbSNP
rs1393010815 4947 dbSNP
rs1320655106 4956 dbSNP
rs1315521039 4958 dbSNP
rs1379176575 4958 dbSNP
rs3092037 4958 dbSNP
rs397839591 4958 dbSNP
rs1224315585 4959 dbSNP
rs1274196360 4966 dbSNP
rs1458703727 4968 dbSNP
rs1343331663 4969 dbSNP
rs1212661384 4971 dbSNP
rs143748867 4972 dbSNP
rs1414814102 4973 dbSNP
rs918944071 4985 dbSNP
rs75622140 4998 dbSNP
rs1417220565 5000 dbSNP
rs968228390 5004 dbSNP
rs1166911263 5005 dbSNP
rs1022467255 5009 dbSNP
rs553558433 5012 dbSNP
rs1324076998 5016 dbSNP
rs145545450 5020 dbSNP
rs6067358 5024 dbSNP
rs1019365417 5035 dbSNP
rs1442948733 5042 dbSNP
rs1190625422 5044 dbSNP
rs1371894896 5050 dbSNP
rs757283503 5060 dbSNP
rs1260624141 5061 dbSNP
rs1294344771 5064 dbSNP
rs953599620 5075 dbSNP
rs1232337034 5076 dbSNP
rs1211508605 5086 dbSNP
rs1439052891 5090 dbSNP
rs1009450805 5096 dbSNP
rs181686591 5103 dbSNP
rs190763399 5107 dbSNP
rs898373623 5110 dbSNP
rs1257991484 5113 dbSNP
rs1474734784 5125 dbSNP
rs574639540 5131 dbSNP
rs997966182 5145 dbSNP
rs751545729 5150 dbSNP
rs1169880805 5156 dbSNP
rs556447959 5161 dbSNP
rs1004094392 5164 dbSNP
rs1313979986 5165 dbSNP
rs759370204 5168 dbSNP
rs1049230714 5169 dbSNP
rs116280943 5184 dbSNP
rs939003626 5191 dbSNP
rs926270704 5192 dbSNP
rs1305205917 5200 dbSNP
rs939042849 5216 dbSNP
rs1280874949 5226 dbSNP
rs774014035 5227 dbSNP
rs1044857362 5229 dbSNP
rs1243603025 5236 dbSNP
rs766400045 5237 dbSNP
rs1417500371 5246 dbSNP
rs1176555952 5247 dbSNP
rs6067357 5260 dbSNP
rs1436591438 5261 dbSNP
rs915418226 5272 dbSNP
rs967740586 5273 dbSNP
rs1433393209 5277 dbSNP
rs1320734569 5288 dbSNP
rs762850928 5289 dbSNP
rs762813161 5290 dbSNP
rs1390981114 5297 dbSNP
rs956959551 5308 dbSNP
rs1170767226 5311 dbSNP
rs773135093 5328 dbSNP
rs988115497 5341 dbSNP
rs1235779562 5346 dbSNP
rs1280415280 5347 dbSNP
rs6020278 5357 dbSNP
rs1182882207 5368 dbSNP
rs1347111816 5371 dbSNP
rs987893778 5386 dbSNP
rs953428980 5395 dbSNP
rs956565837 5398 dbSNP
rs1030028990 5401 dbSNP
rs570477366 5413 dbSNP
rs1473056704 5419 dbSNP
rs998102596 5425 dbSNP
rs1029406715 5432 dbSNP
rs1394520226 5433 dbSNP
rs1017593391 5437 dbSNP
rs567771386 5442 dbSNP
rs1386170527 5443 dbSNP
rs963398268 5444 dbSNP
rs1400423100 5452 dbSNP
rs1317215387 5456 dbSNP
rs373462040 5462 dbSNP
rs1016728143 5464 dbSNP
rs1003979864 5465 dbSNP
rs1305193527 5475 dbSNP
rs1442610860 5477 dbSNP
rs1303571765 5493 dbSNP
rs552273141 5521 dbSNP
rs887040033 5533 dbSNP
rs1056415864 5535 dbSNP
rs1369552762 5541 dbSNP
rs1232033956 5549 dbSNP
rs1281149236 5553 dbSNP
rs149724151 5561 dbSNP
rs1223064743 5567 dbSNP
rs1049262837 5576 dbSNP
rs1024439696 5578 dbSNP
rs116082224 5580 dbSNP
rs1311032158 5590 dbSNP
rs897980281 5594 dbSNP
rs1252473591 5598 dbSNP
rs1413913800 5602 dbSNP
rs1370997187 5621 dbSNP
rs1467160072 5621 dbSNP
rs1300109730 5622 dbSNP
rs1184605784 5623 dbSNP
rs1247245397 5623 dbSNP
rs1364819738 5623 dbSNP
rs1420446698 5623 dbSNP
rs1470061897 5623 dbSNP
rs1491005743 5623 dbSNP
rs397719031 5623 dbSNP
rs556158758 5623 dbSNP
rs61641243 5623 dbSNP
rs1384511965 5624 dbSNP
rs1474184243 5627 dbSNP
rs1330299703 5630 dbSNP
rs185480315 5636 dbSNP
rs1441349543 5644 dbSNP
rs765116797 5648 dbSNP
rs1372514887 5650 dbSNP
rs1057141897 5653 dbSNP
rs946449939 5658 dbSNP
rs1426032302 5662 dbSNP
rs1416302555 5672 dbSNP
rs1332783662 5676 dbSNP
rs1187945189 5677 dbSNP
rs1483584989 5685 dbSNP
rs769461280 5689 dbSNP
rs914969337 5716 dbSNP
rs926291987 5717 dbSNP
rs1052616099 5721 dbSNP
rs761384841 5722 dbSNP
rs1250230043 5729 dbSNP
rs1475703105 5746 dbSNP
rs1244848753 5748 dbSNP
rs1416795490 5750 dbSNP
rs1456063346 5754 dbSNP
rs946470402 5757 dbSNP
rs1336366086 5761 dbSNP
rs1390768288 5762 dbSNP
rs549453593 5767 dbSNP
rs912028902 5780 dbSNP
rs1415106679 5782 dbSNP
rs1292434037 5783 dbSNP
rs537876782 5783 dbSNP
rs548792806 5785 dbSNP
rs1229857790 5792 dbSNP
rs1251989734 5795 dbSNP
rs987781066 5796 dbSNP
rs953750531 5797 dbSNP
rs139608262 5798 dbSNP
rs1283019930 5801 dbSNP
rs1486279449 5803 dbSNP
rs973338716 5812 dbSNP
rs1255816396 5814 dbSNP
rs6091098 5820 dbSNP
rs768417352 5822 dbSNP
rs1194810954 5824 dbSNP
rs983489873 5825 dbSNP
rs563020342 5828 dbSNP
rs1035255826 5838 dbSNP
rs1166655157 5843 dbSNP
rs1003467762 5849 dbSNP
rs905068042 5858 dbSNP
rs192765119 5860 dbSNP
rs532370673 5862 dbSNP
rs1384165647 5867 dbSNP
rs113121879 5873 dbSNP
rs1164753940 5881 dbSNP
rs1325942732 5897 dbSNP
rs1052206956 5898 dbSNP
rs540285957 5899 dbSNP
rs1349281480 5903 dbSNP
rs898004408 5913 dbSNP
rs1254656040 5917 dbSNP
rs1487032632 5925 dbSNP
rs890663567 5937 dbSNP
rs1052330900 5939 dbSNP
rs1261929955 5941 dbSNP
rs1418906354 5943 dbSNP
rs932256454 5950 dbSNP
rs572988875 5951 dbSNP
rs145012732 5953 dbSNP
rs1004210786 5954 dbSNP
rs1172891862 5970 dbSNP
rs761569972 5972 dbSNP
rs780292177 5972 dbSNP
rs1455098240 5989 dbSNP
rs772412670 5993 dbSNP
rs907865737 5995 dbSNP
rs1433125021 6003 dbSNP
rs1270730151 6010 dbSNP
rs905403919 6011 dbSNP
rs1234247380 6012 dbSNP
rs983586243 6020 dbSNP
rs1299740020 6035 dbSNP
rs1045286936 6036 dbSNP
rs527784338 6039 dbSNP
rs946420990 6045 dbSNP
rs1329799047 6079 dbSNP
rs1464192186 6082 dbSNP
rs1281031550 6087 dbSNP
rs1236574251 6096 dbSNP
rs1335009751 6098 dbSNP
rs1302239770 6101 dbSNP
rs914896704 6110 dbSNP
rs1468484004 6116 dbSNP
rs1190561594 6117 dbSNP
rs1423043498 6124 dbSNP
rs541635109 6132 dbSNP
rs1443381916 6149 dbSNP
rs1052160626 6153 dbSNP
rs746388731 6160 dbSNP
rs1362984172 6161 dbSNP
rs1368802437 6168 dbSNP
rs1325325965 6177 dbSNP
rs935072511 6182 dbSNP
rs922443821 6186 dbSNP
rs1034861147 6191 dbSNP
rs982328044 6192 dbSNP
rs139499090 6198 dbSNP
rs147352782 6199 dbSNP
rs538162805 6220 dbSNP
rs1226194828 6233 dbSNP
rs984024054 6239 dbSNP
rs576860772 6243 dbSNP
rs369526278 6244 dbSNP
rs1027630740 6251 dbSNP
rs1023584838 6257 dbSNP
rs1010809689 6258 dbSNP
rs376576986 6259 dbSNP
rs1471451720 6260 dbSNP
rs6012845 6265 dbSNP
rs1418924426 6269 dbSNP
rs1461117320 6269 dbSNP
rs1030664973 6276 dbSNP
rs1162820330 6280 dbSNP
rs1356333579 6289 dbSNP
rs142729247 6290 dbSNP
rs1003753413 6324 dbSNP
rs186547846 6327 dbSNP
rs1192501626 6331 dbSNP
rs1051950385 6350 dbSNP
rs1355738607 6352 dbSNP
rs374642807 6353 dbSNP
rs1045320198 6364 dbSNP
rs1286234162 6375 dbSNP
rs900659238 6376 dbSNP
rs1349599305 6377 dbSNP
rs536430589 6378 dbSNP
rs184028131 6379 dbSNP
rs1236708017 6386 dbSNP
rs942276513 6391 dbSNP
rs1482026612 6393 dbSNP
rs550967272 6395 dbSNP
rs907885723 6399 dbSNP
rs1048160626 6400 dbSNP
rs1472620844 6401 dbSNP
rs938794264 6407 dbSNP
rs1421746211 6408 dbSNP
rs1429138141 6415 dbSNP
rs1168021015 6416 dbSNP
rs1369315641 6417 dbSNP
rs1435872306 6418 dbSNP
rs1328340458 6420 dbSNP
rs78852220 6420 dbSNP
rs893491674 6421 dbSNP
rs1375165928 6422 dbSNP
rs1052078896 6428 dbSNP
rs1282003349 6431 dbSNP
rs551928495 6431 dbSNP
rs935086390 6431 dbSNP
rs1316845411 6434 dbSNP
rs1382164377 6435 dbSNP
rs1041191383 6441 dbSNP
rs1340022272 6441 dbSNP
rs1491178609 6441 dbSNP
rs922339633 6441 dbSNP
rs942576521 6442 dbSNP
rs928688321 6448 dbSNP
rs1208298962 6449 dbSNP
rs35509157 6450 dbSNP
rs1244112106 6463 dbSNP
rs980193827 6473 dbSNP
rs969239792 6475 dbSNP
rs1475861243 6483 dbSNP
rs778039347 6485 dbSNP
rs1188047458 6490 dbSNP
rs1329491854 6516 dbSNP
rs12624795 6518 dbSNP
rs752908752 6526 dbSNP
rs1392845085 6538 dbSNP
rs1174766974 6541 dbSNP
rs1424915701 6545 dbSNP
rs1413069929 6555 dbSNP
rs1320683000 6560 dbSNP
rs6012844 6567 dbSNP
rs1346669417 6581 dbSNP
rs1172680708 6582 dbSNP
rs1319363058 6587 dbSNP
rs952575901 6591 dbSNP
rs1236446509 6595 dbSNP
rs1243349197 6596 dbSNP
rs920602812 6605 dbSNP
rs1190862797 6608 dbSNP
rs1344200462 6608 dbSNP
rs989437511 6632 dbSNP
rs972049995 6635 dbSNP
rs1286048706 6638 dbSNP
rs565276099 6640 dbSNP
rs1208290487 6642 dbSNP
rs112058256 6643 dbSNP
rs1030679749 6651 dbSNP
rs999567788 6653 dbSNP
rs982592724 6661 dbSNP
rs954502225 6674 dbSNP
rs1279859597 6678 dbSNP
rs546584413 6679 dbSNP
rs1409149109 6686 dbSNP
rs1341483808 6687 dbSNP
rs191494850 6689 dbSNP
rs1268508708 6698 dbSNP
rs766094289 6710 dbSNP
rs995924229 6719 dbSNP
rs1442542590 6733 dbSNP
rs762769219 6735 dbSNP
rs750351241 6741 dbSNP
rs900711608 6742 dbSNP
rs1341626400 6743 dbSNP
rs1315413747 6752 dbSNP
rs1323638447 6756 dbSNP
rs1413299726 6760 dbSNP
rs1375285402 6772 dbSNP
rs537592490 6782 dbSNP
rs1281090863 6801 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAU--ACACGACGAu 5'
            || || || |  | ||||||| 
Target 5' auCACACAAUCACCU-UGCUGCUg 3'
5 - 27
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000557021.1 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000557021.1 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000557021.1 | 3UTR | GCUUUUUCUCCCUCCUCCUCAAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000557021.1 | 3UTR | CUUUUUCUCCCUCCUCCUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000557021.1 | 3UTR | ACACAUCACACAAUCACCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000557021.1 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000557021.1 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000557021.1 | 3UTR | CUUUUUCUCCCUCCUCCUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.423 2.2e-2 -0.427 2.1e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.401 2.6e-2 -0.380 3.4e-2 24 Click to see details
GSE27834 Pluripotent stem cells 0.463 3.5e-2 0.500 2.4e-2 16 Click to see details
GSE32688 Pancreatic cancer 0.309 4.3e-2 0.136 2.3e-1 32 Click to see details
GSE38226 Liver fibrosis 0.356 5.7e-2 0.210 1.8e-1 21 Click to see details
GSE17306 Multiple myeloma 0.191 9.4e-2 0.210 7.4e-2 49 Click to see details
GSE21032 Prostate cancer 0.095 2.0e-1 0.073 2.6e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.155 3.1e-1 -0.011 4.9e-1 13 Click to see details
GSE21687 Ependynoma primary tumors 0.061 3.2e-1 -0.063 3.1e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.137 3.4e-1 -0.280 1.9e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.045 3.4e-1 0.084 2.2e-1 90 Click to see details
GSE28544 Breast cancer 0.077 3.6e-1 0.475 9.5e-3 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.496 0.02 0.550 0.01 18 Click to see details
BRCA 0.205 0.03 0.208 0.03 84 Click to see details
THCA 0.206 0.06 0.175 0.09 59 Click to see details
PAAD -0.763 0.12 -0.800 0.1 4 Click to see details
KIRP 0.207 0.13 0.261 0.07 32 Click to see details
COAD 0.455 0.13 0.333 0.21 8 Click to see details
UCEC -0.267 0.13 -0.212 0.19 19 Click to see details
PCPG 0.868 0.17 1.000 0.5 3 Click to see details
LUSC 0.147 0.19 0.039 0.41 38 Click to see details
CESC 0.82 0.19 0.500 0.33 3 Click to see details
KICH 0.146 0.24 0.085 0.34 25 Click to see details
STAD 0.112 0.27 0.092 0.31 32 Click to see details
KIRC -0.069 0.29 -0.092 0.23 68 Click to see details
HNSC 0.084 0.3 0.123 0.22 42 Click to see details
LUAD -0.152 0.32 -0.224 0.24 12 Click to see details
LIHC 0.055 0.35 0.079 0.29 49 Click to see details
PRAD -0.045 0.38 -0.034 0.41 50 Click to see details
ESCA 0.064 0.43 0.182 0.3 11 Click to see details
CHOL 0.04 0.46 -0.117 0.38 9 Click to see details
CHOL 0.04 0.46 -0.117 0.38 9 Click to see details
CHOL 0.04 0.46 -0.117 0.38 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-gl