miRTarBase - #MIRT465570 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TOB2   
Synonyms APRO5, TOB4, TOBL, TROB2
Description transducer of ERBB2, 2
Transcript NM_016272   
Putative miRNA Targets on TOB2
3'UTR of TOB2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ||:| ::| |  ||||||| 
324 - 344 151.00 -14.00
            :::||| | |  ||||||  
Target 5' acTGGACCTTGA--TGCTGCga 3'
1405 - 1424 132.00 -11.20
            || :| ||| | |   |||||||  
2067 - 2093 132.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30517473 2 COSMIC
COSN31480848 5 COSMIC
COSN30106144 11 COSMIC
COSN18722267 25 COSMIC
COSN20073056 62 COSMIC
COSN30177866 67 COSMIC
COSN20080165 76 COSMIC
COSN27408889 254 COSMIC
COSN31480934 292 COSMIC
COSN25491258 318 COSMIC
COSN31483897 493 COSMIC
COSN1262312 544 COSMIC
COSN30163267 552 COSMIC
COSN31595723 588 COSMIC
COSN15662103 617 COSMIC
COSN31522238 622 COSMIC
COSN31480551 625 COSMIC
COSN16629982 769 COSMIC
COSN27344008 819 COSMIC
COSN5771408 1106 COSMIC
COSN9166398 1201 COSMIC
COSN30175446 1233 COSMIC
COSN31595266 1425 COSMIC
COSN30539996 1633 COSMIC
COSN31609703 1868 COSMIC
COSN24307421 1936 COSMIC
COSN26555565 1962 COSMIC
COSN28761578 2140 COSMIC
COSN19655202 2310 COSMIC
COSN31544992 2338 COSMIC
COSN26272103 2366 COSMIC
COSN31481561 2392 COSMIC
COSN31584982 2422 COSMIC
COSN31597738 2427 COSMIC
COSN31584136 2451 COSMIC
COSN31493237 2484 COSMIC
COSN26499235 2491 COSMIC
COSN31544652 2541 COSMIC
COSN31539785 2600 COSMIC
COSN31546974 2624 COSMIC
COSN31526136 2634 COSMIC
COSN31490211 2674 COSMIC
COSN26237881 2720 COSMIC
COSN5992966 2818 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778876078 1 dbSNP
rs1367414151 9 dbSNP
rs757290970 14 dbSNP
rs370123076 15 dbSNP
rs764326164 17 dbSNP
rs756020212 18 dbSNP
rs973153462 23 dbSNP
rs962104409 25 dbSNP
rs752507558 28 dbSNP
rs1448844875 29 dbSNP
rs767627844 35 dbSNP
rs747060261 51 dbSNP
rs1428157884 53 dbSNP
rs1362101349 54 dbSNP
rs1298203292 55 dbSNP
rs995209166 56 dbSNP
rs1423471858 58 dbSNP
rs1391840666 59 dbSNP
rs898237903 61 dbSNP
rs1166831223 62 dbSNP
rs561164846 69 dbSNP
rs992490506 70 dbSNP
rs1318011575 72 dbSNP
rs1387048961 72 dbSNP
rs781584943 73 dbSNP
rs1435094041 74 dbSNP
rs1055588995 84 dbSNP
rs937157142 85 dbSNP
rs769078750 93 dbSNP
rs1328577042 94 dbSNP
rs542562765 97 dbSNP
rs928459735 100 dbSNP
rs111462313 101 dbSNP
rs1345753743 109 dbSNP
rs1045621474 111 dbSNP
rs1221766442 113 dbSNP
rs1464385686 114 dbSNP
rs1429658921 120 dbSNP
rs544923985 120 dbSNP
rs945971464 127 dbSNP
rs1197656049 132 dbSNP
rs140706006 136 dbSNP
rs1481236053 142 dbSNP
rs777717981 143 dbSNP
rs545062763 145 dbSNP
rs1457124729 146 dbSNP
rs1160560768 148 dbSNP
rs1222910512 160 dbSNP
rs1001797394 170 dbSNP
rs968888589 172 dbSNP
rs1022212021 173 dbSNP
rs1307448715 175 dbSNP
rs113833863 181 dbSNP
rs1331871300 188 dbSNP
rs577299751 191 dbSNP
rs958097469 192 dbSNP
rs777840923 197 dbSNP
rs1041152622 198 dbSNP
rs756422767 199 dbSNP
rs1262440388 201 dbSNP
rs975470051 202 dbSNP
rs367648355 208 dbSNP
rs1267880047 209 dbSNP
rs534883904 210 dbSNP
rs1490734013 211 dbSNP
rs1179588904 212 dbSNP
rs1404027239 214 dbSNP
rs779853764 220 dbSNP
rs1343064779 228 dbSNP
rs1472651527 229 dbSNP
rs1008457669 236 dbSNP
rs1183105168 241 dbSNP
rs889815149 249 dbSNP
rs1050276777 251 dbSNP
rs1456878813 251 dbSNP
rs1391979644 252 dbSNP
rs1306433291 253 dbSNP
rs931909952 253 dbSNP
rs1349892031 258 dbSNP
rs920402656 259 dbSNP
rs1309292796 260 dbSNP
rs1338621082 264 dbSNP
rs1244046756 265 dbSNP
rs1037947308 266 dbSNP
rs1265748730 266 dbSNP
rs1273494366 266 dbSNP
rs550589208 266 dbSNP
rs75986371 266 dbSNP
rs573897756 273 dbSNP
rs1483207421 284 dbSNP
rs907606469 286 dbSNP
rs758224015 288 dbSNP
rs879214801 290 dbSNP
rs992606243 317 dbSNP
rs1187463812 324 dbSNP
rs959664759 325 dbSNP
rs1386205267 329 dbSNP
rs926962764 341 dbSNP
rs1353886732 355 dbSNP
rs547603303 386 dbSNP
rs1462747522 396 dbSNP
rs1167973655 402 dbSNP
rs1400172820 403 dbSNP
rs1395320468 404 dbSNP
rs1266912826 406 dbSNP
rs951699904 412 dbSNP
rs1025926716 429 dbSNP
rs969382795 434 dbSNP
rs182015675 435 dbSNP
rs1467002095 439 dbSNP
rs1225873534 442 dbSNP
rs1296654773 445 dbSNP
rs1342432044 449 dbSNP
rs1424145749 455 dbSNP
rs995574829 461 dbSNP
rs750333663 462 dbSNP
rs1244264385 468 dbSNP
rs1463079759 472 dbSNP
rs1187060409 474 dbSNP
rs1019647141 476 dbSNP
rs1429279107 485 dbSNP
rs1172808917 487 dbSNP
rs1375960595 489 dbSNP
rs1465628736 490 dbSNP
rs1055515282 492 dbSNP
rs889761189 493 dbSNP
rs1479601752 498 dbSNP
rs1319632537 514 dbSNP
rs1001297081 520 dbSNP
rs1191878612 527 dbSNP
rs1215896033 528 dbSNP
rs907009562 533 dbSNP
rs1045954428 534 dbSNP
rs945927816 539 dbSNP
rs765209041 542 dbSNP
rs1054418022 553 dbSNP
rs761299825 555 dbSNP
rs1207402261 556 dbSNP
rs1188336141 557 dbSNP
rs899070837 558 dbSNP
rs936635375 561 dbSNP
rs1265509704 564 dbSNP
rs925295856 565 dbSNP
rs753414740 567 dbSNP
rs1310101042 569 dbSNP
rs964114992 570 dbSNP
rs1056876776 574 dbSNP
rs912670696 577 dbSNP
rs1432607756 585 dbSNP
rs926910821 592 dbSNP
rs980167125 596 dbSNP
rs1405239398 598 dbSNP
rs1284580322 599 dbSNP
rs189462855 607 dbSNP
rs1227051511 614 dbSNP
rs987364030 616 dbSNP
rs1268079101 617 dbSNP
rs537358102 618 dbSNP
rs1318103454 620 dbSNP
rs148068050 625 dbSNP
rs1264125280 626 dbSNP
rs914792637 647 dbSNP
rs1200438689 661 dbSNP
rs1448994452 662 dbSNP
rs951613999 669 dbSNP
rs1026315365 673 dbSNP
rs1271063003 681 dbSNP
rs1400720817 681 dbSNP
rs995776771 683 dbSNP
rs962341371 685 dbSNP
rs1181610100 693 dbSNP
rs1175502390 704 dbSNP
rs989108394 708 dbSNP
rs145523137 711 dbSNP
rs1379591692 712 dbSNP
rs1304614022 724 dbSNP
rs1176808291 725 dbSNP
rs1001223324 726 dbSNP
rs1418563073 730 dbSNP
rs1248590050 738 dbSNP
rs752427630 742 dbSNP
rs906936012 752 dbSNP
rs1024091963 754 dbSNP
rs1010481715 756 dbSNP
rs1294189037 759 dbSNP
rs760315013 764 dbSNP
rs1242862039 766 dbSNP
rs1202209867 781 dbSNP
rs891628897 789 dbSNP
rs1233578618 792 dbSNP
rs1342359343 794 dbSNP
rs1054744895 806 dbSNP
rs1471087428 814 dbSNP
rs954137062 816 dbSNP
rs867180806 818 dbSNP
rs1412748645 819 dbSNP
rs1257410616 820 dbSNP
rs1233597215 821 dbSNP
rs935934101 827 dbSNP
rs1315809852 833 dbSNP
rs1328934036 833 dbSNP
rs1368285429 833 dbSNP
rs903841637 834 dbSNP
rs1028398829 837 dbSNP
rs1214194425 847 dbSNP
rs1301641938 854 dbSNP
rs138699434 855 dbSNP
rs1247130589 856 dbSNP
rs1317685949 863 dbSNP
rs764921713 884 dbSNP
rs1340280258 890 dbSNP
rs1039662310 900 dbSNP
rs1273720250 904 dbSNP
rs942733137 905 dbSNP
rs1377594249 911 dbSNP
rs1335761477 915 dbSNP
rs1242431281 927 dbSNP
rs1461745160 931 dbSNP
rs1394082548 935 dbSNP
rs80048472 936 dbSNP
rs1388154536 938 dbSNP
rs772441408 940 dbSNP
rs1168145452 944 dbSNP
rs1420981146 946 dbSNP
rs115432543 949 dbSNP
rs938527500 959 dbSNP
rs547959835 960 dbSNP
rs1454033312 973 dbSNP
rs183946738 978 dbSNP
rs1044177417 980 dbSNP
rs1362108731 981 dbSNP
rs1430229476 981 dbSNP
rs1341791483 983 dbSNP
rs962936007 988 dbSNP
rs1262663168 989 dbSNP
rs41276319 993 dbSNP
rs771620269 994 dbSNP
rs1446246855 996 dbSNP
rs1193397377 1000 dbSNP
rs1243470599 1006 dbSNP
rs192175972 1013 dbSNP
rs971090786 1021 dbSNP
rs529115343 1023 dbSNP
rs1024435673 1025 dbSNP
rs1429394839 1026 dbSNP
rs140352200 1045 dbSNP
rs5758350 1048 dbSNP
rs912696918 1050 dbSNP
rs1032864617 1051 dbSNP
rs1400467186 1054 dbSNP
rs1319438546 1060 dbSNP
rs1000010160 1064 dbSNP
rs900415186 1065 dbSNP
rs1200646177 1071 dbSNP
rs1282660984 1077 dbSNP
rs1346238236 1078 dbSNP
rs532808510 1087 dbSNP
rs1225227594 1088 dbSNP
rs1038964260 1091 dbSNP
rs1205495197 1094 dbSNP
rs1283201769 1094 dbSNP
rs954251236 1094 dbSNP
rs559022211 1096 dbSNP
rs769788887 1100 dbSNP
rs201548277 1103 dbSNP
rs942703768 1108 dbSNP
rs891131882 1112 dbSNP
rs1268926469 1122 dbSNP
rs1481143641 1125 dbSNP
rs974197532 1129 dbSNP
rs1362534032 1142 dbSNP
rs1051583993 1147 dbSNP
rs540768968 1148 dbSNP
rs1387617268 1161 dbSNP
rs930092774 1170 dbSNP
rs1366221140 1178 dbSNP
rs1015595392 1179 dbSNP
rs1313219903 1194 dbSNP
rs1381811646 1205 dbSNP
rs1358896061 1218 dbSNP
rs1005171555 1220 dbSNP
rs1281002697 1226 dbSNP
rs934002917 1244 dbSNP
rs1354028379 1251 dbSNP
rs1221212105 1252 dbSNP
rs1292022184 1266 dbSNP
rs1490749815 1267 dbSNP
rs1035645656 1269 dbSNP
rs886346523 1269 dbSNP
rs918689234 1270 dbSNP
rs1183172525 1273 dbSNP
rs1365103282 1279 dbSNP
rs905725586 1284 dbSNP
rs1365873364 1321 dbSNP
rs1443194194 1323 dbSNP
rs573881631 1324 dbSNP
rs1426851562 1329 dbSNP
rs941541735 1330 dbSNP
rs373771106 1341 dbSNP
rs1395865863 1346 dbSNP
rs544017590 1348 dbSNP
rs1391852736 1350 dbSNP
rs980352656 1362 dbSNP
rs1338678920 1363 dbSNP
rs971435211 1366 dbSNP
rs1052795489 1368 dbSNP
rs1023986685 1396 dbSNP
rs188276068 1398 dbSNP
rs1361135980 1403 dbSNP
rs1225743402 1408 dbSNP
rs1250202737 1412 dbSNP
rs1480692461 1417 dbSNP
rs988943745 1422 dbSNP
rs576626129 1423 dbSNP
rs1427485670 1429 dbSNP
rs1253263031 1432 dbSNP
rs987041586 1433 dbSNP
rs932792710 1437 dbSNP
rs146711808 1440 dbSNP
rs41276317 1441 dbSNP
rs1207961406 1447 dbSNP
rs999977760 1455 dbSNP
rs908652458 1456 dbSNP
rs982777414 1458 dbSNP
rs878943661 1460 dbSNP
rs566124316 1462 dbSNP
rs1226431819 1466 dbSNP
rs964556252 1481 dbSNP
rs960719762 1486 dbSNP
rs1384735274 1489 dbSNP
rs1432392572 1490 dbSNP
rs1294436815 1492 dbSNP
rs1307766681 1498 dbSNP
rs1228939531 1499 dbSNP
rs143705293 1506 dbSNP
rs1253811089 1509 dbSNP
rs535986703 1513 dbSNP
rs1321956086 1522 dbSNP
rs567444875 1530 dbSNP
rs1244083491 1533 dbSNP
rs1462952010 1536 dbSNP
rs370712667 1537 dbSNP
rs1261257843 1540 dbSNP
rs970275042 1541 dbSNP
rs1022802433 1546 dbSNP
rs1427304599 1553 dbSNP
rs1011708513 1556 dbSNP
rs892879291 1596 dbSNP
rs1053319170 1599 dbSNP
rs41276315 1607 dbSNP
rs1362224640 1613 dbSNP
rs890804098 1614 dbSNP
rs1383624373 1622 dbSNP
rs1167642650 1623 dbSNP
rs1280728051 1625 dbSNP
rs1051262655 1628 dbSNP
rs932907364 1638 dbSNP
rs569807170 1642 dbSNP
rs141317378 1643 dbSNP
rs532758375 1671 dbSNP
rs1326328842 1672 dbSNP
rs1214082598 1685 dbSNP
rs1260565586 1689 dbSNP
rs1486284058 1690 dbSNP
rs921396679 1693 dbSNP
rs370341833 1697 dbSNP
rs941562352 1702 dbSNP
rs56176102 1704 dbSNP
rs564491250 1710 dbSNP
rs1431316987 1731 dbSNP
rs1477970247 1737 dbSNP
rs982895194 1741 dbSNP
rs1158092043 1744 dbSNP
rs540704799 1748 dbSNP
rs927971131 1750 dbSNP
rs41276313 1756 dbSNP
rs1404994740 1758 dbSNP
rs1023338433 1763 dbSNP
rs1267994271 1765 dbSNP
rs1222577195 1769 dbSNP
rs865872772 1770 dbSNP
rs1306654886 1772 dbSNP
rs1317930547 1782 dbSNP
rs1011407381 1783 dbSNP
rs868180767 1790 dbSNP
rs1289836062 1803 dbSNP
rs957456541 1811 dbSNP
rs1219457010 1812 dbSNP
rs184637794 1822 dbSNP
rs1273111358 1827 dbSNP
rs113362539 1833 dbSNP
rs1176578703 1857 dbSNP
rs1408377338 1858 dbSNP
rs576581365 1868 dbSNP
rs866018003 1869 dbSNP
rs1161484832 1894 dbSNP
rs1050725983 1896 dbSNP
rs1328764280 1899 dbSNP
rs1445266865 1900 dbSNP
rs1352265033 1902 dbSNP
rs1440597814 1905 dbSNP
rs996948568 1907 dbSNP
rs1374762172 1909 dbSNP
rs200324753 1916 dbSNP
rs1313465421 1917 dbSNP
rs1358985243 1919 dbSNP
rs1247012916 1930 dbSNP
rs1171855534 1933 dbSNP
rs900077748 1935 dbSNP
rs1039048028 1940 dbSNP
rs1203972137 1960 dbSNP
rs1233353340 1962 dbSNP
rs941524101 1965 dbSNP
rs1181510816 1970 dbSNP
rs1242314959 1970 dbSNP
rs1165119418 1973 dbSNP
rs1465779885 1973 dbSNP
rs887288107 1974 dbSNP
rs1408842408 1978 dbSNP
rs1424031187 1978 dbSNP
rs1047156991 1979 dbSNP
rs939421565 1982 dbSNP
rs1170237422 1984 dbSNP
rs1335078417 1990 dbSNP
rs1382508258 1991 dbSNP
rs1478719847 1993 dbSNP
rs927918768 2001 dbSNP
rs1246853977 2005 dbSNP
rs1177902466 2006 dbSNP
rs1337737610 2014 dbSNP
rs1456427644 2018 dbSNP
rs1214056954 2019 dbSNP
rs747886031 2019 dbSNP
rs1239723706 2020 dbSNP
rs1319835464 2023 dbSNP
rs980763038 2025 dbSNP
rs1262234149 2027 dbSNP
rs1461623247 2031 dbSNP
rs1185248022 2036 dbSNP
rs948092568 2045 dbSNP
rs757122076 2050 dbSNP
rs558163313 2051 dbSNP
rs1421045504 2052 dbSNP
rs1467585988 2062 dbSNP
rs1174930254 2068 dbSNP
rs546558607 2070 dbSNP
rs941447543 2075 dbSNP
rs569309090 2090 dbSNP
rs4085935 2091 dbSNP
rs990502506 2094 dbSNP
rs866519807 2098 dbSNP
rs9611591 2103 dbSNP
rs1221220321 2104 dbSNP
rs1270777885 2109 dbSNP
rs1031467175 2110 dbSNP
rs977105399 2115 dbSNP
rs1282525593 2116 dbSNP
rs955117673 2118 dbSNP
rs1427445194 2124 dbSNP
rs1345767796 2128 dbSNP
rs1281968008 2133 dbSNP
rs4085936 2135 dbSNP
rs1216078104 2138 dbSNP
rs1264642561 2140 dbSNP
rs1238544965 2145 dbSNP
rs535869912 2151 dbSNP
rs1481090198 2152 dbSNP
rs1332379937 2156 dbSNP
rs959228191 2156 dbSNP
rs1383279523 2160 dbSNP
rs996506536 2160 dbSNP
rs1172707717 2162 dbSNP
rs899525085 2162 dbSNP
rs1403156586 2168 dbSNP
rs1282789680 2171 dbSNP
rs1346062499 2178 dbSNP
rs1235328398 2201 dbSNP
rs115305524 2202 dbSNP
rs1224173456 2208 dbSNP
rs1006236546 2220 dbSNP
rs1047268436 2220 dbSNP
rs1221090946 2220 dbSNP
rs1268985993 2220 dbSNP
rs1287695992 2220 dbSNP
rs887234835 2220 dbSNP
rs939537480 2225 dbSNP
rs752363257 2228 dbSNP
rs767323317 2229 dbSNP
rs1469918810 2242 dbSNP
rs906614993 2243 dbSNP
rs1425233312 2250 dbSNP
rs556623820 2254 dbSNP
rs1423047380 2256 dbSNP
rs1302549698 2260 dbSNP
rs1366284472 2275 dbSNP
rs1388392088 2276 dbSNP
rs1045199524 2277 dbSNP
rs1157552630 2283 dbSNP
rs1335154717 2287 dbSNP
rs1442650618 2294 dbSNP
rs1311276996 2295 dbSNP
rs948068204 2296 dbSNP
rs915244425 2309 dbSNP
rs1382100765 2310 dbSNP
rs1357886884 2311 dbSNP
rs779227661 2318 dbSNP
rs536852979 2319 dbSNP
rs1249006099 2320 dbSNP
rs770023253 2320 dbSNP
rs768832669 2322 dbSNP
rs1179645990 2330 dbSNP
rs1235561441 2332 dbSNP
rs1240414598 2333 dbSNP
rs1442943953 2333 dbSNP
rs1369086981 2336 dbSNP
rs935921493 2336 dbSNP
rs1459493163 2338 dbSNP
rs1166288936 2345 dbSNP
rs1212483971 2346 dbSNP
rs1443234757 2347 dbSNP
rs1395682110 2354 dbSNP
rs924563251 2363 dbSNP
rs1214542679 2366 dbSNP
rs1333051594 2369 dbSNP
rs1380338847 2370 dbSNP
rs977221821 2374 dbSNP
rs955231015 2383 dbSNP
rs569875654 2387 dbSNP
rs1310618839 2391 dbSNP
rs1245982129 2392 dbSNP
rs551372164 2392 dbSNP
rs1224593463 2402 dbSNP
rs1250336875 2402 dbSNP
rs1377395072 2404 dbSNP
rs963724329 2404 dbSNP
rs975580372 2404 dbSNP
rs1183405336 2405 dbSNP
rs1460282459 2405 dbSNP
rs1017014942 2408 dbSNP
rs34109631 2416 dbSNP
rs1449705396 2423 dbSNP
rs1005768413 2431 dbSNP
rs887349242 2433 dbSNP
rs539376998 2434 dbSNP
rs1172772981 2440 dbSNP
rs1403870621 2445 dbSNP
rs1469082150 2445 dbSNP
rs756139044 2449 dbSNP
rs1296969609 2455 dbSNP
rs1403899621 2459 dbSNP
rs1025944107 2461 dbSNP
rs1294161805 2484 dbSNP
rs1361978229 2490 dbSNP
rs1326525948 2505 dbSNP
rs1219738164 2506 dbSNP
rs1280610368 2519 dbSNP
rs6609 2521 dbSNP
rs546955735 2531 dbSNP
rs1203432614 2538 dbSNP
rs1256961418 2543 dbSNP
rs1484327301 2546 dbSNP
rs1203636430 2566 dbSNP
rs1261082876 2568 dbSNP
rs1478171517 2570 dbSNP
rs1195999993 2579 dbSNP
rs906729499 2580 dbSNP
rs1480107577 2581 dbSNP
rs1360695508 2595 dbSNP
rs1045128085 2596 dbSNP
rs1360809495 2597 dbSNP
rs112797816 2598 dbSNP
rs1401278555 2602 dbSNP
rs528868356 2605 dbSNP
rs1344107605 2606 dbSNP
rs192881080 2608 dbSNP
rs1183408852 2609 dbSNP
rs549893861 2612 dbSNP
rs1260341792 2614 dbSNP
rs1054186481 2621 dbSNP
rs774920626 2628 dbSNP
rs1218883076 2630 dbSNP
rs1266869860 2648 dbSNP
rs1490148807 2655 dbSNP
rs1191723171 2668 dbSNP
rs935371227 2676 dbSNP
rs924512631 2680 dbSNP
rs1489311891 2683 dbSNP
rs1286888793 2685 dbSNP
rs1041644959 2703 dbSNP
rs766852985 2706 dbSNP
rs922459668 2714 dbSNP
rs531801403 2718 dbSNP
rs1364436600 2719 dbSNP
rs1320467200 2720 dbSNP
rs975152172 2725 dbSNP
rs1294602641 2741 dbSNP
rs1292421415 2744 dbSNP
rs964142476 2747 dbSNP
rs909667069 2749 dbSNP
rs1242602168 2764 dbSNP
rs56394634 2767 dbSNP
rs188487784 2776 dbSNP
rs1222452113 2787 dbSNP
rs757226070 2789 dbSNP
rs139244475 2812 dbSNP
rs1176348330 2815 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacACGACGAu 5'
                        |||| || 
Target 5' ----------ucccUGCUCCUc 3'
1 - 12
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000327492.3 | 3UTR | UCCCUGCUCCUCCCUUCCUCCUUCACACUCCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.538 7.2e-3 -0.681 4.7e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.377 3.8e-2 -0.404 2.8e-2 23 Click to see details
GSE28544 Breast cancer -0.354 4.5e-2 -0.283 9.0e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.202 5.5e-2 0.189 6.7e-2 64 Click to see details
GSE32688 Pancreatic cancer -0.288 5.5e-2 -0.132 2.4e-1 32 Click to see details
GSE28260 Renal cortex and medulla 0.401 8.7e-2 0.527 3.2e-2 13 Click to see details
GSE19536 Breast cancer 0.127 1.0e-1 0.060 2.8e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.103 1.8e-1 0.077 2.5e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.182 2.0e-1 -0.241 1.3e-1 24 Click to see details
GSE17498 Multiple myeloma -0.131 2.1e-1 -0.209 9.8e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.152 2.3e-1 0.015 4.7e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.069 2.6e-1 0.111 1.5e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.142 3.0e-1 -0.038 4.4e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.153 3.2e-1 -0.552 3.1e-2 12 Click to see details
GSE38226 Liver fibrosis 0.108 3.2e-1 0.106 3.2e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.108 3.3e-1 0.011 4.8e-1 20 Click to see details
GSE21849 B cell lymphoma -0.08 3.4e-1 -0.164 2.0e-1 29 Click to see details
GSE17306 Multiple myeloma 0.05 3.7e-1 0.015 4.6e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.032 4.4e-1 -0.038 4.3e-1 25 Click to see details
GSE21032 Prostate cancer -0.003 4.9e-1 -0.013 4.5e-1 83 Click to see details
GSE21032 Prostate cancer -0.003 4.9e-1 -0.013 4.5e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.71 0 -0.730 0 32 Click to see details
BRCA 0.323 0 0.306 0 84 Click to see details
BLCA 0.614 0 0.643 0 18 Click to see details
LUSC 0.313 0.03 0.330 0.02 38 Click to see details
CHOL 0.574 0.05 0.300 0.22 9 Click to see details
KIRP -0.282 0.06 -0.247 0.09 32 Click to see details
PRAD 0.206 0.08 0.113 0.22 50 Click to see details
KICH 0.147 0.24 0.108 0.3 25 Click to see details
PAAD 0.459 0.27 0.000 0.5 4 Click to see details
KIRC -0.068 0.29 -0.034 0.39 68 Click to see details
UCEC -0.116 0.32 -0.046 0.43 19 Click to see details
LIHC -0.066 0.33 -0.098 0.25 49 Click to see details
CESC -0.483 0.34 -0.500 0.33 3 Click to see details
HNSC -0.058 0.36 -0.046 0.39 42 Click to see details
LUAD 0.077 0.41 -0.035 0.46 12 Click to see details
ESCA -0.069 0.42 -0.027 0.47 11 Click to see details
PCPG 0.221 0.43 -0.500 0.33 3 Click to see details
COAD -0.048 0.46 0.143 0.37 8 Click to see details
THCA 0.005 0.49 -0.048 0.36 59 Click to see details
THCA 0.005 0.49 -0.048 0.36 59 Click to see details
THCA 0.005 0.49 -0.048 0.36 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
Your e-Mail*