miRTarBase - #MIRT454344 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDKL1   
Synonyms KKIALRE, P42
Description cyclin dependent kinase like 1
Transcript NM_004196   
Expression
Putative miRNA Targets on CDKL1
3'UTR of CDKL1
(miRNA target sites are highlighted)
>CDKL1|NM_004196|3'UTR
   1 AGGAGCTAGGAGACATGATTTTAAAAAAGGAATCAATAGATGCTTTGAAGAAAATAAAACTTATACAGTTGATTGAAAAC
  81 AATTACAATGTTGAAAACACACCAGGAGAAAACATAAGCAAGAAACTGGGAGGCCAACTGGCAAGATATGAAGGGAAATT
 161 CCAGATCCAGTCTTCCATGCTTGATGATGGTGTCCAGAAAAGAAAAAACCTGTTTGGAGTTGCACTTGTATTTCAGTTTA
 241 TGTAAGTAGCCGAACTTATGGACAGAATATGAACTGTCCCATACCTCTGGCAAAACTAGATGATATCAAAAAGATTTATG
 321 CTTCAGTTGTACCACATGCCACACAAGAAAAATGAACCACAAAATGCCCATATATATTTCCTCGGATCTCTGTTGCCTGA
 401 GTCCTATCTCCTGCCTCTCAGATTGTTTCAGCATCATATTTAAGATAGTTCTATTTCTTGAAATCAAAATGTTTAAAATC
 481 CCAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAAC-AGUGUGAGGu 5'
             ||| ::|||   |||| || 
Target 5' attACAATGTTGAAAACACACCa 3'
82 - 104 123.00 -12.00
2
miRNA  3' guuUGUGGU-AACA--GUGUGAGGu 5'
             :| :|| ||||  ||||: || 
Target 5' tatGCTTCAGTTGTACCACATGCCa 3'
317 - 341 113.00 -11.00
3
miRNA  3' guUUGUGG-UAA----CAGUGUGAGgu 5'
            || ||| :||    ||::||||:  
Target 5' aaAAAACCTGTTTGGAGTTGCACTTgt 3'
203 - 229 110.00 -6.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28194886 9 COSMIC
COSN31599035 59 COSMIC
COSN28880184 125 COSMIC
COSN29445183 407 COSMIC
COSN25820325 515 COSMIC
COSN14616568 562 COSMIC
COSN15923997 898 COSMIC
COSN18832679 1014 COSMIC
COSN22906502 1230 COSMIC
COSN19380124 1845 COSMIC
COSN23143851 1846 COSMIC
COSN16032048 2442 COSMIC
COSN23106493 2579 COSMIC
COSN17253021 2746 COSMIC
COSN16087008 2795 COSMIC
COSN8660129 2946 COSMIC
COSN23455468 3441 COSMIC
COSN29576720 3790 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771893011 9 dbSNP
rs542797096 10 dbSNP
rs12882930 13 dbSNP
rs1293121725 14 dbSNP
rs778999738 16 dbSNP
rs1319867738 22 dbSNP
rs1351740953 23 dbSNP
rs766762864 24 dbSNP
rs1228287153 29 dbSNP
rs1326905149 29 dbSNP
rs8007971 31 dbSNP
rs763096694 36 dbSNP
rs557128887 37 dbSNP
rs755838967 39 dbSNP
rs543808565 47 dbSNP
rs990105860 55 dbSNP
rs1366297546 56 dbSNP
rs936025486 59 dbSNP
rs1207159969 64 dbSNP
rs925209933 64 dbSNP
rs1300859468 83 dbSNP
rs981067034 86 dbSNP
rs969351142 88 dbSNP
rs1025189849 101 dbSNP
rs1194711562 102 dbSNP
rs1365851823 108 dbSNP
rs1157820942 109 dbSNP
rs992013919 112 dbSNP
rs951104011 119 dbSNP
rs1419539687 121 dbSNP
rs868184608 122 dbSNP
rs1385590543 123 dbSNP
rs931694306 131 dbSNP
rs1332100847 136 dbSNP
rs112748297 138 dbSNP
rs1294157986 143 dbSNP
rs1337170849 147 dbSNP
rs1159748532 148 dbSNP
rs750661392 149 dbSNP
rs1351829462 153 dbSNP
rs976270135 156 dbSNP
rs1277081132 161 dbSNP
rs1485085643 166 dbSNP
rs1266897376 176 dbSNP
rs1259224297 185 dbSNP
rs898194100 190 dbSNP
rs1364225570 191 dbSNP
rs1455149078 193 dbSNP
rs577923499 199 dbSNP
rs1170791253 202 dbSNP
rs908102462 207 dbSNP
rs1262830716 212 dbSNP
rs985227587 213 dbSNP
rs1017954085 217 dbSNP
rs1007531638 223 dbSNP
rs1203741875 224 dbSNP
rs952036361 225 dbSNP
rs891382035 231 dbSNP
rs1408297285 234 dbSNP
rs1336761253 247 dbSNP
rs1034325117 248 dbSNP
rs980183050 249 dbSNP
rs765504080 251 dbSNP
rs558912178 252 dbSNP
rs1210986921 267 dbSNP
rs538961631 272 dbSNP
rs1481779241 274 dbSNP
rs946255713 282 dbSNP
rs1250758413 291 dbSNP
rs1177785917 296 dbSNP
rs11570887 297 dbSNP
rs1196428920 301 dbSNP
rs1054496495 307 dbSNP
rs1394405619 309 dbSNP
rs776926308 330 dbSNP
rs1454612837 335 dbSNP
rs1311005519 336 dbSNP
rs1175420696 339 dbSNP
rs1234594732 343 dbSNP
rs1013416986 347 dbSNP
rs1280771369 353 dbSNP
rs1406313705 361 dbSNP
rs936099381 363 dbSNP
rs927262216 371 dbSNP
rs763749420 374 dbSNP
rs11570888 384 dbSNP
rs182242520 392 dbSNP
rs1235745146 401 dbSNP
rs1306269341 406 dbSNP
rs1339507338 414 dbSNP
rs1226034851 417 dbSNP
rs567360601 421 dbSNP
rs1380241704 429 dbSNP
rs1386904910 430 dbSNP
rs1207851328 435 dbSNP
rs1252203463 438 dbSNP
rs1468743290 443 dbSNP
rs1289323280 445 dbSNP
rs372928491 457 dbSNP
rs917875740 459 dbSNP
rs1427167452 483 dbSNP
rs1178678595 485 dbSNP
rs1480839841 487 dbSNP
rs1373864165 498 dbSNP
rs1050017454 511 dbSNP
rs768426280 513 dbSNP
rs1324119895 528 dbSNP
rs991989657 529 dbSNP
rs1394293897 530 dbSNP
rs760689008 558 dbSNP
rs1191310820 565 dbSNP
rs1025386502 567 dbSNP
rs901592214 570 dbSNP
rs1295598355 574 dbSNP
rs1040967764 580 dbSNP
rs11157736 584 dbSNP
rs908009868 586 dbSNP
rs1049356787 587 dbSNP
rs1200279415 591 dbSNP
rs11570889 594 dbSNP
rs1246147766 602 dbSNP
rs1186018242 605 dbSNP
rs1485466147 605 dbSNP
rs1262590053 609 dbSNP
rs571130201 614 dbSNP
rs1430378432 621 dbSNP
rs369372965 622 dbSNP
rs927284637 627 dbSNP
rs1018320451 630 dbSNP
rs1167503199 634 dbSNP
rs1441961720 637 dbSNP
rs1430713519 657 dbSNP
rs971510688 664 dbSNP
rs550941276 671 dbSNP
rs891367517 672 dbSNP
rs1031212607 675 dbSNP
rs745713757 680 dbSNP
rs1323627996 685 dbSNP
rs1281814198 690 dbSNP
rs1316107454 695 dbSNP
rs1277132085 696 dbSNP
rs1010345442 711 dbSNP
rs1262389070 715 dbSNP
rs891935664 724 dbSNP
rs1486920592 726 dbSNP
rs967928949 731 dbSNP
rs528794941 735 dbSNP
rs995778163 739 dbSNP
rs377068350 745 dbSNP
rs1400454524 749 dbSNP
rs936048334 758 dbSNP
rs1347412048 762 dbSNP
rs905954345 765 dbSNP
rs1311671877 766 dbSNP
rs1040134845 767 dbSNP
rs1375694319 777 dbSNP
rs1416306115 813 dbSNP
rs1395312927 820 dbSNP
rs1005019234 830 dbSNP
rs1044784352 834 dbSNP
rs1224112508 837 dbSNP
rs1309093152 839 dbSNP
rs1208827182 844 dbSNP
rs1279775153 845 dbSNP
rs1049227253 849 dbSNP
rs1486035805 849 dbSNP
rs1470306547 851 dbSNP
rs1231369786 858 dbSNP
rs1399688050 859 dbSNP
rs950119252 861 dbSNP
rs559609082 866 dbSNP
rs927529019 872 dbSNP
rs1453054459 875 dbSNP
rs1056424617 886 dbSNP
rs1044440533 888 dbSNP
rs950067848 890 dbSNP
rs1187265907 891 dbSNP
rs1326501472 901 dbSNP
rs750113113 904 dbSNP
rs1443179759 913 dbSNP
rs1245432462 919 dbSNP
rs1204892502 920 dbSNP
rs190414195 923 dbSNP
rs1368720761 927 dbSNP
rs1233559338 931 dbSNP
rs1304023826 940 dbSNP
rs988913837 945 dbSNP
rs1220968538 959 dbSNP
rs1271185806 979 dbSNP
rs1271651554 981 dbSNP
rs770657030 982 dbSNP
rs1437392239 985 dbSNP
rs1193616064 986 dbSNP
rs956284476 992 dbSNP
rs374148585 996 dbSNP
rs1467414850 1003 dbSNP
rs1270475146 1004 dbSNP
rs923808933 1006 dbSNP
rs1455212623 1008 dbSNP
rs1165615802 1010 dbSNP
rs1244905714 1010 dbSNP
rs1392069305 1012 dbSNP
rs1410129530 1012 dbSNP
rs200113966 1012 dbSNP
rs1438708609 1014 dbSNP
rs372955511 1014 dbSNP
rs979231066 1014 dbSNP
rs1215448434 1016 dbSNP
rs1338809227 1016 dbSNP
rs911011222 1016 dbSNP
rs985510326 1017 dbSNP
rs1317025030 1018 dbSNP
rs1453319098 1019 dbSNP
rs1028851883 1020 dbSNP
rs1376137070 1020 dbSNP
rs1190419562 1022 dbSNP
rs996018477 1022 dbSNP
rs1326929043 1023 dbSNP
rs965756233 1027 dbSNP
rs1397408094 1028 dbSNP
rs1162894487 1029 dbSNP
rs1423083376 1030 dbSNP
rs1387492227 1032 dbSNP
rs1415142326 1032 dbSNP
rs1460755834 1033 dbSNP
rs1184644025 1034 dbSNP
rs1439586968 1035 dbSNP
rs1231744019 1036 dbSNP
rs1165294003 1038 dbSNP
rs1317556116 1038 dbSNP
rs1333082075 1038 dbSNP
rs1385670136 1038 dbSNP
rs1396612969 1038 dbSNP
rs1398937841 1038 dbSNP
rs1474643095 1038 dbSNP
rs199949248 1038 dbSNP
rs57657571 1038 dbSNP
rs67088222 1038 dbSNP
rs766292540 1038 dbSNP
rs1188203326 1039 dbSNP
rs947652275 1046 dbSNP
rs1370041471 1052 dbSNP
rs1157977931 1055 dbSNP
rs1468382589 1055 dbSNP
rs748724834 1058 dbSNP
rs538356115 1059 dbSNP
rs1273187489 1061 dbSNP
rs1373888904 1062 dbSNP
rs1221322602 1064 dbSNP
rs1294135487 1069 dbSNP
rs1356948111 1071 dbSNP
rs745362476 1074 dbSNP
rs1237271321 1075 dbSNP
rs1279517079 1085 dbSNP
rs1351942088 1092 dbSNP
rs1218180137 1104 dbSNP
rs886181735 1110 dbSNP
rs1029295259 1118 dbSNP
rs774075938 1120 dbSNP
rs202215405 1122 dbSNP
rs1293645782 1123 dbSNP
rs1180774087 1125 dbSNP
rs1010420489 1127 dbSNP
rs1246525790 1129 dbSNP
rs200006894 1131 dbSNP
rs75961992 1133 dbSNP
rs554012447 1135 dbSNP
rs796368991 1135 dbSNP
rs569227431 1136 dbSNP
rs151281958 1138 dbSNP
rs1243037987 1144 dbSNP
rs905940893 1145 dbSNP
rs1301839600 1146 dbSNP
rs1346589288 1146 dbSNP
rs398118192 1146 dbSNP
rs71118871 1146 dbSNP
rs1336458731 1148 dbSNP
rs867853946 1148 dbSNP
rs1323081708 1149 dbSNP
rs1014658841 1150 dbSNP
rs1403309034 1150 dbSNP
rs111875032 1153 dbSNP
rs994987256 1154 dbSNP
rs1386850816 1155 dbSNP
rs1302693756 1158 dbSNP
rs1305246442 1164 dbSNP
rs1047780672 1166 dbSNP
rs201607613 1168 dbSNP
rs4901013 1174 dbSNP
rs918516817 1180 dbSNP
rs1192834515 1184 dbSNP
rs1269640541 1192 dbSNP
rs578028045 1193 dbSNP
rs1426779698 1199 dbSNP
rs941225416 1204 dbSNP
rs1470857425 1206 dbSNP
rs1192806704 1207 dbSNP
rs1424544095 1208 dbSNP
rs1232975014 1209 dbSNP
rs1163146121 1211 dbSNP
rs1394414410 1218 dbSNP
rs564505576 1220 dbSNP
rs1458920040 1223 dbSNP
rs1295799541 1224 dbSNP
rs1198128425 1225 dbSNP
rs910948066 1233 dbSNP
rs985196153 1236 dbSNP
rs1270669584 1238 dbSNP
rs541424618 1253 dbSNP
rs955317422 1257 dbSNP
rs1446217857 1258 dbSNP
rs1160054125 1260 dbSNP
rs1272377965 1267 dbSNP
rs895824407 1268 dbSNP
rs1223731449 1270 dbSNP
rs1282015150 1272 dbSNP
rs1258869491 1275 dbSNP
rs922230856 1279 dbSNP
rs988443846 1283 dbSNP
rs1204591122 1293 dbSNP
rs573218419 1296 dbSNP
rs1264176946 1297 dbSNP
rs8021046 1302 dbSNP
rs1238079785 1309 dbSNP
rs780341941 1313 dbSNP
rs926020103 1314 dbSNP
rs375896930 1321 dbSNP
rs536457676 1327 dbSNP
rs1347609921 1337 dbSNP
rs1303999941 1338 dbSNP
rs534246896 1349 dbSNP
rs1343834953 1358 dbSNP
rs1361877889 1359 dbSNP
rs1412613568 1365 dbSNP
rs148299214 1366 dbSNP
rs1000754583 1368 dbSNP
rs185084056 1371 dbSNP
rs1425134897 1385 dbSNP
rs567058818 1406 dbSNP
rs758750911 1417 dbSNP
rs1479177215 1420 dbSNP
rs1286906987 1432 dbSNP
rs1489311732 1435 dbSNP
rs1430887362 1442 dbSNP
rs1257054058 1453 dbSNP
rs1483798790 1462 dbSNP
rs750857908 1463 dbSNP
rs1023569179 1473 dbSNP
rs571305184 1483 dbSNP
rs1014319124 1485 dbSNP
rs974692541 1491 dbSNP
rs1381667651 1493 dbSNP
rs181889950 1495 dbSNP
rs1311917449 1499 dbSNP
rs1359339792 1501 dbSNP
rs1449957985 1506 dbSNP
rs1018648529 1509 dbSNP
rs983521840 1511 dbSNP
rs534274269 1512 dbSNP
rs950471627 1514 dbSNP
rs143261043 1520 dbSNP
rs1240873062 1530 dbSNP
rs1311331257 1531 dbSNP
rs1447507274 1533 dbSNP
rs765417733 1538 dbSNP
rs1232123647 1540 dbSNP
rs993533789 1548 dbSNP
rs897053712 1566 dbSNP
rs1312928392 1574 dbSNP
rs1212494296 1575 dbSNP
rs1231591124 1577 dbSNP
rs768859766 1580 dbSNP
rs941285937 1584 dbSNP
rs1179869473 1593 dbSNP
rs1240515404 1597 dbSNP
rs1452065535 1599 dbSNP
rs906049427 1610 dbSNP
rs1415879572 1611 dbSNP
rs1425449844 1611 dbSNP
rs1023105654 1614 dbSNP
rs8020274 1615 dbSNP
rs1447222880 1624 dbSNP
rs896053863 1625 dbSNP
rs1050028012 1626 dbSNP
rs1274393938 1629 dbSNP
rs1368387553 1630 dbSNP
rs933721127 1637 dbSNP
rs1272259695 1641 dbSNP
rs753816190 1643 dbSNP
rs988433895 1645 dbSNP
rs1317711270 1653 dbSNP
rs1199620726 1669 dbSNP
rs934351819 1673 dbSNP
rs780513950 1676 dbSNP
rs1198759815 1701 dbSNP
rs1246853842 1707 dbSNP
rs188625823 1716 dbSNP
rs1432015796 1717 dbSNP
rs1405917297 1721 dbSNP
rs1418296451 1722 dbSNP
rs1465978123 1723 dbSNP
rs6572658 1724 dbSNP
rs1460914227 1738 dbSNP
rs932696483 1740 dbSNP
rs1331801232 1748 dbSNP
rs1467737488 1754 dbSNP
rs1438641114 1759 dbSNP
rs1268668873 1761 dbSNP
rs1340040976 1775 dbSNP
rs760469130 1778 dbSNP
rs550331177 1785 dbSNP
rs371625175 1787 dbSNP
rs993414089 1788 dbSNP
rs960106602 1803 dbSNP
rs775553128 1821 dbSNP
rs911781991 1826 dbSNP
rs1212991075 1827 dbSNP
rs983167415 1834 dbSNP
rs993481571 1841 dbSNP
rs899133892 1845 dbSNP
rs11570890 1846 dbSNP
rs1163791905 1846 dbSNP
rs1415444410 1846 dbSNP
rs1005427939 1854 dbSNP
rs1316239274 1855 dbSNP
rs969786995 1855 dbSNP
rs889708145 1865 dbSNP
rs74515247 1876 dbSNP
rs1023172010 1880 dbSNP
rs191859028 1881 dbSNP
rs568297214 1883 dbSNP
rs1354011186 1885 dbSNP
rs1032350591 1891 dbSNP
rs111342310 1898 dbSNP
rs1359003865 1901 dbSNP
rs1052830030 1906 dbSNP
rs1284767831 1909 dbSNP
rs1263807608 1913 dbSNP
rs1218394512 1919 dbSNP
rs1254895384 1921 dbSNP
rs904533277 1923 dbSNP
rs934425534 1925 dbSNP
rs572432387 1952 dbSNP
rs1370133972 1955 dbSNP
rs1043005692 1961 dbSNP
rs996922119 1968 dbSNP
rs899926500 1969 dbSNP
rs186664292 1974 dbSNP
rs978839147 1978 dbSNP
rs1275396128 1992 dbSNP
rs944526190 1993 dbSNP
rs1335209966 1994 dbSNP
rs1215453531 2005 dbSNP
rs1048126814 2009 dbSNP
rs911700857 2009 dbSNP
rs774336171 2010 dbSNP
rs1382538931 2013 dbSNP
rs1313495130 2014 dbSNP
rs929168361 2021 dbSNP
rs1353823600 2030 dbSNP
rs1455027952 2030 dbSNP
rs920291915 2034 dbSNP
rs973062852 2034 dbSNP
rs969818012 2045 dbSNP
rs184390218 2046 dbSNP
rs1352348333 2066 dbSNP
rs992560122 2067 dbSNP
rs1440434829 2069 dbSNP
rs573858786 2073 dbSNP
rs1376149154 2076 dbSNP
rs556912667 2077 dbSNP
rs1430126850 2084 dbSNP
rs993011774 2086 dbSNP
rs569747738 2092 dbSNP
rs537241531 2096 dbSNP
rs960221216 2097 dbSNP
rs1026495568 2102 dbSNP
rs1331267806 2103 dbSNP
rs577364232 2107 dbSNP
rs1378248950 2116 dbSNP
rs972117712 2120 dbSNP
rs750496634 2121 dbSNP
rs550272080 2123 dbSNP
rs963457635 2123 dbSNP
rs1181578742 2132 dbSNP
rs1016230666 2134 dbSNP
rs1243747859 2135 dbSNP
rs1233603730 2148 dbSNP
rs1257381629 2158 dbSNP
rs1176679518 2170 dbSNP
rs1197703945 2172 dbSNP
rs899945479 2174 dbSNP
rs1458994890 2176 dbSNP
rs1479700253 2182 dbSNP
rs1234777342 2186 dbSNP
rs866918211 2187 dbSNP
rs1265445625 2188 dbSNP
rs770442036 2191 dbSNP
rs112533600 2195 dbSNP
rs1359053914 2196 dbSNP
rs1379524189 2197 dbSNP
rs749001770 2198 dbSNP
rs757380688 2199 dbSNP
rs1401455562 2205 dbSNP
rs1008289575 2209 dbSNP
rs1248707539 2210 dbSNP
rs1292285257 2211 dbSNP
rs1389458573 2214 dbSNP
rs890288823 2217 dbSNP
rs111985271 2225 dbSNP
rs929247002 2226 dbSNP
rs1306928664 2227 dbSNP
rs920491986 2231 dbSNP
rs1337905642 2240 dbSNP
rs60103816 2240 dbSNP
rs894481777 2240 dbSNP
rs1319735511 2249 dbSNP
rs193207924 2251 dbSNP
rs915554707 2262 dbSNP
rs1488201944 2265 dbSNP
rs900985995 2273 dbSNP
rs1269767209 2287 dbSNP
rs959780789 2310 dbSNP
rs565307234 2313 dbSNP
rs548940735 2317 dbSNP
rs1424873103 2324 dbSNP
rs1478999566 2326 dbSNP
rs769361970 2329 dbSNP
rs116849769 2331 dbSNP
rs1457995401 2332 dbSNP
rs1294721975 2334 dbSNP
rs1358044328 2341 dbSNP
rs1042723858 2355 dbSNP
rs948432133 2359 dbSNP
rs916150066 2364 dbSNP
rs964411244 2365 dbSNP
rs921287373 2368 dbSNP
rs1322205655 2370 dbSNP
rs1019572564 2372 dbSNP
rs1267346470 2377 dbSNP
rs1158330741 2378 dbSNP
rs1417345841 2382 dbSNP
rs1487347097 2393 dbSNP
rs1216236793 2398 dbSNP
rs1264098671 2409 dbSNP
rs1489477057 2411 dbSNP
rs1180438317 2412 dbSNP
rs1057496981 2418 dbSNP
rs1008736823 2420 dbSNP
rs887196560 2421 dbSNP
rs1026175725 2437 dbSNP
rs1183030894 2438 dbSNP
rs1378013444 2439 dbSNP
rs938931891 2447 dbSNP
rs1418502976 2449 dbSNP
rs1490245503 2451 dbSNP
rs149136376 2452 dbSNP
rs1225108207 2453 dbSNP
rs898968724 2457 dbSNP
rs550151473 2459 dbSNP
rs1302098060 2460 dbSNP
rs1037638148 2461 dbSNP
rs972232373 2464 dbSNP
rs533519564 2465 dbSNP
rs1351615008 2467 dbSNP
rs1239430986 2469 dbSNP
rs146766928 2475 dbSNP
rs948578095 2478 dbSNP
rs963448267 2479 dbSNP
rs1056789840 2482 dbSNP
rs1260611322 2486 dbSNP
rs938471446 2489 dbSNP
rs1237303528 2490 dbSNP
rs924368414 2494 dbSNP
rs909327541 2495 dbSNP
rs1236818459 2513 dbSNP
rs986130881 2515 dbSNP
rs1228543097 2522 dbSNP
rs370797512 2524 dbSNP
rs547880729 2528 dbSNP
rs1381605027 2544 dbSNP
rs1412445239 2547 dbSNP
rs1174910792 2549 dbSNP
rs548413212 2555 dbSNP
rs1467336343 2560 dbSNP
rs1329232444 2565 dbSNP
rs1406499168 2572 dbSNP
rs1376008404 2574 dbSNP
rs1391214908 2577 dbSNP
rs1288120716 2582 dbSNP
rs111657658 2583 dbSNP
rs1365527477 2584 dbSNP
rs1159980248 2590 dbSNP
rs1205930092 2591 dbSNP
rs1313161269 2591 dbSNP
rs1480157612 2592 dbSNP
rs1457749841 2593 dbSNP
rs1179781450 2594 dbSNP
rs1239535015 2598 dbSNP
rs1427376821 2603 dbSNP
rs1201903815 2604 dbSNP
rs1434076692 2605 dbSNP
rs1261443444 2607 dbSNP
rs1203796679 2609 dbSNP
rs1476748774 2613 dbSNP
rs1190286368 2614 dbSNP
rs1168209288 2615 dbSNP
rs1225560948 2615 dbSNP
rs1274521568 2615 dbSNP
rs1275653392 2615 dbSNP
rs1333275551 2615 dbSNP
rs1356408390 2615 dbSNP
rs1399243002 2615 dbSNP
rs1434316386 2615 dbSNP
rs1434717973 2615 dbSNP
rs1466111086 2615 dbSNP
rs1491189908 2615 dbSNP
rs555068519 2615 dbSNP
rs750138701 2615 dbSNP
rs758016227 2615 dbSNP
rs761957738 2615 dbSNP
rs773565273 2615 dbSNP
rs1220135069 2616 dbSNP
rs1491533985 2616 dbSNP
rs1246946185 2617 dbSNP
rs1490752154 2622 dbSNP
rs1191016379 2628 dbSNP
rs1422736563 2630 dbSNP
rs1478016699 2632 dbSNP
rs1172743043 2635 dbSNP
rs1411488555 2637 dbSNP
rs914719946 2638 dbSNP
rs188961144 2642 dbSNP
rs372205602 2648 dbSNP
rs374510361 2651 dbSNP
rs1340312624 2656 dbSNP
rs1219557622 2660 dbSNP
rs144862473 2666 dbSNP
rs1354800819 2673 dbSNP
rs1228228715 2675 dbSNP
rs1290014146 2679 dbSNP
rs904271608 2680 dbSNP
rs1360966383 2681 dbSNP
rs1280914743 2690 dbSNP
rs1224939098 2697 dbSNP
rs1043224449 2700 dbSNP
rs1012679398 2706 dbSNP
rs894106936 2710 dbSNP
rs1331365041 2715 dbSNP
rs1056818197 2721 dbSNP
rs938879605 2724 dbSNP
rs1195007838 2727 dbSNP
rs74332015 2738 dbSNP
rs11295551 2740 dbSNP
rs1235502360 2740 dbSNP
rs1491098235 2740 dbSNP
rs398025028 2740 dbSNP
rs572873116 2740 dbSNP
rs75453465 2740 dbSNP
rs764149606 2741 dbSNP
rs772342450 2741 dbSNP
rs112635475 2744 dbSNP
rs1339042643 2745 dbSNP
rs1321145039 2747 dbSNP
rs1469321269 2754 dbSNP
rs1297245421 2756 dbSNP
rs1025746323 2769 dbSNP
rs561658214 2780 dbSNP
rs527304439 2788 dbSNP
rs541892416 2800 dbSNP
rs942215581 2806 dbSNP
rs1206498631 2807 dbSNP
rs1276328166 2807 dbSNP
rs1441620272 2813 dbSNP
rs543261777 2814 dbSNP
rs995565469 2822 dbSNP
rs564929194 2823 dbSNP
rs909285868 2834 dbSNP
rs1446552750 2842 dbSNP
rs1176802859 2853 dbSNP
rs986592054 2856 dbSNP
rs1379741991 2860 dbSNP
rs953507223 2864 dbSNP
rs780536449 2865 dbSNP
rs1400586712 2866 dbSNP
rs976063492 2870 dbSNP
rs965258981 2871 dbSNP
rs577383734 2874 dbSNP
rs1031591509 2875 dbSNP
rs998629236 2878 dbSNP
rs1460407016 2883 dbSNP
rs894392468 2886 dbSNP
rs1240817291 2887 dbSNP
rs1272660207 2889 dbSNP
rs1344039760 2890 dbSNP
rs1057227404 2901 dbSNP
rs938349177 2921 dbSNP
rs544753631 2926 dbSNP
rs183619492 2927 dbSNP
rs190630091 2929 dbSNP
rs1345266074 2938 dbSNP
rs1041467649 2943 dbSNP
rs559076357 2944 dbSNP
rs1419730626 2955 dbSNP
rs1184262992 2957 dbSNP
rs1376065402 2962 dbSNP
rs1021475314 2965 dbSNP
rs1013040610 2967 dbSNP
rs139269206 2971 dbSNP
rs1224882151 2976 dbSNP
rs7147718 2978 dbSNP
rs1035345911 2983 dbSNP
rs1002577828 2988 dbSNP
rs182427567 2989 dbSNP
rs1330098390 2994 dbSNP
rs376139589 3000 dbSNP
rs942305227 3010 dbSNP
rs1315831772 3011 dbSNP
rs1217994279 3022 dbSNP
rs1258562964 3023 dbSNP
rs987429763 3031 dbSNP
rs1415173777 3037 dbSNP
rs1197587020 3039 dbSNP
rs1265336486 3040 dbSNP
rs887903807 3041 dbSNP
rs951431635 3045 dbSNP
rs1050633508 3047 dbSNP
rs1431981628 3051 dbSNP
rs932029352 3052 dbSNP
rs1477013308 3053 dbSNP
rs757351447 3057 dbSNP
rs570254769 3068 dbSNP
rs923385045 3070 dbSNP
rs1170599342 3073 dbSNP
rs1166378223 3076 dbSNP
rs1202545954 3087 dbSNP
rs1374100339 3100 dbSNP
rs1463091530 3103 dbSNP
rs918550915 3110 dbSNP
rs1389346742 3122 dbSNP
rs556778791 3134 dbSNP
rs1463805594 3139 dbSNP
rs112928084 3142 dbSNP
rs935371315 3144 dbSNP
rs924520852 3152 dbSNP
rs112774313 3156 dbSNP
rs1188951694 3161 dbSNP
rs1309241484 3166 dbSNP
rs1442499898 3166 dbSNP
rs1012736151 3172 dbSNP
rs958904500 3180 dbSNP
rs1035626910 3181 dbSNP
rs1355718009 3185 dbSNP
rs1003182439 3187 dbSNP
rs540056987 3188 dbSNP
rs1041332092 3199 dbSNP
rs1487531763 3199 dbSNP
rs968684652 3202 dbSNP
rs1430849400 3207 dbSNP
rs1163288988 3209 dbSNP
rs112034799 3213 dbSNP
rs1342361792 3218 dbSNP
rs1165086705 3225 dbSNP
rs571030844 3239 dbSNP
rs1343921475 3244 dbSNP
rs991368460 3245 dbSNP
rs1358187332 3260 dbSNP
rs1399187606 3262 dbSNP
rs1275048918 3270 dbSNP
rs1245061829 3279 dbSNP
rs1363814850 3295 dbSNP
rs1015516833 3297 dbSNP
rs958682282 3298 dbSNP
rs1128692 3301 dbSNP
rs111446193 3302 dbSNP
rs1382133686 3303 dbSNP
rs146476824 3304 dbSNP
rs897461690 3305 dbSNP
rs111453906 3306 dbSNP
rs568533881 3307 dbSNP
rs754102433 3311 dbSNP
rs1487046309 3331 dbSNP
rs1045886 3345 dbSNP
rs548340695 3350 dbSNP
rs1255987026 3355 dbSNP
rs1444745117 3359 dbSNP
rs113730157 3360 dbSNP
rs1302906800 3368 dbSNP
rs1423144277 3369 dbSNP
rs764277812 3370 dbSNP
rs962813004 3374 dbSNP
rs1302225018 3376 dbSNP
rs916656890 3380 dbSNP
rs991284507 3385 dbSNP
rs958585568 3386 dbSNP
rs1035893462 3389 dbSNP
rs1362688224 3391 dbSNP
rs531685296 3394 dbSNP
rs10133342 3408 dbSNP
rs967259457 3413 dbSNP
rs1019948226 3416 dbSNP
rs1221390593 3417 dbSNP
rs901931561 3418 dbSNP
rs1489800882 3425 dbSNP
rs1040468111 3430 dbSNP
rs1235892838 3451 dbSNP
rs1011183128 3454 dbSNP
rs1177432632 3459 dbSNP
rs935423541 3462 dbSNP
rs923922559 3464 dbSNP
rs78401946 3478 dbSNP
rs1406505940 3492 dbSNP
rs767539716 3494 dbSNP
rs113426815 3497 dbSNP
rs914520579 3513 dbSNP
rs1230367757 3515 dbSNP
rs1398217707 3517 dbSNP
rs1441481550 3528 dbSNP
rs370472521 3537 dbSNP
rs930248502 3543 dbSNP
rs958562038 3548 dbSNP
rs533034731 3549 dbSNP
rs1283086532 3553 dbSNP
rs1324702345 3555 dbSNP
rs117513134 3558 dbSNP
rs540815766 3566 dbSNP
rs571854789 3572 dbSNP
rs941357376 3574 dbSNP
rs1324679168 3578 dbSNP
rs1014569812 3580 dbSNP
rs1005913800 3581 dbSNP
rs916546588 3584 dbSNP
rs952376492 3593 dbSNP
rs762552673 3595 dbSNP
rs1029284314 3599 dbSNP
rs377567904 3603 dbSNP
rs1190266274 3604 dbSNP
rs990925167 3610 dbSNP
rs1156291527 3615 dbSNP
rs1481262137 3616 dbSNP
rs1473297135 3617 dbSNP
rs939397964 3619 dbSNP
rs1409472053 3630 dbSNP
rs996738145 3632 dbSNP
rs1171279794 3668 dbSNP
rs1356321464 3669 dbSNP
rs149907445 3675 dbSNP
rs981679991 3679 dbSNP
rs1040540375 3682 dbSNP
rs1020170437 3692 dbSNP
rs1276880825 3695 dbSNP
rs1339365084 3701 dbSNP
rs1215637187 3703 dbSNP
rs1248207509 3718 dbSNP
rs1319388791 3723 dbSNP
rs1221295614 3741 dbSNP
rs999539524 3750 dbSNP
rs190157058 3752 dbSNP
rs1222113873 3753 dbSNP
rs1490788357 3753 dbSNP
rs374964333 3753 dbSNP
rs1241279211 3754 dbSNP
rs1446339548 3755 dbSNP
rs575960805 3760 dbSNP
rs1421759714 3763 dbSNP
rs990001495 3766 dbSNP
rs116425757 3767 dbSNP
rs1366375237 3769 dbSNP
rs1426761731 3772 dbSNP
rs375971812 3773 dbSNP
rs1326206443 3775 dbSNP
rs1432181924 3776 dbSNP
rs868384611 3791 dbSNP
rs1272373778 3796 dbSNP
rs1376348420 3797 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' aucACACCACU---GCACUCCa 3'
1 - 19
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000395834.1 | 3UTR | AUCACACCACUGCACUCCAACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*