Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT438610 [miRNA, hsa-miR-15a-5p :: RET, target gene]
miRTarBase - #MIRT438610 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RET   
Synonyms CDHF12, CDHR16, HSCR1, MEN2A, MEN2B, MTC1, PTC, RET-ELE1, RET51
Description ret proto-oncogene
Transcript NM_020975   
Other Transcripts NM_020630   
Expression
Putative miRNA Targets on RET
3'UTR of RET
(miRNA target sites are highlighted)
>RET|NM_020975|3'UTR
   1 CATTTCTTTGTGAAAGGTAATGGACTCACAAGGGGAAGAAACATGCTGAGAATGGAAAGTCTACCGGCCCTTTCTTTGTG
  81 AACGTCACATTGGCCGAGCCGTGTTCAGTTCCCAGGTGGCAGACTCGTTTTTGGTAGTTTGTTTTAACTTCCAAGGTGGT
 161 TTTACTTCTGATAGCCGGTGATTTTCCCTCCTAGCAGACATGCCACACCGGGTAAGAGCTCTGAGTCTTAGTGGTTAAGC
 241 ATTCCTTTCTCTTCAGTGCCCAGCAGCACCCAGTGTTGGTCTGTGTCCATCAGTGACCACCAACATTCTGTGTTCACATG
 321 TGTGGGTCCAACACTTACTACCTGGTGTATGAAATTGGACCTGAACTGTTGGATTTTTCTAGTTGCCGCCAAACAAGGCA
 401 AAAAAATTTAAACATGAAGCACACACACAAAAAAGGCAGTAGGAAAAATGCTGGCCCTGATGACCTGTCCTTATTCAGAA
 481 TGAGAGACTGCGGGGGGGGCCTGGGGGTAGTGTCAATGCCCCTCCAGGGCTGGAGGGGAAGAGGGGCCCCGAGGATGGGC
 561 CTGGGCTCAGCATTCGAGATCTTGAGAATGATTTTTTTTTAATCATGCAACCTTTCCTTAGGAAGACATTTGGTTTTCAT
 641 CATGATTAAGATGATTCCTAGATTTAGCACAATGGAGAGATTCCATGCCATCTTTACTATGTGGATGGTGGTATCAGGGA
 721 AGAGGGCTCACAAGACACATTTGTCCCCCGGGCCCACCACATCATCCTCACGTGTTCGGTACTGAGCAGCCACTACCCCT
 801 GATGAGAACAGTATGAAGAAAGGGGGCTGTTGGAGTCCCAGAATTGCTGACAGCAGAGGCTTTGCTGCTGTGAATCCCAC
 881 CTGCCACCAGCCTGCAGCACACCCCACAGCCAAGTAGAGGCGAAAGCAGTGGCTCATCCTACCTGTTAGGAGCAGGTAGG
 961 GCTTGTACTCACTTTAATTTGAATCTTATCAACTTACTCATAAAGGGACAGGCTAGCTAGCTGTGTTAGAAGTAGCAATG
1041 ACAATGACCAAGGACTGCTACACCTCTGATTACAATTCTGATGTGAAAAAGATGGTGTTTGGCTCTTATAGAGCCTGTGT
1121 GAAAGGCCCATGGATCAGCTCTTCCTGTGTTTGTAATTTAATGCTGCTACAAGATGTTTCTGTTTCTTAGATTCTGACCA
1201 TGACTCATAAGCTTCTTGTCATTCTTCATTGCTTGTTTGTGGTCACAGATGCACAACACTCCTCCAGTCTTGTGGGGGCA
1281 GCTTTTGGGAAGTCTCAGCAGCTCTTCTGGCTGTGTTGTCAGCACTGTAACTTCGCAGAAAAGAGTCGGATTACCAAAAC
1361 ACTGCCTGCTCTTCAGACTTAAAGCACTGATAGGACTTAAAATAGTCTCATTCAAATACTGTATTTTATATAGGCATTTC
1441 ACAAAAACAGCAAAATTGTGGCATTTTGTGAGGCCAAGGCTTGGATGCGTGTGTAATAGAGCCTTGTGGTGTGTGCGCAC
1521 ACACCCAGAGGGAGAGTTTGAAAAATGCTTATTGGACACGTAACCTGGCTCTAATTTGGGCTGTTTTTCAGATACACTGT
1601 GATAAGTTCTTTTACAAATATCTATAGACATGGTAAACTTTTGGTTTTCAGATATGCTTAATGATAGTCTTACTAAATGC
1681 AGAAATAAGAATAAACTTTCTCAAATTATTAAAAATGCCTACACAGTAAGTGTGAATTGCTGCAACAGGTTTGTTCTCAG
1761 GAGGGTAAGAACTCCAGGTCTAAACAGCTGACCCAGTGATGGGGAATTTATCCTTGACCAATTTATCCTTGACCAATAAC
1841 CTAATTGTCTATTCCTGAGTTATAAAAGTCCCCATCCTTATTAGCTCTACTGGAATTTTCATACACGTAAATGCAGAAGT
1921 TACTAAGTATTAAGTATTACTGAGTATTAAGTAGTAATCTGTCAGTTATTAAAATTTGTAAAATCTATTTATGAAAGGTC
2001 ATTAAACCAGATCATGTTCCTTTTTTTGTAATCAAGGTGACTAAGAAAATCAGTTGTGTAAATAAAATCATGTATCATAA
2081 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  |||   ||||||| 
Target 5' tgtttgtaATTTAATGCTGCTa 3'
1148 - 1169 146.00 -10.80
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:|   ||   ||||||| 
Target 5' agCAGAGGCTT---TGCTGCTg 3'
852 - 870 145.00 -14.90
3
miRNA  3' guGU-UUGGUAAUAC---ACGACGau 5'
            || |:: | |:||   ||||||  
Target 5' taCACAGTAAGTGTGAATTGCTGCaa 3'
1720 - 1745 132.00 -14.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
877386 30 ClinVar
299902 85 ClinVar
299903 96 ClinVar
879000 160 ClinVar
299904 176 ClinVar
880217 181 ClinVar
299905 331 ClinVar
299906 359 ClinVar
299907 369 ClinVar
299908 389 ClinVar
299909 447 ClinVar
299910 454 ClinVar
299911 492 ClinVar
877445 493 ClinVar
878467 501 ClinVar
299912 507 ClinVar
299913 510 ClinVar
299914 539 ClinVar
299915 554 ClinVar
299916 577 ClinVar
299917 601 ClinVar
299918 745 ClinVar
299919 764 ClinVar
299920 825 ClinVar
877490 884 ClinVar
299921 936 ClinVar
299922 1021 ClinVar
878517 1047 ClinVar
299923 1104 ClinVar
299924 1110 ClinVar
879101 1113 ClinVar
299925 1117 ClinVar
299926 1131 ClinVar
299927 1213 ClinVar
299928 1234 ClinVar
299929 1274 ClinVar
877535 1327 ClinVar
299930 1338 ClinVar
299931 1346 ClinVar
299932 1349 ClinVar
878562 1431 ClinVar
299933 1490 ClinVar
299934 1507 ClinVar
880357 1517 ClinVar
877587 1534 ClinVar
299935 1559 ClinVar
299936 1584 ClinVar
299937 1592 ClinVar
299938 1600 ClinVar
299939 1645 ClinVar
299940 1647 ClinVar
299941 1660 ClinVar
299942 1743 ClinVar
299943 1798 ClinVar
299944 1798 ClinVar
877645 1813 ClinVar
299945 1871 ClinVar
878659 1887 ClinVar
879260 1901 ClinVar
13954 1970 ClinVar
COSN21530511 7 COSMIC
COSN30477310 7 COSMIC
COSN30484874 36 COSMIC
COSN31590151 67 COSMIC
COSN30193573 85 COSMIC
COSN28667782 94 COSMIC
COSN15659980 96 COSMIC
COSN30149041 101 COSMIC
COSN30504640 121 COSMIC
COSN31505469 133 COSMIC
COSN8640078 164 COSMIC
COSN23365645 188 COSMIC
COSN19493699 234 COSMIC
COSN21532449 245 COSMIC
COSN31567992 250 COSMIC
COSN21531989 316 COSMIC
COSN31532593 343 COSMIC
COSN6970725 389 COSMIC
COSN20454509 408 COSMIC
COSN31522788 413 COSMIC
COSN31567432 432 COSMIC
COSN8640079 463 COSMIC
COSN31516580 492 COSMIC
COSN20509994 493 COSMIC
COSN31556616 494 COSMIC
COSN31526864 500 COSMIC
COSN28644171 601 COSMIC
COSN22405598 764 COSMIC
COSN31532634 772 COSMIC
COSN31561744 779 COSMIC
COSN31563337 1103 COSMIC
COSN31592820 1116 COSMIC
COSN28787761 1117 COSMIC
COSN26638253 1148 COSMIC
COSN31564847 1157 COSMIC
COSN31522793 1279 COSMIC
COSN31550329 1280 COSMIC
COSN31543762 1517 COSMIC
COSN31602821 1546 COSMIC
COSN8185424 1590 COSMIC
COSN31556617 1606 COSMIC
COSN31584701 1610 COSMIC
COSN22005201 1628 COSMIC
COSN28201900 1751 COSMIC
rs2435355 1117 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1006334638 7 dbSNP
rs767797283 7 dbSNP
rs754150221 9 dbSNP
rs552689504 17 dbSNP
rs758171346 18 dbSNP
rs199639914 30 dbSNP
rs964782677 33 dbSNP
rs1164946666 38 dbSNP
rs1390760145 43 dbSNP
rs1386740298 45 dbSNP
rs746548497 46 dbSNP
rs554412445 49 dbSNP
rs1353359492 59 dbSNP
rs572882220 62 dbSNP
rs1416867855 64 dbSNP
rs1464792143 66 dbSNP
rs528719922 67 dbSNP
rs1030554238 69 dbSNP
rs954548551 84 dbSNP
rs558718557 85 dbSNP
rs1180575612 88 dbSNP
rs576596502 89 dbSNP
rs17028 96 dbSNP
rs990520144 97 dbSNP
rs989798683 101 dbSNP
rs562423497 102 dbSNP
rs771806847 103 dbSNP
rs1278142026 107 dbSNP
rs921056011 109 dbSNP
rs1329545645 110 dbSNP
rs1290154987 118 dbSNP
rs1226432250 120 dbSNP
rs1334831991 121 dbSNP
rs574541792 127 dbSNP
rs542197260 128 dbSNP
rs1449556341 134 dbSNP
rs1268210524 135 dbSNP
rs866607851 141 dbSNP
rs1458105715 173 dbSNP
rs886046990 176 dbSNP
rs938882200 177 dbSNP
rs1472584289 186 dbSNP
rs1415126007 202 dbSNP
rs1340059795 208 dbSNP
rs1047959746 210 dbSNP
rs772972038 211 dbSNP
rs1260040151 213 dbSNP
rs912400736 226 dbSNP
rs750235070 236 dbSNP
rs1213599792 239 dbSNP
rs760430228 260 dbSNP
rs1291312910 265 dbSNP
rs1453840565 277 dbSNP
rs1269863187 290 dbSNP
rs1206575120 308 dbSNP
rs1191413220 309 dbSNP
rs1313307374 312 dbSNP
rs1241917650 323 dbSNP
rs141460872 331 dbSNP
rs1037744929 350 dbSNP
rs1193990737 353 dbSNP
rs1376270009 357 dbSNP
rs886046991 359 dbSNP
rs756051983 369 dbSNP
rs1313926677 370 dbSNP
rs1425126893 374 dbSNP
rs74985876 375 dbSNP
rs900183928 376 dbSNP
rs1319022223 388 dbSNP
rs3026782 389 dbSNP
rs995488837 395 dbSNP
rs868001503 398 dbSNP
rs1055044570 404 dbSNP
rs895106692 408 dbSNP
rs1189292251 409 dbSNP
rs1451626475 411 dbSNP
rs776208853 419 dbSNP
rs1186490507 423 dbSNP
rs564684954 425 dbSNP
rs1315914130 426 dbSNP
rs1359708136 428 dbSNP
rs1030113616 429 dbSNP
rs879219838 429 dbSNP
rs1290471000 431 dbSNP
rs954517352 435 dbSNP
rs999396875 443 dbSNP
rs886046992 447 dbSNP
rs1294894136 453 dbSNP
rs886046993 454 dbSNP
rs1030844397 475 dbSNP
rs112831036 481 dbSNP
rs550523226 487 dbSNP
rs1295808099 489 dbSNP
rs1435034485 491 dbSNP
rs201945709 492 dbSNP
rs886046994 492 dbSNP
rs989427123 492 dbSNP
rs989847929 492 dbSNP
rs568766449 493 dbSNP
rs1427705241 494 dbSNP
rs759025154 495 dbSNP
rs764840727 496 dbSNP
rs928757875 497 dbSNP
rs771336993 499 dbSNP
rs1047850811 500 dbSNP
rs564665995 501 dbSNP
rs942251108 504 dbSNP
rs886046995 507 dbSNP
rs548173921 508 dbSNP
rs566296190 509 dbSNP
rs886046996 510 dbSNP
rs1186159776 513 dbSNP
rs1368567398 517 dbSNP
rs995889582 519 dbSNP
rs1046505420 520 dbSNP
rs1297673899 522 dbSNP
rs1466794564 536 dbSNP
rs886046997 539 dbSNP
rs1379562776 541 dbSNP
rs1051504737 542 dbSNP
rs1479310564 542 dbSNP
rs1428543269 543 dbSNP
rs902577299 544 dbSNP
rs1483751882 550 dbSNP
rs1473719069 552 dbSNP
rs886046998 554 dbSNP
rs1156791950 557 dbSNP
rs1247890023 563 dbSNP
rs533907181 569 dbSNP
rs558217664 573 dbSNP
rs576656916 576 dbSNP
rs185408658 577 dbSNP
rs996432579 583 dbSNP
rs1230841021 584 dbSNP
rs1306444271 592 dbSNP
rs1395694718 592 dbSNP
rs886046999 592 dbSNP
rs1029634372 593 dbSNP
rs1030813783 597 dbSNP
rs953750077 600 dbSNP
rs988757343 600 dbSNP
rs2742240 601 dbSNP
rs1159625250 611 dbSNP
rs867764036 612 dbSNP
rs1180521462 613 dbSNP
rs1023582489 624 dbSNP
rs972573720 630 dbSNP
rs1309255721 639 dbSNP
rs970456860 645 dbSNP
rs1257867867 652 dbSNP
rs919764191 660 dbSNP
rs574402179 673 dbSNP
rs1242690764 675 dbSNP
rs764746553 683 dbSNP
rs960084274 687 dbSNP
rs541713530 688 dbSNP
rs1349206813 693 dbSNP
rs1260604828 696 dbSNP
rs949437288 698 dbSNP
rs908016498 705 dbSNP
rs1342281943 710 dbSNP
rs942239472 712 dbSNP
rs1046828340 718 dbSNP
rs902632382 725 dbSNP
rs974054435 728 dbSNP
rs3026783 729 dbSNP
rs1256215263 732 dbSNP
rs886047000 745 dbSNP
rs935409638 745 dbSNP
rs1053830989 746 dbSNP
rs554160069 750 dbSNP
rs1382744951 751 dbSNP
rs1157882846 759 dbSNP
rs886047001 764 dbSNP
rs893996058 768 dbSNP
rs572314050 772 dbSNP
rs1051397767 773 dbSNP
rs373663381 778 dbSNP
rs751939293 779 dbSNP
rs890682130 784 dbSNP
rs949739223 794 dbSNP
rs935046116 797 dbSNP
rs1160183525 798 dbSNP
rs546311946 802 dbSNP
rs1465708288 803 dbSNP
rs868398610 810 dbSNP
rs1210887791 818 dbSNP
rs1289759170 819 dbSNP
rs1052208691 822 dbSNP
rs1173430269 824 dbSNP
rs886047002 825 dbSNP
rs1437042916 826 dbSNP
rs1324416136 829 dbSNP
rs1010774935 830 dbSNP
rs1404429349 836 dbSNP
rs1389818127 839 dbSNP
rs190116296 845 dbSNP
rs1161172987 846 dbSNP
rs1423407683 849 dbSNP
rs1390424113 865 dbSNP
rs1023971500 867 dbSNP
rs1170033509 868 dbSNP
rs564549781 869 dbSNP
rs531989073 882 dbSNP
rs1200008316 886 dbSNP
rs1449685746 897 dbSNP
rs1267344606 901 dbSNP
rs1221883929 916 dbSNP
rs1035631314 919 dbSNP
rs550170271 922 dbSNP
rs1277056981 923 dbSNP
rs1301658759 929 dbSNP
rs1269425217 931 dbSNP
rs983486610 934 dbSNP
rs886047003 936 dbSNP
rs1015042252 939 dbSNP
rs916540978 942 dbSNP
rs757629939 943 dbSNP
rs949320569 951 dbSNP
rs1403814591 957 dbSNP
rs963875302 960 dbSNP
rs544018393 982 dbSNP
rs982018125 983 dbSNP
rs1309309637 990 dbSNP
rs1407916456 994 dbSNP
rs973554630 1000 dbSNP
rs923938527 1002 dbSNP
rs138493014 1019 dbSNP
rs886047004 1021 dbSNP
rs529592624 1024 dbSNP
rs932195153 1033 dbSNP
rs1199260655 1034 dbSNP
rs987741746 1039 dbSNP
rs143948954 1047 dbSNP
rs756179310 1050 dbSNP
rs935015045 1052 dbSNP
rs1437500839 1056 dbSNP
rs1279547473 1061 dbSNP
rs1200841809 1062 dbSNP
rs1051028833 1073 dbSNP
rs1281302103 1085 dbSNP
rs1180476888 1086 dbSNP
rs1351018428 1094 dbSNP
rs890746652 1095 dbSNP
rs886047005 1104 dbSNP
rs1264979335 1108 dbSNP
rs886047006 1110 dbSNP
rs1353594500 1113 dbSNP
rs2435355 1117 dbSNP
rs1471169039 1118 dbSNP
rs1199849453 1128 dbSNP
rs572936041 1131 dbSNP
rs879461597 1134 dbSNP
rs1175585515 1135 dbSNP
rs1469643486 1136 dbSNP
rs946463063 1138 dbSNP
rs1460676077 1139 dbSNP
rs1238278985 1141 dbSNP
rs1170005653 1143 dbSNP
rs1189798393 1147 dbSNP
rs1401170391 1148 dbSNP
rs1026714500 1152 dbSNP
rs952462426 1168 dbSNP
rs1012117081 1182 dbSNP
rs758303610 1192 dbSNP
rs1023898179 1195 dbSNP
rs1286212804 1201 dbSNP
rs1221598716 1203 dbSNP
rs1467622682 1204 dbSNP
rs1371914926 1207 dbSNP
rs1284433385 1212 dbSNP
rs551902553 1213 dbSNP
rs970546158 1215 dbSNP
rs570206266 1225 dbSNP
rs1336544485 1229 dbSNP
rs1458055924 1231 dbSNP
rs1347483892 1233 dbSNP
rs886047007 1234 dbSNP
rs1157479719 1238 dbSNP
rs777756501 1240 dbSNP
rs1387637416 1244 dbSNP
rs1165062235 1248 dbSNP
rs905041974 1249 dbSNP
rs746810657 1256 dbSNP
rs982455243 1260 dbSNP
rs535667130 1261 dbSNP
rs923824692 1264 dbSNP
rs9971097 1270 dbSNP
rs1034929386 1273 dbSNP
rs1332418440 1274 dbSNP
rs886047008 1274 dbSNP
rs147336674 1275 dbSNP
rs989460912 1276 dbSNP
rs1213477497 1279 dbSNP
rs1316269773 1280 dbSNP
rs1004876964 1283 dbSNP
rs35856296 1287 dbSNP
rs761472636 1298 dbSNP
rs1356861151 1304 dbSNP
rs1313853154 1305 dbSNP
rs776277370 1314 dbSNP
rs555944246 1326 dbSNP
rs141016377 1327 dbSNP
rs745534552 1335 dbSNP
rs963459590 1336 dbSNP
rs886047009 1338 dbSNP
rs1263683776 1341 dbSNP
rs1488121588 1342 dbSNP
rs1165594500 1344 dbSNP
rs886047010 1346 dbSNP
rs149252070 1349 dbSNP
rs1384871411 1365 dbSNP
rs912066028 1370 dbSNP
rs1476943723 1381 dbSNP
rs115358030 1382 dbSNP
rs953552512 1390 dbSNP
rs1485533811 1392 dbSNP
rs1037051951 1394 dbSNP
rs1478882251 1400 dbSNP
rs987712066 1406 dbSNP
rs1489603029 1407 dbSNP
rs1290581035 1428 dbSNP
rs912183233 1430 dbSNP
rs775114955 1431 dbSNP
rs1308878378 1432 dbSNP
rs762590499 1443 dbSNP
rs1214319154 1450 dbSNP
rs764691685 1451 dbSNP
rs3026784 1456 dbSNP
rs1349750276 1457 dbSNP
rs1305440708 1459 dbSNP
rs946462631 1466 dbSNP
rs1045239610 1467 dbSNP
rs926444517 1468 dbSNP
rs1295615355 1469 dbSNP
rs555071393 1471 dbSNP
rs148393331 1478 dbSNP
rs1463777095 1481 dbSNP
rs535080963 1490 dbSNP
rs1427647709 1504 dbSNP
rs888079888 1505 dbSNP
rs1201409403 1506 dbSNP
rs2742241 1507 dbSNP
rs1023359997 1514 dbSNP
rs886985086 1517 dbSNP
rs1004092534 1518 dbSNP
rs181388347 1533 dbSNP
rs899181624 1537 dbSNP
rs1204295965 1547 dbSNP
rs1219866857 1552 dbSNP
rs1313090532 1553 dbSNP
rs762178593 1556 dbSNP
rs142572876 1559 dbSNP
rs953521182 1561 dbSNP
rs1345423928 1566 dbSNP
rs186000190 1570 dbSNP
rs1245480170 1572 dbSNP
rs1393185781 1582 dbSNP
rs192065891 1584 dbSNP
rs76759170 1592 dbSNP
rs1461295120 1596 dbSNP
rs145954635 1600 dbSNP
rs756269717 1615 dbSNP
rs1489400895 1623 dbSNP
rs1178302073 1625 dbSNP
rs1468211731 1631 dbSNP
rs1180142337 1634 dbSNP
rs117119161 1645 dbSNP
rs886047011 1647 dbSNP
rs753913049 1652 dbSNP
rs139925563 1655 dbSNP
rs886047012 1660 dbSNP
rs1247996458 1679 dbSNP
rs944895276 1681 dbSNP
rs544885679 1683 dbSNP
rs919544402 1691 dbSNP
rs1167587908 1698 dbSNP
rs1202148860 1712 dbSNP
rs926413705 1723 dbSNP
rs1323502322 1730 dbSNP
rs1269279819 1733 dbSNP
rs1241309033 1734 dbSNP
rs1333982227 1737 dbSNP
rs939104646 1742 dbSNP
rs143369221 1743 dbSNP
rs1396884993 1746 dbSNP
rs755113276 1750 dbSNP
rs1049264367 1764 dbSNP
rs888130470 1766 dbSNP
rs947716147 1767 dbSNP
rs1159017646 1769 dbSNP
rs1419556265 1776 dbSNP
rs908394790 1780 dbSNP
rs939931209 1787 dbSNP
rs1045245074 1793 dbSNP
rs906263568 1794 dbSNP
rs886047013 1798 dbSNP
rs1244567860 1800 dbSNP
rs756385643 1805 dbSNP
rs892268965 1808 dbSNP
rs1263047788 1810 dbSNP
rs183817000 1813 dbSNP
rs1300532976 1814 dbSNP
rs1260265282 1817 dbSNP
rs995283390 1822 dbSNP
rs1361900610 1826 dbSNP
rs1313127455 1827 dbSNP
rs1450199631 1848 dbSNP
rs1050498758 1865 dbSNP
rs1228801508 1869 dbSNP
rs889165676 1870 dbSNP
rs146771196 1871 dbSNP
rs35911434 1876 dbSNP
rs1287825682 1878 dbSNP
rs986132666 1878 dbSNP
rs1019488309 1880 dbSNP
rs1019095754 1887 dbSNP
rs746921948 1890 dbSNP
rs972088872 1891 dbSNP
rs956882000 1901 dbSNP
rs1374048229 1906 dbSNP
rs188882445 1907 dbSNP
rs919430359 1908 dbSNP
rs1239086192 1917 dbSNP
rs1445813942 1920 dbSNP
rs1261591584 1935 dbSNP
rs1009807577 1942 dbSNP
rs1289870544 1949 dbSNP
rs985020345 1949 dbSNP
rs1023003252 1951 dbSNP
rs763658875 1962 dbSNP
rs3026785 1970 dbSNP
rs1340306491 1979 dbSNP
rs1270603112 1980 dbSNP
rs1229302125 1986 dbSNP
rs1324653545 1988 dbSNP
rs947733162 1988 dbSNP
rs1236953903 1999 dbSNP
rs1405048583 2004 dbSNP
rs1366966529 2013 dbSNP
rs1483654000 2021 dbSNP
rs865786570 2021 dbSNP
rs1228311904 2032 dbSNP
rs191974370 2040 dbSNP
rs1423658428 2043 dbSNP
rs1396729345 2057 dbSNP
rs542427089 2073 dbSNP
rs1033312043 2082 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions K562 , HL-60 , TPH-1
Location of target site 3'UTR
Original Description (Extracted from the article) ... In the Renilla-luciferase assay, we inserted the 3'-UTR region of RET in the 3'-UTR of Renilla gene in psiCheck2 vector (modified psicheck2 vector). When we transfected the cells with either the modified psicheck2 vector and each pre-miRNA of interest or the modified vector and pre-miR-negative control, we found that five miRNAs (miR-218, miR-128, miR-27b, miR-15a, miR-195) significantly downregulated Renilla translation by binding to the RET 3'-UTR region, as observed by a reduction of 41–49% in Renilla activity at 24 hours after transfection (Figure 3a), indicating that RET is a target of these miRNAs. ...

- Diaz-Beya M; Navarro A; Ferrer G; Diaz T; et al., 2013, Leukemia.

Article - Diaz-Beya M; Navarro A; Ferrer G; Diaz T; et al.
- Leukemia, 2013
Acute myeloid leukemia (AML) with t(8;16)(p11;p13) (t(8;16) AML) has unique clinico-biological characteristics, but its microRNA pattern is unknown. We analyzed 670 microRNAs in seven patients with t(8;16) AML and 113 with other AML subtypes. Hierarchical cluster analysis showed that all t(8;16) AML patients grouped in an independent cluster. Supervised analysis revealed a distinctive signature of 94-microRNAs, most of which were downregulated, including miR-21 and cluster miR-17-92. The mRNA expression analysis of two known transcription factors of these microRNAs (STAT3 and c-Myc, respectively) showed significant downregulation of STAT3 (P=0.04). A bioinformatic analysis showed that 29 of the downregulated microRNAs might be regulated by methylation; we treated a t(8;16) AML sample with 5-aza-2'-deoxycytidine (5-AZA-dC) and trichostatin A and found that 27 microRNAs were re-expressed after treatment. However, there was no difference in methylation status between t(8;16) and other AML subtypes, either overall or in the microRNA promoter. Cross-correlation of mRNA and microRNA expression identified RET as a potential target of several microRNAs. A Renilla-luciferase assay and flow cytometry after transfection with pre-microRNAs confirmed that RET is regulated by miR-218, miR-128, miR-27b, miR-15a and miR-195. In conclusion, t(8;16) AML harbors a specific microRNA signature that is partially epigenetically regulated and targets RET proto-oncogene.
LinkOut: [PMID: 23022987]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.259 4.6e-3 0.226 1.2e-2 100 Click to see details
GSE21032 Prostate cancer -0.201 3.4e-2 -0.144 9.7e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.385 4.7e-2 0.274 1.2e-1 20 Click to see details
GSE38226 Liver fibrosis -0.374 4.7e-2 -0.288 1.0e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.186 5.0e-2 0.149 9.5e-2 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.293 8.7e-2 -0.091 3.4e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.259 1.4e-1 0.349 6.6e-2 20 Click to see details
GSE21687 Ependynoma primary tumors -0.132 1.5e-1 -0.174 8.5e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.2 1.7e-1 0.287 8.2e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.268 2.0e-1 -0.119 3.6e-1 12 Click to see details
GSE28544 Breast cancer -0.143 2.5e-1 -0.545 2.9e-3 24 Click to see details
GSE14794 Lymphoblastoid cells 0.07 2.6e-1 0.062 2.8e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.146 2.9e-1 -0.115 3.4e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.162 3.0e-1 0.055 4.3e-1 13 Click to see details
GSE17306 Multiple myeloma 0.065 3.3e-1 0.034 4.1e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.086 3.4e-1 0.108 3.0e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.071 3.5e-1 -0.063 3.7e-1 32 Click to see details
GSE17498 Multiple myeloma 0.035 4.2e-1 0.113 2.4e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.034 4.4e-1 0.052 4.0e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.034 4.4e-1 0.052 4.0e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.034 4.4e-1 0.052 4.0e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.758 0 -0.782 0 32 Click to see details
HNSC -0.306 0.02 -0.307 0.02 42 Click to see details
COAD -0.704 0.03 -0.762 0.01 8 Click to see details
LIHC -0.226 0.06 -0.252 0.04 49 Click to see details
LUAD -0.454 0.07 -0.329 0.15 12 Click to see details
CHOL -0.504 0.08 -0.183 0.32 9 Click to see details
PAAD -0.827 0.09 -0.800 0.1 4 Click to see details
BRCA 0.146 0.09 0.043 0.35 84 Click to see details
BLCA 0.235 0.17 0.117 0.32 18 Click to see details
KIRC 0.11 0.19 0.109 0.19 68 Click to see details
UCEC -0.196 0.21 -0.086 0.36 19 Click to see details
ESCA -0.231 0.25 -0.064 0.43 11 Click to see details
PRAD 0.098 0.25 0.024 0.43 50 Click to see details
KICH 0.112 0.3 0.128 0.27 25 Click to see details
CESC -0.582 0.3 -0.500 0.33 3 Click to see details
THCA -0.017 0.45 -0.028 0.42 59 Click to see details
KIRP -0.022 0.45 -0.109 0.28 32 Click to see details
LUSC -0.018 0.46 -0.086 0.3 38 Click to see details
PCPG -0.045 0.49 -0.500 0.33 3 Click to see details
PCPG -0.045 0.49 -0.500 0.33 3 Click to see details
PCPG -0.045 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*