miRTarBase - #MIRT438005 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MEF2D   
Synonyms -
Description myocyte enhancer factor 2D
Transcript NM_005920   
Expression
Putative miRNA Targets on MEF2D
3'UTR of MEF2D
(miRNA target sites are highlighted)
>MEF2D|NM_005920|3'UTR
   1 CGATTCCCACTCCCCTCCTCTCAGCCTCCCTGATGAAGAGTTGACAATCTCACCGCCCGCCCTTCCCTGCCCCGGGCTCC
  81 TCCCGCTCGACCCCCACTTCCTTTCTTGTGCTTCGTGTCCTGTTGACGGTTACATTTGTGTATAATTATTATATTATTAT
 161 TATTATTATTATATTTTTTTTAATTTGGATTCTCGCTTTGGAGAGGGGGATGCTCTCATCCCCTCTTTCTGTACCCCCCA
 241 CCATTTTCACTGGCTGGGGGGCTCTCTTTTTCGCGGGAAGGGGGGACACTTTGCACGTTGTACACATATGCTGCAGGAAG
 321 GGGGTGGGGGGCCCAATAAGGCCTTTGGGAAAGGACAGGTGCCGAGCCCTGCATGTGGAGCCCTCCCACCCCACCCCCAG
 401 ATAGAGGGAAATAACCAAAAAACTACCAAACAACAGAAACCCACACTCTAGACTGAAACCCCAAAGTGGGCTTGATGGGT
 481 GGGTTTGTGTTTCAAGGGGAAAGTGAGGCAGAGGTTCTGAAAAGGGTCTCTGTTTTTGTGTTCATGTAGCCATAGGCACA
 561 TGGAGCAGAATACTTAAGCCTGGCCCCCAAATGCCCCTGCACACACACGTGCCACACCTGCGCTGATTCTTGTGTGTGCT
 641 GCACCCCCAAGGTGTGTGGGTGCTGGCTGAGCTTTGGGCCGGGAAGGCAGCCTGGGAATCTGAGGCTGGAGACAGGGGTT
 721 TGAGGTGGGGGCCTCTCTGGAAGCACATTTGGAGGGAAAGACAAGAGAGCCATGAGGAGAGGGCTGAGGAGGGCAGAAGG
 801 GCTAGGCAGGGGGCAAATTGAGCCCCTCCCTTCCCCAGTTTTTCTCTAAGATATACAGTGCAATAGCTCCCCACCCCTCA
 881 GTTGACGCCAGCCCTGTAAAGCTGGCCACAGTGTGCAGGGAGAATGGGGAGAGGGTCTTCAGTGAGGTGGCTGGGGCGAG
 961 AGTCGGCCTGGACTTCCCTGGGGTGCTCCAGGCCAGAGCTCTTTCATTGGGGCGAGTGTGGTGAGGGGACGTCCTTGGTC
1041 TTGCACGCACACTACCTGGGGGAGTCAACACTGGGATGGTCTGTGGGGTGGGAGGGCCTACGGATGGGTCCGTAGAGGTC
1121 CCACCTCCCTCATTCCTCCTTGGCCCCTCTCCCTAGCTTCTCCTGTTAGCTCCTTCTGCTCCTGACCCCACCTCCTTGCT
1201 CTTGGCGCCCCTATTGTCTCTGGCTACCTCCTTGTCCCACCACCTCCAGGCTGCATCCCACCTTCCCTCTTGGCTACTGT
1281 AATTGTAAATAGCGACCTTTGGAAAACGTTAGCGGTGTAACAGTCCAGGAAACTGTTTTTTTTTGTTGTTGTTGTATTGA
1361 TATGAAATGAGATTCTATTTTTGTCAAAGTATATTGTAATAATAATGACTCAAACGGCCCGTACTGTACAGACGAGATTC
1441 TTCTGCTGTTGTTCTTGCTCCCCTCCCCTCCTCTGAGTCCGCCCCTCCCTGCTGCCTCCTCAGTGGGGCAGTGGGCAAGG
1521 GGCCCAGGGGCAGCCGAAGCACGGGGTCCTGAGACCTCAGGCAGGATTGGAGATCAAACCAGAGGGGGCAGGCCCCCAGC
1601 CTGCTCTCTAGGATCACCCCCCGCCCTAAGGGGCCTGGCCTGGGGTGACGTGGCCAGGCAGACTGTCTGCCCCACTCCTT
1681 CACACAAGCCCAGCTCCTCTGCCCAAGGGGTGCGGCGCCCCCTTGGGGTTTCCTCCCAGTTGGAGAGTAGAGTTAAGACA
1761 AGGCCCAGTTTTGTGTTAGCCGACCGTCTTTGCCCACCTCTATGACCCAGCCTCTTGCAGTATTCCCATACTTGATGCAG
1841 GGAAGGAACCAGAAGCAGAGGGGCCTCTACGCAGGTACACACGTGTACCTGAGTGTGTTCATGAGGGCATCTGGTGTTTA
1921 TGTGTCTGAGTGTAGCTTTGTATTTATGTGTGTGTGTGTGTGTATGTCTGATTGCACGGGTGTACTTTTGTATTTATGTG
2001 TGTGTGTGGTTGCACGGGTGTGCCTCTGTGTGTCTCTGACCCTGGCTGGGTGTGTGTGCAAATCTGTGTGACTGGAGCTC
2081 TAGGGGCATCTCTGTGTCTGAGTGTGCCTGGTGTGTGTTTACAAAGGGAGAGTTGGCTGCTCCAGCTCCACAGCCCTGGG
2161 ACCCCAACTCCTGTCTTCCCTGCTCCTTTCCCTGTGTTCACCCTCAGCTCTGACACATTGAACTGCAGTTGGGGGGATTG
2241 GCAGTTAGCCCTCTGTGCTTCTCCCTGCAGCCCTACCTCTGCCAAGGTCTCTCCCTCCAGGGACCTCTGCTTCCACCCAC
2321 ATATGTCCACTTAGTCACCCACACTTGACACAGTTCCTGGAGTACCCTCTTCCCCCAACCCCAGACCTGCTTTCAGAGCA
2401 AAACTCAAGTCCCTCTTCCTCCGTGAAGCTTCTCCCTCAGCTGAGCAGTGATCACTTACTCACTCTTAACCCCAATCCGC
2481 TGACTGGGTGGGGACAGCACGTCCAGCCTTCCCACCTCTCCTGCAGGCTTCTAGACGGAGTTTCAAAAACTGATGAGCCT
2561 CGATCCAGGGCTTGAAAGAAGCCAGGGTGTAATCTTGTTCATGCATGCGTCCCCAGAGCCTCGCCCAGTGCCTGGCACAT
2641 AGTAGGCACTCAATAAATGCTGAATGGGTGAATAGTTGAATGATAGGTGCTCAATAAATGAATGAATGGCCTTCCCTTCT
2721 CAGGCTATTCCCACCATTAGTCTGCCCACCTTTCTAGGCTGGGCTTGGCCACCATTAAACACGGGGTGGGGGTGAGGGCC
2801 CCTGCAATTCACGGTGCAATATTCACCAGTTTTGCCCTCTGCCTCATAAAGGCAAACCTGGCTTTTGATTACCATGTGTG
2881 GATGTTTCAGTGTCCTTTCTTCTCTGTCCCTGGGGATGGGGTGGTCTGTGAATATGTGACATTTCTGCAGTTCAGTATCC
2961 GAAGGTTTCTCTTGGGGGTAGGGGCTCCTGGGCGGCCAGATGAATGGGTCCCTGGGAACCCAGACCTCAGATGAGGACTT
3041 AATGTCTTCTTCCTCTCAAGCCAAATTCGCCTCCACCCACTCCCTCTGAAGAACTGGGCATTTGCCAAAGTAACCACTGG
3121 AGTCATCTAATGGCCCTCCCCCTCCCCAGGTTTCCCACAGCTTTCAGGGACAGTGGGCAAGAGGACACCCCCCCCCACCA
3201 CCTCAGTGGAACACACCATTCTCCCCCCCTCAACAGCACACTCAGTGCAGCAAGACTGACCCCTGACCCCCTCCCAGCCC
3281 TCCCTACCTTGGACAGGAAGGAAGTAATGCACCTTCTCTTGCTGATTATTTATTTGTTTGGAGAGACAGAAATGTAAAAG
3361 TGTATCTAGAAATATCTATATCTCTATATATTTTTAACTGACTCTTTGGAATCCCCTGGGGTGGGGTGAGGGGTAAGTTT
3441 AGGCTTTCGCGGAGGGGAGGAGACATGGAGCCTGGGAACTCCTTGTTCTCCCCTCTGCTGCCTCTCCCCACCCCTTAAAG
3521 CAGTTGGTAGAAGGAATGGTATTTGTATGGGGGGAGGGAGGCTGGAATGGAGAATCTGGATTCTCTCCTCTTCCCCATTC
3601 TCCAGAGGGAGGGAGGTGGTGAGGAAGAGGAAGGGAGGGGCAGGATGGGCCATGGAGGTGCCCCACCCCCACACCTGACA
3681 ATCACCCACACTCCTGGGGCTCTTCCTGGGTCCTGGGGCAGGGCGAGTCCAAGTGTGAGGCTGTTGATTTGTTTTCAATA
3761 TTTCTTTTCGTGCTGTATGGTGATGCTTTCTTAGTATTCTACACAATAAGAAAAGACAAAGTCCTCGAGATTCTTATGAG
3841 TTTTGTTTGAAAACTCTTTCACTATATTTGTTGTAAAGAGGTTTACTATTAAAAGAAAAAGAATACACGTTTCTGATACT
3921 TCGGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            | ||||     |||||||| 
Target 5' caATCACC-----CACACTCCt 3'
3679 - 3695 151.00 -17.10
2
miRNA  3' guUUGUGG--UAACAGUGUGAGGu 5'
            |||| |  |    |||||||: 
Target 5' caAACAACAGAAACCCACACTCTa 3'
427 - 450 134.00 -17.10
3
miRNA  3' guuUGUGGUAACA--------------GUGUGAGgu 5'
             |||||||| |              |||||||  
Target 5' aacACACCATTCTCCCCCCCTCAACAGCACACTCag 3'
3210 - 3245 133.00 -17.47
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31612436 1 COSMIC
COSN30488829 2 COSMIC
COSN30461943 12 COSMIC
COSN26574894 17 COSMIC
COSN30526219 22 COSMIC
COSN26984170 42 COSMIC
COSN26984172 54 COSMIC
COSN30578859 58 COSMIC
COSN30644210 59 COSMIC
COSN31494829 74 COSMIC
COSN30460357 80 COSMIC
COSN30472623 84 COSMIC
COSN26984169 85 COSMIC
COSN30126364 90 COSMIC
COSN30492214 105 COSMIC
COSN30498740 114 COSMIC
COSN30126611 153 COSMIC
COSN30126331 154 COSMIC
COSN31585964 155 COSMIC
COSN26669461 200 COSMIC
COSN16131744 203 COSMIC
COSN28785052 243 COSMIC
COSN31595586 273 COSMIC
COSN28662745 275 COSMIC
COSN31521593 286 COSMIC
COSN24298463 297 COSMIC
COSN30173722 364 COSMIC
COSN17038248 462 COSMIC
COSN17038246 466 COSMIC
COSN6003834 600 COSMIC
COSN5732278 646 COSMIC
COSN31540278 809 COSMIC
COSN30538937 893 COSMIC
COSN31610722 963 COSMIC
COSN31588336 967 COSMIC
COSN31537869 993 COSMIC
COSN31533207 996 COSMIC
COSN31539414 1030 COSMIC
COSN31542782 1034 COSMIC
COSN31594718 1148 COSMIC
COSN30542798 1231 COSMIC
COSN2511456 1246 COSMIC
COSN20095445 1335 COSMIC
COSN8636340 1342 COSMIC
COSN31583759 1418 COSMIC
COSN28138136 1421 COSMIC
COSN31960325 1641 COSMIC
COSN29325793 1927 COSMIC
COSN20095444 1946 COSMIC
COSN23240378 1947 COSMIC
COSN20090371 2476 COSMIC
COSN25813872 2766 COSMIC
COSN17181649 2816 COSMIC
COSN15337744 2889 COSMIC
COSN7178846 2961 COSMIC
COSN27944379 3032 COSMIC
COSN29418598 3066 COSMIC
COSN20772239 3194 COSMIC
COSN30172376 3209 COSMIC
COSN1090145 3223 COSMIC
COSN30163644 3260 COSMIC
COSN17038255 3268 COSMIC
COSN17038247 3269 COSMIC
COSN31481866 3345 COSMIC
COSN26638927 3596 COSMIC
COSN32082886 3627 COSMIC
COSN31601304 3660 COSMIC
COSN26638303 3724 COSMIC
COSN31607261 3769 COSMIC
COSN31481908 3827 COSMIC
COSN20866967 3910 COSMIC
rs1050316 2734 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768342831 1 dbSNP
rs1286217916 2 dbSNP
rs977869257 10 dbSNP
rs982195577 11 dbSNP
rs746871461 12 dbSNP
rs779843419 13 dbSNP
rs758173418 14 dbSNP
rs1020757973 19 dbSNP
rs745340293 20 dbSNP
rs752818500 23 dbSNP
rs778319755 25 dbSNP
rs757735074 30 dbSNP
rs1239637719 35 dbSNP
rs767762458 41 dbSNP
rs553751129 54 dbSNP
rs1019364833 55 dbSNP
rs1356932160 56 dbSNP
rs958222401 58 dbSNP
rs541777657 59 dbSNP
rs1032937565 72 dbSNP
rs574607089 73 dbSNP
rs1324705034 74 dbSNP
rs997001817 74 dbSNP
rs1457057975 75 dbSNP
rs953840402 77 dbSNP
rs1381626602 82 dbSNP
rs1296976486 84 dbSNP
rs1159843927 85 dbSNP
rs1436040067 87 dbSNP
rs1028254937 88 dbSNP
rs537925147 96 dbSNP
rs995796738 108 dbSNP
rs1360057068 109 dbSNP
rs556209577 111 dbSNP
rs1329558113 114 dbSNP
rs1379286842 115 dbSNP
rs1240940158 122 dbSNP
rs898499198 125 dbSNP
rs1004211518 127 dbSNP
rs575019158 128 dbSNP
rs907327387 136 dbSNP
rs1041265669 150 dbSNP
rs1008216387 151 dbSNP
rs1239600623 153 dbSNP
rs1165568240 154 dbSNP
rs887106987 170 dbSNP
rs1047156433 172 dbSNP
rs1054719442 173 dbSNP
rs1174762044 173 dbSNP
rs748414721 173 dbSNP
rs1188672266 174 dbSNP
rs931383339 175 dbSNP
rs919991854 181 dbSNP
rs1275361178 182 dbSNP
rs1329356591 182 dbSNP
rs1438528834 182 dbSNP
rs1317129817 195 dbSNP
rs1216542224 205 dbSNP
rs1257459210 206 dbSNP
rs1197860113 208 dbSNP
rs747225123 210 dbSNP
rs1452830484 213 dbSNP
rs937827024 215 dbSNP
rs1291784340 217 dbSNP
rs966352532 218 dbSNP
rs1338705870 221 dbSNP
rs1191988596 225 dbSNP
rs912337990 227 dbSNP
rs1229294123 234 dbSNP
rs537925930 235 dbSNP
rs1301608114 236 dbSNP
rs1436189859 240 dbSNP
rs1324178991 241 dbSNP
rs1339717750 242 dbSNP
rs1398021166 259 dbSNP
rs1279877470 262 dbSNP
rs1340829576 263 dbSNP
rs1331982392 267 dbSNP
rs1243705196 268 dbSNP
rs1325946788 268 dbSNP
rs926569900 272 dbSNP
rs571059334 273 dbSNP
rs1168646550 274 dbSNP
rs1431142534 275 dbSNP
rs1392869788 281 dbSNP
rs1187172295 284 dbSNP
rs1171583094 286 dbSNP
rs981753303 286 dbSNP
rs1478157103 288 dbSNP
rs1028535342 296 dbSNP
rs1164323043 297 dbSNP
rs1359919517 299 dbSNP
rs1179427005 306 dbSNP
rs995349949 308 dbSNP
rs970407345 321 dbSNP
rs913557729 331 dbSNP
rs1205953794 332 dbSNP
rs150376931 332 dbSNP
rs1341928732 336 dbSNP
rs1245001703 337 dbSNP
rs72994638 344 dbSNP
rs1350777329 349 dbSNP
rs1238696037 356 dbSNP
rs958045808 361 dbSNP
rs907191526 363 dbSNP
rs1486425744 366 dbSNP
rs1200206737 374 dbSNP
rs1254458128 375 dbSNP
rs185375713 380 dbSNP
rs1218799293 384 dbSNP
rs1346013976 388 dbSNP
rs1276921334 389 dbSNP
rs1237393128 393 dbSNP
rs1350371821 394 dbSNP
rs1465451609 395 dbSNP
rs1045805175 397 dbSNP
rs1404012492 399 dbSNP
rs1309234776 400 dbSNP
rs1412242241 402 dbSNP
rs1373032246 408 dbSNP
rs1332970087 409 dbSNP
rs1032052304 410 dbSNP
rs1414635369 412 dbSNP
rs1448321422 415 dbSNP
rs1309834626 417 dbSNP
rs1233092274 423 dbSNP
rs1318078937 423 dbSNP
rs1426891697 436 dbSNP
rs1012918360 438 dbSNP
rs567012748 443 dbSNP
rs1347577266 452 dbSNP
rs1204614350 456 dbSNP
rs1237783223 462 dbSNP
rs1456536805 466 dbSNP
rs894644579 482 dbSNP
rs548225589 501 dbSNP
rs936174204 503 dbSNP
rs41267367 508 dbSNP
rs1041954595 510 dbSNP
rs1484652919 525 dbSNP
rs1020324911 528 dbSNP
rs1169580932 532 dbSNP
rs1470109009 532 dbSNP
rs1235766696 545 dbSNP
rs945041703 546 dbSNP
rs912198156 556 dbSNP
rs986550318 579 dbSNP
rs953815857 580 dbSNP
rs1299805915 583 dbSNP
rs1347837235 584 dbSNP
rs1224477754 586 dbSNP
rs921015953 600 dbSNP
rs1200697674 604 dbSNP
rs1443190980 606 dbSNP
rs532947520 608 dbSNP
rs536226236 609 dbSNP
rs887136608 613 dbSNP
rs1047061249 621 dbSNP
rs1015946842 622 dbSNP
rs995441805 623 dbSNP
rs982636482 625 dbSNP
rs898583835 632 dbSNP
rs1170707000 635 dbSNP
rs1024218604 636 dbSNP
rs568850006 644 dbSNP
rs1055877839 645 dbSNP
rs1354142225 647 dbSNP
rs1292336932 648 dbSNP
rs1368044233 652 dbSNP
rs1406040040 657 dbSNP
rs937882752 659 dbSNP
rs894584354 660 dbSNP
rs905009362 670 dbSNP
rs1033084136 678 dbSNP
rs1448174371 679 dbSNP
rs370193446 680 dbSNP
rs9970660 681 dbSNP
rs949296149 686 dbSNP
rs112673830 690 dbSNP
rs766287653 692 dbSNP
rs903327676 695 dbSNP
rs913796604 708 dbSNP
rs1478673765 712 dbSNP
rs1412581830 714 dbSNP
rs1421653225 715 dbSNP
rs58899958 716 dbSNP
rs987808723 716 dbSNP
rs1425853455 719 dbSNP
rs755979067 727 dbSNP
rs376909183 729 dbSNP
rs1161141428 734 dbSNP
rs936315948 736 dbSNP
rs1433293037 739 dbSNP
rs925058489 746 dbSNP
rs758257815 754 dbSNP
rs964583127 756 dbSNP
rs546428234 757 dbSNP
rs140369520 761 dbSNP
rs1239412566 762 dbSNP
rs771206851 762 dbSNP
rs1448561320 765 dbSNP
rs951648536 769 dbSNP
rs1239414690 776 dbSNP
rs560813326 782 dbSNP
rs1236635424 783 dbSNP
rs1050784705 791 dbSNP
rs1361268031 792 dbSNP
rs995948904 795 dbSNP
rs1464641477 797 dbSNP
rs768435728 800 dbSNP
rs1438523756 812 dbSNP
rs1158622340 813 dbSNP
rs1378967641 815 dbSNP
rs921038630 818 dbSNP
rs1160317599 821 dbSNP
rs1358886632 823 dbSNP
rs1446096923 826 dbSNP
rs1338933244 833 dbSNP
rs1383687242 845 dbSNP
rs74116849 846 dbSNP
rs1289876986 847 dbSNP
rs1352780582 851 dbSNP
rs1228383471 853 dbSNP
rs182605263 854 dbSNP
rs1277662907 857 dbSNP
rs1380636560 858 dbSNP
rs1310217321 867 dbSNP
rs1205236765 868 dbSNP
rs1243348561 873 dbSNP
rs1294769549 879 dbSNP
rs562526308 886 dbSNP
rs749986855 887 dbSNP
rs982664108 894 dbSNP
rs767009827 899 dbSNP
rs1024166388 910 dbSNP
rs1178905055 911 dbSNP
rs1459712100 918 dbSNP
rs532014362 919 dbSNP
rs949159882 920 dbSNP
rs991477750 923 dbSNP
rs1349218668 924 dbSNP
rs1274164222 926 dbSNP
rs958714123 933 dbSNP
rs1407026080 935 dbSNP
rs1225081407 937 dbSNP
rs892396698 957 dbSNP
rs761511955 958 dbSNP
rs1000256139 964 dbSNP
rs1196303281 965 dbSNP
rs936372418 968 dbSNP
rs1274503461 971 dbSNP
rs924953692 976 dbSNP
rs1183229074 978 dbSNP
rs1246608380 981 dbSNP
rs975595120 988 dbSNP
rs564093724 989 dbSNP
rs912287777 990 dbSNP
rs1477623265 997 dbSNP
rs1166365825 1006 dbSNP
rs773933296 1007 dbSNP
rs544732077 1013 dbSNP
rs58318768 1014 dbSNP
rs1348079168 1020 dbSNP
rs564761116 1021 dbSNP
rs1283701280 1025 dbSNP
rs1038537098 1026 dbSNP
rs1216482847 1027 dbSNP
rs974336437 1030 dbSNP
rs534098796 1031 dbSNP
rs1287068267 1038 dbSNP
rs879842980 1046 dbSNP
rs573602888 1047 dbSNP
rs763330663 1052 dbSNP
rs1034368692 1054 dbSNP
rs1191360607 1056 dbSNP
rs1374969568 1057 dbSNP
rs1475839116 1061 dbSNP
rs1271798432 1066 dbSNP
rs949872385 1069 dbSNP
rs1342392154 1071 dbSNP
rs775695606 1074 dbSNP
rs1303682609 1084 dbSNP
rs907290753 1086 dbSNP
rs1299445010 1087 dbSNP
rs1384847009 1088 dbSNP
rs555330859 1088 dbSNP
rs1397879172 1091 dbSNP
rs1319997592 1097 dbSNP
rs917187699 1098 dbSNP
rs1024362962 1101 dbSNP
rs1013459034 1102 dbSNP
rs1281934127 1104 dbSNP
rs991341905 1106 dbSNP
rs892300315 1110 dbSNP
rs958971594 1111 dbSNP
rs1052375288 1112 dbSNP
rs1488189326 1120 dbSNP
rs750320134 1124 dbSNP
rs1429265633 1127 dbSNP
rs770374747 1129 dbSNP
rs1447809188 1136 dbSNP
rs1187024055 1138 dbSNP
rs1170657734 1142 dbSNP
rs1241436209 1150 dbSNP
rs1431664653 1151 dbSNP
rs1446506234 1152 dbSNP
rs1164185487 1164 dbSNP
rs1379649547 1165 dbSNP
rs1451480125 1165 dbSNP
rs536932141 1173 dbSNP
rs568914168 1175 dbSNP
rs1192161503 1179 dbSNP
rs1395165574 1180 dbSNP
rs547789024 1186 dbSNP
rs1384427055 1190 dbSNP
rs1452686129 1199 dbSNP
rs550594739 1206 dbSNP
rs191700727 1207 dbSNP
rs942319738 1213 dbSNP
rs1262868834 1214 dbSNP
rs1351843353 1220 dbSNP
rs867809015 1224 dbSNP
rs538732960 1228 dbSNP
rs912317585 1237 dbSNP
rs1050800855 1243 dbSNP
rs571211115 1244 dbSNP
rs776913490 1250 dbSNP
rs1483128089 1255 dbSNP
rs996411451 1272 dbSNP
rs1230527844 1277 dbSNP
rs918744555 1283 dbSNP
rs974621107 1285 dbSNP
rs1311276477 1288 dbSNP
rs1038076669 1293 dbSNP
rs527856552 1294 dbSNP
rs186799231 1305 dbSNP
rs1046779554 1307 dbSNP
rs927497944 1308 dbSNP
rs980135121 1313 dbSNP
rs971380135 1314 dbSNP
rs1024434833 1317 dbSNP
rs1370452525 1319 dbSNP
rs1390234610 1333 dbSNP
rs1010306746 1335 dbSNP
rs41267365 1336 dbSNP
rs949904999 1336 dbSNP
rs1056125839 1337 dbSNP
rs1325943661 1338 dbSNP
rs1204476615 1339 dbSNP
rs1257582217 1339 dbSNP
rs778098196 1342 dbSNP
rs925855275 1343 dbSNP
rs1001081563 1344 dbSNP
rs11558893 1345 dbSNP
rs147940265 1345 dbSNP
rs1431080098 1346 dbSNP
rs1299998635 1347 dbSNP
rs1169509669 1348 dbSNP
rs1464687953 1348 dbSNP
rs978815117 1349 dbSNP
rs1377333013 1351 dbSNP
rs182209416 1354 dbSNP
rs967355032 1355 dbSNP
rs1404817903 1356 dbSNP
rs913340216 1356 dbSNP
rs1281778899 1360 dbSNP
rs1039991063 1363 dbSNP
rs1224418934 1365 dbSNP
rs1006552327 1386 dbSNP
rs954869262 1387 dbSNP
rs1473205552 1393 dbSNP
rs1029129494 1396 dbSNP
rs890774737 1399 dbSNP
rs1253289956 1407 dbSNP
rs1050831672 1409 dbSNP
rs1198281897 1412 dbSNP
rs1482708882 1413 dbSNP
rs576116511 1415 dbSNP
rs1488122469 1416 dbSNP
rs929743239 1417 dbSNP
rs1220072206 1420 dbSNP
rs1270860565 1421 dbSNP
rs1490448257 1421 dbSNP
rs1211958207 1422 dbSNP
rs918312619 1433 dbSNP
rs530705552 1434 dbSNP
rs941492002 1443 dbSNP
rs927603044 1448 dbSNP
rs1228892130 1449 dbSNP
rs1367906993 1453 dbSNP
rs1016913900 1454 dbSNP
rs1288617434 1455 dbSNP
rs1360158052 1458 dbSNP
rs562589214 1463 dbSNP
rs1216484662 1465 dbSNP
rs1005240931 1466 dbSNP
rs1358811514 1475 dbSNP
rs980757941 1486 dbSNP
rs971409586 1497 dbSNP
rs1293825148 1498 dbSNP
rs749152271 1501 dbSNP
rs1214845148 1503 dbSNP
rs1240085102 1512 dbSNP
rs116084080 1518 dbSNP
rs577284678 1519 dbSNP
rs1254945877 1523 dbSNP
rs1013924648 1525 dbSNP
rs1162270625 1528 dbSNP
rs1387673456 1534 dbSNP
rs148275247 1535 dbSNP
rs190375273 1536 dbSNP
rs1033469777 1538 dbSNP
rs1471083970 1542 dbSNP
rs1000712854 1543 dbSNP
rs1317198840 1561 dbSNP
rs1383466833 1563 dbSNP
rs1281971288 1565 dbSNP
rs779457515 1567 dbSNP
rs1386821475 1575 dbSNP
rs1318494207 1577 dbSNP
rs949928582 1583 dbSNP
rs968276924 1586 dbSNP
rs915725826 1592 dbSNP
rs1458212054 1597 dbSNP
rs562686238 1599 dbSNP
rs946044650 1600 dbSNP
rs1184930108 1601 dbSNP
rs1018217298 1609 dbSNP
rs1445765534 1615 dbSNP
rs913203179 1617 dbSNP
rs573512677 1618 dbSNP
rs891016316 1622 dbSNP
rs369566047 1623 dbSNP
rs987558354 1623 dbSNP
rs1405665129 1629 dbSNP
rs1468384610 1633 dbSNP
rs1183173850 1636 dbSNP
rs555193885 1641 dbSNP
rs1383612961 1648 dbSNP
rs896911599 1649 dbSNP
rs1441463512 1650 dbSNP
rs769296683 1660 dbSNP
rs1277681336 1666 dbSNP
rs933433961 1667 dbSNP
rs536995438 1671 dbSNP
rs941578211 1683 dbSNP
rs1209174105 1687 dbSNP
rs906007750 1693 dbSNP
rs1205094493 1699 dbSNP
rs575964986 1701 dbSNP
rs556922229 1702 dbSNP
rs1204495407 1708 dbSNP
rs1231638641 1712 dbSNP
rs1016533940 1713 dbSNP
rs1339885185 1714 dbSNP
rs538219515 1716 dbSNP
rs988811634 1717 dbSNP
rs143112998 1735 dbSNP
rs1409422485 1740 dbSNP
rs546140960 1749 dbSNP
rs1356232297 1755 dbSNP
rs926091722 1756 dbSNP
rs1442767541 1759 dbSNP
rs1170587816 1762 dbSNP
rs979238455 1764 dbSNP
rs746407270 1767 dbSNP
rs1025225054 1776 dbSNP
rs112456371 1781 dbSNP
rs1283497289 1782 dbSNP
rs1338223067 1786 dbSNP
rs534397439 1802 dbSNP
rs1274438247 1807 dbSNP
rs1034497119 1809 dbSNP
rs1001394860 1813 dbSNP
rs567163063 1819 dbSNP
rs1161917588 1831 dbSNP
rs1268698116 1835 dbSNP
rs1489955996 1842 dbSNP
rs1201917520 1845 dbSNP
rs1378462673 1849 dbSNP
rs955294494 1858 dbSNP
rs1166248458 1871 dbSNP
rs1029500545 1877 dbSNP
rs1302454507 1882 dbSNP
rs757678354 1882 dbSNP
rs548762981 1883 dbSNP
rs985541719 1884 dbSNP
rs530717368 1891 dbSNP
rs891717638 1892 dbSNP
rs1339460067 1896 dbSNP
rs1229848990 1899 dbSNP
rs554008601 1901 dbSNP
rs376450175 1902 dbSNP
rs1247072590 1907 dbSNP
rs1188962540 1914 dbSNP
rs1357875086 1919 dbSNP
rs1016707259 1920 dbSNP
rs1225219774 1920 dbSNP
rs1268427892 1920 dbSNP
rs1265010496 1922 dbSNP
rs1191303620 1924 dbSNP
rs1005699809 1932 dbSNP
rs1450138034 1934 dbSNP
rs1162895031 1938 dbSNP
rs1357001623 1944 dbSNP
rs397945978 1947 dbSNP
rs751938217 1948 dbSNP
rs933293270 1950 dbSNP
rs144936751 1952 dbSNP
rs1297220571 1960 dbSNP
rs1326546273 1964 dbSNP
rs1451321021 1964 dbSNP
rs1491483871 1964 dbSNP
rs187653349 1964 dbSNP
rs201586484 1964 dbSNP
rs558460420 1964 dbSNP
rs57351079 1964 dbSNP
rs1436110013 1966 dbSNP
rs1465479707 1968 dbSNP
rs896076447 1968 dbSNP
rs983670178 1968 dbSNP
rs1183086163 1971 dbSNP
rs1328498035 1975 dbSNP
rs1053355072 1977 dbSNP
rs1386657978 1978 dbSNP
rs149914103 1979 dbSNP
rs1363062179 1992 dbSNP
rs1451319763 1997 dbSNP
rs1304398024 1998 dbSNP
rs1468914713 1998 dbSNP
rs992477127 1998 dbSNP
rs145947955 2000 dbSNP
rs1398360672 2006 dbSNP
rs200396793 2008 dbSNP
rs1034118308 2009 dbSNP
rs565268959 2009 dbSNP
rs747391776 2009 dbSNP
rs533826187 2015 dbSNP
rs978758100 2016 dbSNP
rs904360096 2024 dbSNP
rs540413523 2026 dbSNP
rs1201005882 2028 dbSNP
rs1249769114 2032 dbSNP
rs1417180956 2038 dbSNP
rs1183737767 2040 dbSNP
rs1476190606 2041 dbSNP
rs1021919515 2054 dbSNP
rs1010068073 2059 dbSNP
rs1430859817 2060 dbSNP
rs943469694 2061 dbSNP
rs1271051773 2064 dbSNP
rs1297070204 2066 dbSNP
rs1224803408 2080 dbSNP
rs910600599 2081 dbSNP
rs763787173 2083 dbSNP
rs1390112742 2094 dbSNP
rs955201410 2108 dbSNP
rs1351482894 2111 dbSNP
rs574820482 2114 dbSNP
rs1281579007 2122 dbSNP
rs765283541 2129 dbSNP
rs1314122096 2132 dbSNP
rs933324587 2132 dbSNP
rs141115869 2142 dbSNP
rs1197476100 2158 dbSNP
rs1252339164 2163 dbSNP
rs1490117581 2164 dbSNP
rs961099014 2167 dbSNP
rs942070134 2168 dbSNP
rs1229362632 2170 dbSNP
rs1433362844 2178 dbSNP
rs554796691 2195 dbSNP
rs1402295997 2206 dbSNP
rs1370778808 2218 dbSNP
rs1341764683 2229 dbSNP
rs1171019943 2232 dbSNP
rs909295840 2233 dbSNP
rs1017024563 2234 dbSNP
rs1005193761 2235 dbSNP
rs538085889 2236 dbSNP
rs34924929 2237 dbSNP
rs970214589 2238 dbSNP
rs759628658 2243 dbSNP
rs561471579 2246 dbSNP
rs568925733 2250 dbSNP
rs992342768 2259 dbSNP
rs1230575859 2270 dbSNP
rs895983208 2272 dbSNP
rs1358599160 2274 dbSNP
rs576019780 2275 dbSNP
rs1369322485 2285 dbSNP
rs36023544 2286 dbSNP
rs545659156 2295 dbSNP
rs147783896 2313 dbSNP
rs1171781088 2320 dbSNP
rs552922526 2321 dbSNP
rs1478268593 2323 dbSNP
rs904752501 2331 dbSNP
rs1431183033 2333 dbSNP
rs1179846417 2336 dbSNP
rs1351977630 2343 dbSNP
rs1458654063 2344 dbSNP
rs1288484320 2348 dbSNP
rs1359998984 2349 dbSNP
rs1437413629 2365 dbSNP
rs955835905 2367 dbSNP
rs1043455326 2372 dbSNP
rs1472242463 2374 dbSNP
rs1030268836 2376 dbSNP
rs1243597544 2380 dbSNP
rs943350004 2382 dbSNP
rs1291846478 2384 dbSNP
rs1322087938 2385 dbSNP
rs868151234 2387 dbSNP
rs774289143 2388 dbSNP
rs180830950 2396 dbSNP
rs1208822356 2399 dbSNP
rs1241910634 2400 dbSNP
rs1444631141 2418 dbSNP
rs1051795945 2419 dbSNP
rs777214270 2422 dbSNP
rs566976361 2423 dbSNP
rs555159406 2428 dbSNP
rs972562887 2434 dbSNP
rs961610002 2444 dbSNP
rs768527204 2455 dbSNP
rs909761859 2461 dbSNP
rs1458967842 2462 dbSNP
rs1276852765 2463 dbSNP
rs1321308598 2464 dbSNP
rs900504582 2466 dbSNP
rs1450435969 2468 dbSNP
rs771168747 2475 dbSNP
rs76784967 2477 dbSNP
rs1022758813 2478 dbSNP
rs887882550 2479 dbSNP
rs1208959173 2486 dbSNP
rs1350431980 2488 dbSNP
rs111272476 2492 dbSNP
rs959750743 2498 dbSNP
rs551422910 2501 dbSNP
rs1483838953 2502 dbSNP
rs998996061 2504 dbSNP
rs1406159014 2507 dbSNP
rs11576224 2524 dbSNP
rs1160164849 2534 dbSNP
rs571599668 2536 dbSNP
rs1407977702 2537 dbSNP
rs376188339 2548 dbSNP
rs772375410 2555 dbSNP
rs1468269691 2562 dbSNP
rs1008012231 2564 dbSNP
rs1156713180 2587 dbSNP
rs1359685654 2589 dbSNP
rs889098156 2603 dbSNP
rs1441305426 2604 dbSNP
rs546928468 2606 dbSNP
rs56374142 2608 dbSNP
rs561328525 2609 dbSNP
rs779956273 2616 dbSNP
rs1220478681 2618 dbSNP
rs1278647682 2622 dbSNP
rs543263273 2623 dbSNP
rs531154732 2626 dbSNP
rs1471232257 2628 dbSNP
rs980201724 2636 dbSNP
rs769417829 2638 dbSNP
rs939836192 2641 dbSNP
rs968396796 2648 dbSNP
rs868560541 2650 dbSNP
rs1187024157 2652 dbSNP
rs909821619 2653 dbSNP
rs1265329579 2659 dbSNP
rs1207277699 2664 dbSNP
rs914345305 2668 dbSNP
rs1425952483 2678 dbSNP
rs1409362272 2681 dbSNP
rs988532996 2682 dbSNP
rs955866973 2684 dbSNP
rs775183372 2687 dbSNP
rs563889785 2694 dbSNP
rs948389342 2698 dbSNP
rs781059559 2700 dbSNP
rs1225993753 2709 dbSNP
rs992472505 2710 dbSNP
rs1343275586 2717 dbSNP
rs965021599 2724 dbSNP
rs1275000412 2725 dbSNP
rs1338170193 2727 dbSNP
rs959782043 2731 dbSNP
rs1050316 2734 dbSNP
rs978026784 2735 dbSNP
rs1344887273 2736 dbSNP
rs1206330277 2738 dbSNP
rs751109791 2743 dbSNP
rs1450154649 2744 dbSNP
rs1201263900 2764 dbSNP
rs1027064970 2782 dbSNP
rs1475106160 2783 dbSNP
rs887749398 2785 dbSNP
rs1430268156 2791 dbSNP
rs1162705200 2792 dbSNP
rs1448243819 2803 dbSNP
rs1406797127 2807 dbSNP
rs1323783766 2810 dbSNP
rs578193636 2812 dbSNP
rs777144213 2816 dbSNP
rs1007798478 2819 dbSNP
rs896571028 2824 dbSNP
rs1434184214 2834 dbSNP
rs1389267713 2835 dbSNP
rs1161123288 2839 dbSNP
rs758131334 2867 dbSNP
rs889336608 2869 dbSNP
rs1229781935 2874 dbSNP
rs1056590163 2875 dbSNP
rs1354660080 2882 dbSNP
rs1211895643 2883 dbSNP
rs1290896038 2894 dbSNP
rs938177461 2900 dbSNP
rs1206914799 2904 dbSNP
rs1249908177 2912 dbSNP
rs905468515 2920 dbSNP
rs1182901089 2921 dbSNP
rs1366554184 2923 dbSNP
rs1473639089 2928 dbSNP
rs1043962707 2936 dbSNP
rs1383818434 2937 dbSNP
rs1455256309 2945 dbSNP
rs1245242141 2949 dbSNP
rs1187054435 2950 dbSNP
rs1464685023 2960 dbSNP
rs1274706836 2961 dbSNP
rs1243060216 2966 dbSNP
rs1388710157 2967 dbSNP
rs947056977 2970 dbSNP
rs914209340 2972 dbSNP
rs752237928 2975 dbSNP
rs934437830 2978 dbSNP
rs1350240086 2985 dbSNP
rs1320468787 2993 dbSNP
rs1288506000 2994 dbSNP
rs552696535 2996 dbSNP
rs997432774 2999 dbSNP
rs745372452 3000 dbSNP
rs1203005820 3001 dbSNP
rs765641868 3006 dbSNP
rs1295019334 3008 dbSNP
rs1227226236 3010 dbSNP
rs1254035937 3016 dbSNP
rs1444019231 3017 dbSNP
rs976350376 3019 dbSNP
rs1036438041 3029 dbSNP
rs1365566266 3034 dbSNP
rs1471439219 3040 dbSNP
rs1290440623 3045 dbSNP
rs1160894482 3060 dbSNP
rs1434148193 3068 dbSNP
rs964553546 3069 dbSNP
rs1017951306 3070 dbSNP
rs1400706224 3073 dbSNP
rs939885756 3079 dbSNP
rs1335358947 3081 dbSNP
rs952048903 3083 dbSNP
rs888265606 3091 dbSNP
rs1290415085 3097 dbSNP
rs1048818013 3098 dbSNP
rs1223007990 3099 dbSNP
rs1254268481 3101 dbSNP
rs1200949159 3106 dbSNP
rs1249616295 3107 dbSNP
rs766639617 3108 dbSNP
rs948638296 3110 dbSNP
rs1252110913 3123 dbSNP
rs915794329 3138 dbSNP
rs142909571 3139 dbSNP
rs1166876100 3143 dbSNP
rs1173347875 3143 dbSNP
rs1468083961 3143 dbSNP
rs992503764 3146 dbSNP
rs1420607104 3148 dbSNP
rs188401177 3149 dbSNP
rs555071727 3156 dbSNP
rs1310186312 3157 dbSNP
rs1200968709 3158 dbSNP
rs1197082284 3160 dbSNP
rs1386364303 3168 dbSNP
rs1487775727 3187 dbSNP
rs1332882119 3190 dbSNP
rs1250720375 3193 dbSNP
rs993449385 3193 dbSNP
rs536342587 3194 dbSNP
rs1490680012 3195 dbSNP
rs541244820 3195 dbSNP
rs1035089918 3196 dbSNP
rs1271861194 3196 dbSNP
rs1390127383 3197 dbSNP
rs1393094475 3197 dbSNP
rs540111996 3197 dbSNP
rs1387444812 3198 dbSNP
rs1296890669 3201 dbSNP
rs1227155458 3203 dbSNP
rs1002805217 3204 dbSNP
rs374771003 3212 dbSNP
rs1297427130 3222 dbSNP
rs1217303751 3223 dbSNP
rs905333407 3226 dbSNP
rs892721156 3227 dbSNP
rs576199828 3228 dbSNP
rs557930375 3229 dbSNP
rs1423628475 3230 dbSNP
rs923034458 3230 dbSNP
rs1370428639 3231 dbSNP
rs1458540344 3242 dbSNP
rs977180087 3243 dbSNP
rs969321765 3252 dbSNP
rs1021809498 3254 dbSNP
rs943204627 3255 dbSNP
rs986238401 3261 dbSNP
rs1378303158 3268 dbSNP
rs953631877 3274 dbSNP
rs1226424586 3281 dbSNP
rs985026510 3284 dbSNP
rs1227398058 3289 dbSNP
rs1321954688 3289 dbSNP
rs539357806 3291 dbSNP
rs1465834951 3303 dbSNP
rs1429330081 3305 dbSNP
rs1243221444 3308 dbSNP
rs1483174401 3309 dbSNP
rs1180479870 3313 dbSNP
rs997506519 3319 dbSNP
rs1424671388 3321 dbSNP
rs897825708 3325 dbSNP
rs1015445111 3329 dbSNP
rs1409904909 3335 dbSNP
rs1026173347 3336 dbSNP
rs780627961 3348 dbSNP
rs565928328 3356 dbSNP
rs547034827 3362 dbSNP
rs1445646170 3365 dbSNP
rs1431860595 3366 dbSNP
rs960673260 3375 dbSNP
rs1424917585 3378 dbSNP
rs759782072 3382 dbSNP
rs1286103192 3384 dbSNP
rs887828790 3384 dbSNP
rs1228485088 3386 dbSNP
rs1200693635 3388 dbSNP
rs1277207857 3402 dbSNP
rs1312184070 3404 dbSNP
rs1208619220 3408 dbSNP
rs1239628894 3410 dbSNP
rs1048228917 3414 dbSNP
rs1181865164 3415 dbSNP
rs1249922954 3418 dbSNP
rs1035529625 3421 dbSNP
rs534985765 3422 dbSNP
rs1424545357 3423 dbSNP
rs567639447 3425 dbSNP
rs969964785 3426 dbSNP
rs1359630628 3429 dbSNP
rs1428894253 3432 dbSNP
rs549531405 3448 dbSNP
rs754416240 3449 dbSNP
rs371346059 3450 dbSNP
rs938352612 3451 dbSNP
rs1203875575 3455 dbSNP
rs1052669999 3457 dbSNP
rs1218025961 3468 dbSNP
rs1281393460 3476 dbSNP
rs1349173896 3477 dbSNP
rs1252769737 3482 dbSNP
rs1272849597 3487 dbSNP
rs1484198577 3491 dbSNP
rs1207739031 3502 dbSNP
rs1246252924 3507 dbSNP
rs563775847 3508 dbSNP
rs551903898 3514 dbSNP
rs1263565673 3533 dbSNP
rs1192941697 3536 dbSNP
rs1395625044 3540 dbSNP
rs1225216487 3547 dbSNP
rs1166550561 3548 dbSNP
rs1348611758 3549 dbSNP
rs1041749448 3550 dbSNP
rs1438022004 3551 dbSNP
rs947174478 3553 dbSNP
rs1040529577 3554 dbSNP
rs1228307260 3555 dbSNP
rs1295940740 3558 dbSNP
rs943171686 3562 dbSNP
rs910284282 3573 dbSNP
rs914266345 3574 dbSNP
rs1048913341 3579 dbSNP
rs930458290 3580 dbSNP
rs1300058974 3583 dbSNP
rs919191709 3587 dbSNP
rs971929913 3594 dbSNP
rs1186568842 3604 dbSNP
rs1391822811 3605 dbSNP
rs960705809 3607 dbSNP
rs184061244 3608 dbSNP
rs1406678512 3612 dbSNP
rs1326075124 3622 dbSNP
rs1387261563 3631 dbSNP
rs1435075862 3634 dbSNP
rs1319096374 3640 dbSNP
rs1367909287 3644 dbSNP
rs1228629792 3649 dbSNP
rs1283900542 3652 dbSNP
rs1354596650 3653 dbSNP
rs1177625625 3657 dbSNP
rs1230222360 3660 dbSNP
rs953537225 3670 dbSNP
rs1273940503 3671 dbSNP
rs1464473067 3672 dbSNP
rs1206855319 3673 dbSNP
rs923563530 3675 dbSNP
rs1249847136 3676 dbSNP
rs981179556 3685 dbSNP
rs1235521850 3686 dbSNP
rs41267363 3687 dbSNP
rs1165172011 3690 dbSNP
rs1410639942 3692 dbSNP
rs1022790265 3694 dbSNP
rs1410448745 3697 dbSNP
rs1160661381 3699 dbSNP
rs1387781957 3701 dbSNP
rs1180817319 3705 dbSNP
rs1419210691 3707 dbSNP
rs1011102553 3712 dbSNP
rs35769575 3712 dbSNP
rs1333988137 3715 dbSNP
rs1339051005 3721 dbSNP
rs1252057669 3722 dbSNP
rs541304752 3724 dbSNP
rs1031265379 3725 dbSNP
rs527546597 3729 dbSNP
rs1243505635 3741 dbSNP
rs1205378750 3752 dbSNP
rs1006597551 3757 dbSNP
rs561339021 3758 dbSNP
rs1199792118 3767 dbSNP
rs1023718692 3768 dbSNP
rs368908432 3769 dbSNP
rs562082006 3770 dbSNP
rs1007622977 3775 dbSNP
rs1250629943 3778 dbSNP
rs1239702102 3792 dbSNP
rs888892819 3796 dbSNP
rs1048772756 3802 dbSNP
rs1363856348 3804 dbSNP
rs930494166 3805 dbSNP
rs1172473628 3821 dbSNP
rs1400638550 3823 dbSNP
rs1436992043 3825 dbSNP
rs1317523369 3827 dbSNP
rs1309275337 3830 dbSNP
rs919060695 3834 dbSNP
rs374569320 3837 dbSNP
rs1002805638 3839 dbSNP
rs1232497861 3850 dbSNP
rs903077226 3856 dbSNP
rs1036241873 3864 dbSNP
rs1273641450 3870 dbSNP
rs1337767258 3874 dbSNP
rs1206822012 3877 dbSNP
rs1250665332 3880 dbSNP
rs1432122966 3889 dbSNP
rs543162134 3890 dbSNP
rs548368414 3900 dbSNP
rs939324538 3900 dbSNP
rs1484191696 3901 dbSNP
rs762108845 3904 dbSNP
rs980826170 3908 dbSNP
rs969776572 3909 dbSNP
rs3748566 3913 dbSNP
rs915348426 3916 dbSNP
rs989530798 3919 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Huh7 , PLC/PRF/ 5 , SMMC-7721 , BEL-7404 , MHCC97-H , MHCC97-L , Hep3B , HepG2 , HeLa , HEK293 , HEK293FT
Disease Hepatocellular Carcinoma
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... 7D).Wethen constructed a vector to investigate whether miR-122 could directly target MEF2D 30UTR. We found that miR-122 markedly inhibited luciferase activity when MEF2D 30UTR was inserted downstream of luciferase cDNA in our reporter vector (pMIRMEF2D3UTR). In contrast, no significant suppressive effect on luciferase activity was observed in cells transfected with a control vector with mutant MEF2D 30UTR (MIR-MEF2- D3UTRm) when miR-122 expression was elevated (Fig. 7E). ...

- Ma L; Liu J; Liu L; Duan G; Wang Q; Xu Y; et al., 2014, Cancer research.

Article - Ma L; Liu J; Liu L; Duan G; Wang Q; Xu Y; et al.
- Cancer research, 2014
The underlying molecular pathogenesis in hepatocellular carcinoma remains poorly understood. The transcription factor MEF2D promotes survival in various cell types and it seems to function as an oncogene in leukemia. However, its potential contributions to solid cancers have not been explored. In this study, we investigated MEF2D expression and function in hepatocellular carcinoma, finding that MEF2D elevation in hepatocellular carcinoma clinical specimens was associated with poor prognosis. MEF2D-positive primary hepatocellular carcinoma cells displayed a faster proliferation rate compared with MEF2D-negative cells, and silencing or promoting MEF2D expression in these settings limited or accelerated cell proliferation, respectively. Notably, MEF2D-silencing abolished hepatocellular carcinoma tumorigenicity in mouse xenograft models. Mechanistic investigations revealed that MEF2D-silencing triggered G2-M arrest in a manner associated with direct downregulation of the cell-cycle regulatory genes RPRM, GADD45A, GADD45B, and CDKN1A. Furthermore, we identified MEF2D as an authentic target of miR-122, the reduced expression of which in hepatocellular carcinoma may be responsible for MEF2D upregulation. Together, our results identify MEF2D as a candidate oncogene in hepatocellular carcinoma and a potential target for hepatocellular carcinoma therapy.
LinkOut: [PMID: 24390737]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac myxoma tissue of patient
Disease Cardiac myxoma
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... This results showed that MEF2D is one of the target genes of miR-122. ...

- Qiu Y; Yang J; Bian S; Chen G; Yu J, 2016, Biochemical and biophysical research communications.

Article - Qiu Y; Yang J; Bian S; Chen G; Yu J
- Biochemical and biophysical research communications, 2016
Peroxisome proliferator-activated receptor gamma (PPARgamma), a multiple functional transcription factor, has been reported to have anti-tumor effects through inhibition of cells proliferation. However, its effects on cardiac myxoma (CM) cells and the underlying signaling mechanism is unclear. In the present study, we demonstrated that the level of PPARgamma is inversely correlated with that of myocyte enhancer factor 2D (MEF2D), a biomarker of CM. We found that activation of PPARgamma inhibit MEF2D expression via upregulation of miR-122, which can target the 3'-UTR of MEF2D and inhibit MEF2D expression, by directly binding to the PPRE in the miR-122 promoter region. Functional experiments further showed that miR-122-dependent downregulation of MEF2D by PPARgamma suppress the proliferation of CM cells. These results suggest that PPARgamma may exert its antiproliferative effects by negatively regulating the MEF2D in CM cells, which through upregulation of miR-122, and PPARgamma/miR-122/MEF2D signaling pathway may be a novel target for treatment of CM.
LinkOut: [PMID: 27109478]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase su