miRTarBase - #MIRT327962 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CHIC1   
Synonyms BRX
Description cysteine rich hydrophobic domain 1
Transcript NM_001039840   
Expression
Putative miRNA Targets on CHIC1
3'UTR of CHIC1
(miRNA target sites are highlighted)
>CHIC1|NM_001039840|3'UTR
   1 GGAGTTTTATCCAGTCACTTCTGTGTTACCTGTCATTTCCTACCCTTAGTGCCTTGTAGATTTGGAATGAAGATGGTCTC
  81 CTTTGCTGTGTTCAACTTATTCTTTATAATGGTAGAATATTCTTCTCGCTCTTTTGTGTTGGTTTATGAAGAAAATTTGC
 161 ACATCTTTTTTGTCTTTCAATGAGGCTTGTGTTTTGCACTCTCAATTTTAAATACACACACATGCGTGTGTGCATATACA
 241 TATATAGATAGTTGCCATTAAAGATAAATCATCAGTGTTGGTGTTTAAAAAACAAAAACTTGTTCTGAGCATGCTGCCTT
 321 ATAATTTTCATACTCATTGTTTCTAAACTCGCATCATTTTTCTAGGCTACTTGATGCTCTGTAATCCCTTACTGGACAAA
 401 CTTAAATAAGCTTTTGGTAGCTTTTAGAAATGGTTTTACTCTGCTTTTAAAGGACATGCTTTTAAAGGACATGCAATTAA
 481 TGGCACTGGTTTTGTCCTGCACTTTGCTTTATCACTTATGTTAGTGGATAAAATATTTAAACTCCTAAAGACTTGTAAAT
 561 ATTGCCTCTTTGCATAATGTAAAATGTGGTATGCCATGGTTTACATAATGTAACATTACTCTTATTGTATTGCCAACAAT
 641 TTTACATAGATTTTAATATGAATGAAGTTTGCAAGCATCCCTTTGAATGTAGAAACTGCTAACATGCTGTTTTATGGCAA
 721 GGCCATAATGAGTATGTTAAGAATTTCAGGTGTAGGGCAAGGTTGCCCTTTGTAACAAGTGGACTAAAATTGAAATTATT
 801 ATCTCAGATATTCTGTATTGCACCTGAAACCATGACCTTTATTTTTCCATTTCGTTTAATAATTTCCATTTTGTTGTCTA
 881 CTCCTTCCCACAAAAAAACTATTTGACATCTGACACATTTCACAGTCTCACTATCCTGCATTTATTAGCCTTTTCTTCCT
 961 TTGAAAATACACACAATTATGACTTTTAAGGAGTATTTTGAGATTTCAGACATCTTCAGAAGGTATCTAGACCCTCTTGA
1041 AAGCCACTAACACCTTTCTGCAGTTCTGATATTCTAGTTTGAGAAAGAGAGAGAACTATTTGAGAAGCTGTAGCTAAAGA
1121 GTATATAGCAGCTGATTCATAATTGAAAAAAAATTCTCAATTCTGTTTTTGATGATCCTTTATAAAACATTAATGAGGAA
1201 AGACAAGTGTTTAGACAAAAGTATTTTAGTTTATAAATTCAGCACATATGTAACATTTATTTGGTCCATATTTCTCTATT
1281 TTTCTTCACAATTAAAATGATTGCTAGCACCACACAACTAGAATTTGAAAATTCAGTATAATGAAAGCTTTATATCACAT
1361 TAATTCAACTGCAAATGTATGCCTGTTTGTAGGCATTATTTGTAATTCATAGTGCTAAAAATAAAAGTGTCTAGGGCTCA
1441 GTAATATTTTGTCATCTTACTCTTACTGCTTTTAGTAAACCTTTTAGGCAAGATTCATCTCAGTGAAGTGAACAATCATT
1521 TCTTCATAGAAGGTCAAGCCTTTTTAAGCCACTCTTAAAATTTATGCCTAATTTGAAATCCACAGTCCTTGACCAGTTTA
1601 AAAAAGAGAGGAAAAAGAAGACACTATTTTATATGTGATTATAATTGTTTGCACAAACACTTTTCCACCTTCCTCTGTGC
1681 CCCATTACCTCTGTGCCACTCAGTCACCCCAAATCTCTAACCTTTAGTAATGTGTATGCCTGCAAATATTATGTGTTTGC
1761 CTGCTGCAAAATTGAAGGTGTATTTTTATAGACAAGGTAGAAGCCTCTGAAAATGTATACCAAATGTCTTGTTTTGTAGC
1841 TAAGGTCGGGAAAAATTGTATCTGAGGTTTATGTTCCAGCTAATGTTATCAAATTTATGCTTCAAACTGTGATATTTTAA
1921 TACCAAAATCGATTTTCAGCATAATACAAAATATCTCATTTTCACTGATAGAAAATTGCTTTTAAGTGTTGATCCTTAGA
2001 AATCTTATTTTTTTCTATAACCTTAGAATTTGATCATATGATGGTCATAGGAACTTTTTCTGCCATGTATAAATCACACT
2081 TGGTTTTGCTCAAAGAACAGCATGAAGTGGTGAATTGTTTCCATGAAACAATTATTGAGAATGGGAATACAGTATATCTG
2161 GAAATGACACAGTATAATACAAGTTACAGTAGCATTTGTCACAAAAACCACTTGTCAGCATGTGTAAACTTAATTTTAAA
2241 GCCTATTCTAATCACTCGAGTTTATTATTTTATTGTTCGCTATGCTGGTTGACTCATCTTAGTTTCTTCAACTACCCAAA
2321 AAAATACCAATTTTTTTCCTCTCTTGTATGACTACTTTTTCAAACTGTTTTCCTTTGCAGGGGGCTGATTAGCAATTGAG
2401 TATTTTGTAATGTTTGGGCGGGGTTGCTTTGTTTTCAGTGAAATTGGTTGCAGTGAATGCTAAAATGACACAGCACACTG
2481 GTGATTAATTCCTCCCCCATGGAGCCTTTTTTCTGTTATGCTTAGGATAGAACATACTTGTAATTTTCCATTAGGTTAGT
2561 AACATACTTTTGTGAAAGTTGTTTTTAGACTGAAGAAAGTAATTTTGAATTTCTTTGTTACATAATATTCCTTTATGAAA
2641 CTTGTGATAGTTTCCAGAGCAAAACATGTATTTGCCAAAGTATATAAATCTCACAAGGCTTTAAGATTACAAGCTAAAAT
2721 TGTTTTTTAAAATTAATGTTCCAATGTTTCTCATTTGGCCCAAGATTCTGGCTTCATAAATTTGTCCAACTGGCTATTTT
2801 TAAGCTTGTCCTAAAAGCCAATAACATGTTTATTCCTAATAACTAATATGGGCAAGTGTTATTTACAGATTTATTAACTC
2881 CATCCCAGATATGTCTCCACTCTTTGTTCCCTCCTAATGCTAATTTAGGAAAGAGACCACTGTAGTAAAACTTTAGAAGA
2961 AGATGGAGAAGTGCCTTGTCTTTTTAGAACAAAGATAACACATTACGTGTAAGGAAGCATAATAAATGAATTGGTAGATG
3041 ATTAGATTAGAAATCATCCTTTTCAACTAGGTCTAAGAATACTTTACTAGTGTATTATCTTTTATTTATTATGTAAAGCT
3121 TCTTTCCTTCCTTTTCCCCAATCATGATATATTAGTGACAAAATATTACAGAACCGGACTATCAGTCACTTAAAAAAACA
3201 GTATAATTCTAATGCTAGTAAACATGTAATTTAATTTAGTTCTGGAAGGACAGTTGTCTTTGATTAAAGCCCCACCAAAA
3281 CCCATTTAAGTATTTAATGTACATACTATTCATATTATTATGGCCTGTAAACACTAATATCTGAGCAATCAAACTGTTTT
3361 ATCTACCATTTTTGATGAAATTTGAATAAAGTTTAAAAACGTGTAAGCCTTTGAACAAATGTATGAAAGCTTTAAAAGAT
3441 CATTAGCACTTTTATTTTGTTTACAAATAAGCTGCCATTTAAAAAAATAAAACCTCACTACTTGAACATAAAGCTCCCAA
3521 ACAATATTGTATTAAAATGTACTATATTGACCTAGGAGGATATAGAAATTATATTCACCTGATTAACTGGAGCAGTTTCA
3601 CATAGTAGAAATACTTTTTGCTAATTTGATTATAAGTGCTCAAATTTATTGAAATTAGATTCTCATGCCTATAAAAGTAT
3681 ACTTTAAAAATATTTTGCAACAACTGTCAAATTATTTGGGTTCCTTTAAATAGCAAACAATTGGGAAATTTTCCATAAAA
3761 ATGAATAGGTTTTATTAATACCTGTTCATGTAGTATGTGGACTAAAACAATTGATATATATCTGTATGTAAAAATGAATG
3841 ATCTTATCTTGCCCCAAATTTTTCTTACCTGATTCTGAGCCAGCCTTTTTGTTTTGATGGCACCCTGTGAGTATGTTCCA
3921 TTTTCTGTGAACTTTGTCAAATTCATACTATATGAGGAAATGATCTAATATTGTGGGCTCCAGGCAGGTCATCTTAATTG
4001 CATGTCTGTCTCTTCTGTAAAATGATGAGGTGGAACCTAGAGCTGGACAAAAAATTAGAGATCACTTAACATTCTGTGAT
4081 TCAAGGAATTCTTAGGACATTTTTACTCTATAGAATCTCAGAATGATTATTCTCAGATCTACTGTCCTTGGTGGAAACTC
4161 TCACAGTGCCTTGCATGCAGTAAAAGTTTGATTTGCCGACTGGCTGACGTGTTAATTATCACACAGACTCCAAGAACCTG
4241 ATGCTTGCTAGACCTTAGTTCCTTGGTGATGCTAAGAGTAAATGTAGTTTTCCTAGGAACTGAGCACTGAGGTCTGTGTC
4321 CTTTGCCTGTGTAGAATCTGTCTATGCAGTTGGTATTCAGGCAAGAATTTTAGCTGTAACAACAATGGAAATATTGGAGG
4401 ACCCACTTTGGCATTTATGTAAAGATTTCATATCCTATCCAACATTTACTTTAGTGTCTAATCAAATTCCATACCCTCAA
4481 AAAGATCTGTTGGAACAAATTGATAAAATTAGGTGGAAAGGAAAGTGGTATGGGACTCAAATACAAGTCACTTCTGGTTT
4561 AATTATTGGCTCTGCTGCTTAATTCCTCTGTACCTCACGTCCTCATTGTCGAAGTGGGGACAATAATCTGGACCTACCTC
4641 ACAGGGGAATTGAGGATATTTTCATATATTAGTGTGCTTTGAAGTTGACTGAAAGATATACTGGATATCATAATTATATA
4721 ATTTCTAAATAGATTTCTTTAAATCCATGCTATGTTTTCTTTTTCAGTCAGGTCCTACAGAATGACTATTGCACTTGGTC
4801 TATTGTTTTAATAGTAAATTTTGTTATTAATCTCCTATGTGTTAAACGTGGGTAATTGTATTATGTTAATACATACTTAG
4881 GGAGGAAAAGCAGGTGGATGTAAATCAGTGATTCCCAACTTCAGCAGATGATAGCAGTGGAGGGTATCCTTGAGCTTTTT
4961 GTAATATTTCAAAAAGTATATTAGAAATTATACATTTACCCATAATATTCCTGCTTCACAAGTCAATTAAGACATTGAAT
5041 TTCCATTCATTTTGCCTATATTCTCTCAAAAGCTGTGAATGGCAGTATGTTTTTGATTAATAATAAAATAAGAAATCCTA
5121 TTATGTGCAACTTATTAAATACTTGGGAACATGGGAAAAGAATAATGAAGGGATTCTTATGGTGAAAATGTTGGGAACCA
5201 CTTTTATAAAGGAACTAAGATTATTTGACCCCCTCCACAGATTGCTTACCTAGTCTCTAAATAATGAAATGTGTGTGTTT
5281 GTGTGTTTTGGCTATATTAGGCTATATAACTTCAGGTTAGAATTTGCCTTCAGTTTTTTTTCTGTTTTAGAATATCACTG
5361 GCCTAATTTATTTAGGTGTGTACATGTTGCTCATACATACACACACATATAGGATTACAAATGTGGAAAATGTTATAATG
5441 TCATATTCTAGCATTGGACTAAATATCAATTTCTGACTCTTAAAGTAGTTCTGTGTATAAATTCAACATGATGAATCAAG
5521 GCAATAATTTCTCAAATGTTCTTTTATTTCTTTGTTTTTATCTCGACTTTTTATTTTCCATTTTTTCTAGTACGCAAATA
5601 GTGTAAAATTGTTTTAATGCCTGGACTTTGAAACAAGTAACAAGTGTTTGAAAGTATATAATCTACGAGCGAATTTGCCC
5681 TCCTTGGACTAACCACATACAAATATGAATCTGGCTGCAAGAACAGGATATCCAGGTAACTAGAGAGTGGGCATTGATAA
5761 AAATATCTGGTGGAGAAGCCTAGGATTTCAACTTTTTGTCAGAGGATTCCTGTTGGGACAGCTTTACCAGAAAAGAATAA
5841 TAGCGGATATGTTCATCCAAACTAAGAACTTTCATGCATCTTGCATTGTTACATAGCCTGTGGAATGAATTCATTTTTTC
5921 TCCCTTGAGTCCAGGAATGACTTCCCTGGAAAAACTCAATCTATATACAGCTGTGCCAAAATGAAGGATACCTGCCTCTC
6001 CGAAACTTTCACTGCTGCTTCTGTCATTGTTCACTTGTCAGATAAAATTTTATTATCTCAGGATGCAAATTTAAAATAAA
6081 GTGTAAATCTATGTTAATGAATTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAU--ACACGACGAu 5'
              ||::|||:  | ||||||| 
Target 5' gtttAATTATTGGCTCTGCTGCTt 3'
4557 - 4580 160.00 -13.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |:|| | ||   ||||||| 
Target 5' tcCGAAACTTTCACTGCTGCTt 3'
5999 - 6020 156.00 -10.80
3
miRNA  3' guGUUUGGUAAUAC--------ACGACGau 5'
            |||| :||||||        ||||||  
Target 5' tgCAAA-TATTATGTGTTTGCCTGCTGCaa 3'
1741 - 1769 141.00 -16.90
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751244244 2 dbSNP
rs1377872193 5 dbSNP
rs1397238716 5 dbSNP
rs1452418193 8 dbSNP
rs1327065151 12 dbSNP
rs1158715739 13 dbSNP
rs1387011606 15 dbSNP
rs1412741004 18 dbSNP
rs761499501 22 dbSNP
rs372866799 23 dbSNP
rs1454720760 28 dbSNP
rs1307368278 33 dbSNP
rs767429391 37 dbSNP
rs750207232 46 dbSNP
rs1239855857 50 dbSNP
rs1026514053 58 dbSNP
rs5982472 59 dbSNP
rs753065041 61 dbSNP
rs980279981 72 dbSNP
rs1437762473 77 dbSNP
rs950865044 85 dbSNP
rs1254798885 86 dbSNP
rs1194100833 91 dbSNP
rs987698706 96 dbSNP
rs113925521 100 dbSNP
rs1360873667 113 dbSNP
rs927374696 120 dbSNP
rs938776565 124 dbSNP
rs758172633 129 dbSNP
rs1266208212 137 dbSNP
rs1304771317 147 dbSNP
rs992749566 161 dbSNP
rs1440697490 165 dbSNP
rs757342716 173 dbSNP
rs1019125069 174 dbSNP
rs1320645654 177 dbSNP
rs930022119 181 dbSNP
rs767715862 197 dbSNP
rs1156958954 199 dbSNP
rs888409425 207 dbSNP
rs942519747 214 dbSNP
rs1174161584 217 dbSNP
rs964688620 225 dbSNP
rs1234332705 226 dbSNP
rs974731581 227 dbSNP
rs900882068 230 dbSNP
rs779763108 232 dbSNP
rs915224461 233 dbSNP
rs1349395953 235 dbSNP
rs1414441416 236 dbSNP
rs1234243102 241 dbSNP
rs1346261842 249 dbSNP
rs1272305595 252 dbSNP
rs946855444 291 dbSNP
rs1426518708 294 dbSNP
rs1431913255 294 dbSNP
rs1326137293 315 dbSNP
rs1165525483 319 dbSNP
rs1184818974 320 dbSNP
rs1363816981 325 dbSNP
rs753777030 327 dbSNP
rs182236439 331 dbSNP
rs1030641869 334 dbSNP
rs892114219 342 dbSNP
rs1329805738 351 dbSNP
rs1372199555 352 dbSNP
rs1337815537 370 dbSNP
rs923816240 372 dbSNP
rs754900157 374 dbSNP
rs1486425622 382 dbSNP
rs1257608908 398 dbSNP
rs142445658 407 dbSNP
rs1441253813 408 dbSNP
rs780733359 442 dbSNP
rs1215562696 443 dbSNP
rs969034199 450 dbSNP
rs1276645061 453 dbSNP
rs980206100 455 dbSNP
rs1356257797 457 dbSNP
rs1312363064 477 dbSNP
rs1412996903 487 dbSNP
rs1330789381 507 dbSNP
rs895026071 507 dbSNP
rs947951162 512 dbSNP
rs1248827451 529 dbSNP
rs1038075151 537 dbSNP
rs1168190840 539 dbSNP
rs1475992301 544 dbSNP
rs1034482966 549 dbSNP
rs1186682796 553 dbSNP
rs898145075 563 dbSNP
rs993957246 566 dbSNP
rs960090903 568 dbSNP
rs1358116271 575 dbSNP
rs1195964609 580 dbSNP
rs1215879325 597 dbSNP
rs992887063 600 dbSNP
rs1292875775 606 dbSNP
rs1435785988 609 dbSNP
rs1280175101 611 dbSNP
rs1025789773 616 dbSNP
rs1335038078 618 dbSNP
rs1329121811 633 dbSNP
rs1462816090 636 dbSNP
rs1394811115 639 dbSNP
rs1163730973 641 dbSNP
rs1403193549 653 dbSNP
rs886620321 663 dbSNP
rs778945910 684 dbSNP
rs1243581274 687 dbSNP
rs1008985005 689 dbSNP
rs866568114 690 dbSNP
rs147939677 699 dbSNP
rs1033990884 707 dbSNP
rs929963093 710 dbSNP
rs1469173043 731 dbSNP
rs1272895453 734 dbSNP
rs984173305 745 dbSNP
rs909756277 751 dbSNP
rs964969333 752 dbSNP
rs1223281400 774 dbSNP
rs996822889 776 dbSNP
rs1383398279 791 dbSNP
rs747873884 794 dbSNP
rs1376158584 815 dbSNP
rs1306947432 816 dbSNP
rs942595166 826 dbSNP
rs968430216 833 dbSNP
rs1371488017 836 dbSNP
rs978215428 842 dbSNP
rs1292691555 848 dbSNP
rs1039531951 851 dbSNP
rs1346536826 854 dbSNP
rs769229642 855 dbSNP
rs1398865624 856 dbSNP
rs758270450 860 dbSNP
rs1176106111 882 dbSNP
rs992033929 883 dbSNP
rs1052167612 892 dbSNP
rs1252774545 899 dbSNP
rs12559655 900 dbSNP
rs746667912 902 dbSNP
rs1038677329 910 dbSNP
rs749868155 911 dbSNP
rs1043407373 926 dbSNP
rs1407335798 935 dbSNP
rs1348419940 939 dbSNP
rs1300342737 963 dbSNP
rs771579369 965 dbSNP
rs1363716693 966 dbSNP
rs1289052541 969 dbSNP
rs774816325 974 dbSNP
rs1398956672 976 dbSNP
rs1313575587 984 dbSNP
rs1358113852 986 dbSNP
rs1314113619 989 dbSNP
rs1435904044 998 dbSNP
rs1394995857 999 dbSNP
rs1001760588 1012 dbSNP
rs1034451995 1014 dbSNP
rs770380305 1019 dbSNP
rs1382781382 1030 dbSNP
rs1227513565 1034 dbSNP
rs1487405989 1035 dbSNP
rs1259703187 1039 dbSNP
rs1211615454 1061 dbSNP
rs1485991468 1063 dbSNP
rs759839828 1082 dbSNP
rs1271474761 1086 dbSNP
rs929600351 1093 dbSNP
rs1309063857 1095 dbSNP
rs960178402 1097 dbSNP
rs776150516 1103 dbSNP
rs1337885158 1105 dbSNP
rs1194897857 1114 dbSNP
rs1014413393 1122 dbSNP
rs1414866499 1122 dbSNP
rs767755122 1128 dbSNP
rs1463934281 1132 dbSNP
rs1355509098 1137 dbSNP
rs5981562 1139 dbSNP
rs1462495231 1154 dbSNP
rs1420275039 1155 dbSNP
rs1188829299 1156 dbSNP
rs745424131 1157 dbSNP
rs1255444864 1158 dbSNP
rs1198695088 1164 dbSNP
rs1242446018 1166 dbSNP
rs1251687916 1183 dbSNP
rs1040553245 1189 dbSNP
rs1197765143 1189 dbSNP
rs1315755699 1214 dbSNP
rs1274634697 1215 dbSNP
rs900665845 1228 dbSNP
rs1339386099 1229 dbSNP
rs1309906004 1238 dbSNP
rs1393646704 1240 dbSNP
rs1374610480 1241 dbSNP
rs758631177 1255 dbSNP
rs1464388032 1257 dbSNP
rs1397009938 1264 dbSNP
rs996465612 1266 dbSNP
rs1457560894 1271 dbSNP
rs1366803592 1279 dbSNP
rs1184009848 1295 dbSNP
rs770180014 1300 dbSNP
rs1374884210 1303 dbSNP
rs760802187 1305 dbSNP
rs1238713576 1318 dbSNP
rs1177823908 1319 dbSNP
rs984486887 1321 dbSNP
rs1254597574 1322 dbSNP
rs764213055 1339 dbSNP
rs375687832 1340 dbSNP
rs753923512 1342 dbSNP
rs1355125260 1348 dbSNP
rs776126410 1357 dbSNP
rs1263178399 1359 dbSNP
rs1240541124 1377 dbSNP
rs1022940918 1378 dbSNP
rs909899628 1386 dbSNP
rs1474525758 1403 dbSNP
rs1309132806 1408 dbSNP
rs1445090607 1410 dbSNP
rs963926697 1412 dbSNP
rs1170245719 1418 dbSNP
rs1326920261 1422 dbSNP
rs975313548 1434 dbSNP
rs377679492 1436 dbSNP
rs1388833221 1448 dbSNP
rs922539427 1452 dbSNP
rs1380898113 1457 dbSNP
rs933811589 1465 dbSNP
rs34208034 1470 dbSNP
rs1052314174 1476 dbSNP
rs968084373 1481 dbSNP
rs999895061 1482 dbSNP
rs946490341 1493 dbSNP
rs1335225283 1494 dbSNP
rs1031007506 1504 dbSNP
rs1383322953 1509 dbSNP
rs960817376 1515 dbSNP
rs1485895402 1518 dbSNP
rs763226211 1519 dbSNP
rs992232480 1524 dbSNP
rs1001855331 1525 dbSNP
rs1304701427 1536 dbSNP
rs916443363 1551 dbSNP
rs769072146 1555 dbSNP
rs758260920 1569 dbSNP
rs1319666465 1571 dbSNP
rs1382945170 1580 dbSNP
rs1360020166 1583 dbSNP
rs1324207572 1595 dbSNP
rs1417798682 1597 dbSNP
rs1014341487 1605 dbSNP
rs896105408 1605 dbSNP
rs1025813808 1606 dbSNP
rs147576860 1627 dbSNP
rs1194906032 1651 dbSNP
rs929658791 1652 dbSNP
rs1213811899 1653 dbSNP
rs751324739 1653 dbSNP
rs1005645485 1668 dbSNP
rs1279917421 1672 dbSNP
rs1200294000 1673 dbSNP
rs912220578 1674 dbSNP
rs370965069 1681 dbSNP
rs754781630 1686 dbSNP
rs964023919 1689 dbSNP
rs1228430713 1690 dbSNP
rs1340051606 1700 dbSNP
rs780869030 1722 dbSNP
rs975452610 1739 dbSNP
rs922507104 1751 dbSNP
rs1039409747 1752 dbSNP
rs1262327766 1756 dbSNP
rs1334715866 1760 dbSNP
rs1413787518 1767 dbSNP
rs1399834069 1777 dbSNP
rs900693506 1792 dbSNP
rs1477977751 1794 dbSNP
rs1422465214 1798 dbSNP
rs1190927640 1804 dbSNP
rs1475891883 1809 dbSNP
rs747823133 1813 dbSNP
rs755672535 1821 dbSNP
rs1187502390 1825 dbSNP
rs955284820 1832 dbSNP
rs1199646546 1846 dbSNP
rs988341247 1848 dbSNP
rs1256357403 1849 dbSNP
rs777361756 1851 dbSNP
rs1384726304 1868 dbSNP
rs996715129 1889 dbSNP
rs187694404 1891 dbSNP
rs1338616262 1892 dbSNP
rs946430699 1893 dbSNP
rs1263857902 1898 dbSNP
rs771515971 1900 dbSNP
rs1168128036 1913 dbSNP
rs1043986504 1914 dbSNP
rs1043471080 1925 dbSNP
rs1413896262 1931 dbSNP
rs1193116183 1932 dbSNP
rs374880300 1942 dbSNP
rs1162068951 1952 dbSNP
rs41303729 1954 dbSNP
rs1235093569 1970 dbSNP
rs1179695940 1973 dbSNP
rs767662449 1974 dbSNP
rs1031038858 1983 dbSNP
rs1236679004 1984 dbSNP
rs192749382 1987 dbSNP
rs1377449461 1993 dbSNP
rs760853614 2000 dbSNP
rs1289319924 2006 dbSNP
rs746211714 2006 dbSNP
rs1226679232 2008 dbSNP
rs1354213850 2018 dbSNP
rs1311341519 2025 dbSNP
rs41310677 2035 dbSNP
rs969255176 2043 dbSNP
rs1375922663 2046 dbSNP
rs1328967566 2063 dbSNP
rs974273072 2064 dbSNP
rs1383503894 2067 dbSNP
rs1163536979 2069 dbSNP
rs896031924 2074 dbSNP
rs1026815160 2077 dbSNP
rs541807237 2084 dbSNP
rs982649497 2094 dbSNP
rs1159808448 2101 dbSNP
rs912251831 2117 dbSNP
rs1439579888 2121 dbSNP
rs1047642265 2124 dbSNP
rs1260090856 2126 dbSNP
rs775766280 2132 dbSNP
rs943683299 2136 dbSNP
rs1006154889 2145 dbSNP
rs1219529155 2148 dbSNP
rs760746356 2155 dbSNP
rs1448838801 2158 dbSNP
rs1286782488 2171 dbSNP
rs764300930 2173 dbSNP
rs1017019264 2174 dbSNP
rs975140386 2175 dbSNP
rs1306884233 2193 dbSNP
rs1220731932 2195 dbSNP
rs1367909131 2199 dbSNP
rs1292556282 2208 dbSNP
rs1433792970 2216 dbSNP
rs1317298128 2219 dbSNP
rs920974706 2223 dbSNP
rs947155056 2230 dbSNP
rs1298200558 2233 dbSNP
rs1044319385 2258 dbSNP
rs1434099607 2259 dbSNP
rs904009701 2259 dbSNP
rs1424842021 2261 dbSNP
rs996818459 2279 dbSNP
rs776656468 2280 dbSNP
rs1264018274 2282 dbSNP
rs1215973907 2284 dbSNP
rs935594643 2286 dbSNP
rs1487958515 2291 dbSNP
rs1052666732 2294 dbSNP
rs1212029085 2296 dbSNP
rs1312574745 2310 dbSNP
rs1029674243 2311 dbSNP
rs1258882525 2317 dbSNP
rs1278340810 2318 dbSNP
rs1341924685 2318 dbSNP
rs1349953871 2320 dbSNP
rs1359242838 2321 dbSNP
rs896504562 2325 dbSNP
rs1215947091 2327 dbSNP
rs1021319443 2331 dbSNP
rs761908598 2331 dbSNP
rs112987259 2334 dbSNP
rs766284032 2345 dbSNP
rs1490888989 2352 dbSNP
rs1193086007 2353 dbSNP
rs1476866980 2354 dbSNP
rs1197577898 2368 dbSNP
rs1259644463 2368 dbSNP
rs1183558988 2384 dbSNP
rs1483497707 2386 dbSNP
rs1267033362 2390 dbSNP
rs184748977 2393 dbSNP
rs1207740970 2395 dbSNP
rs1319608375 2396 dbSNP
rs140720032 2407 dbSNP
rs1217583584 2412 dbSNP
rs979706981 2420 dbSNP
rs1419670542 2421 dbSNP
rs1397140094 2445 dbSNP
rs926339926 2446 dbSNP
rs1301528837 2451 dbSNP
rs995595424 2465 dbSNP
rs937763977 2471 dbSNP
rs1422291872 2478 dbSNP
rs1170260614 2500 dbSNP
rs1027260864 2505 dbSNP
rs1292594931 2520 dbSNP
rs150099393 2526 dbSNP
rs572987330 2528 dbSNP
rs1370273745 2530 dbSNP
rs991761017 2532 dbSNP
rs1424386809 2547 dbSNP
rs1255378065 2548 dbSNP
rs917593863 2550 dbSNP
rs1458943629 2565 dbSNP
rs1392915811 2571 dbSNP
rs982682107 2572 dbSNP
rs1238519931 2573 dbSNP
rs1019461255 2587 dbSNP
rs1047290988 2591 dbSNP
rs368014112 2595 dbSNP
rs965017827 2600 dbSNP
rs1321690463 2610 dbSNP
rs1311176170 2621 dbSNP
rs755762391 2632 dbSNP
rs941532366 2635 dbSNP
rs1378147057 2665 dbSNP
rs1331019484 2674 dbSNP
rs41303727 2675 dbSNP
rs1393129480 2678 dbSNP
rs1294261181 2683 dbSNP
rs1292544379 2693 dbSNP
rs899881198 2694 dbSNP
rs753375725 2699 dbSNP
rs1161630917 2707 dbSNP
rs1441397204 2723 dbSNP
rs920932692 2745 dbSNP
rs540856639 2748 dbSNP
rs202243058 2759 dbSNP
rs780873324 2761 dbSNP
rs978518909 2762 dbSNP
rs1487883691 2780 dbSNP
rs925463814 2791 dbSNP
rs746417230 2803 dbSNP
rs1242953044 2815 dbSNP
rs745369292 2826 dbSNP
rs1309062048 2829 dbSNP
rs1238425617 2840 dbSNP
rs772645131 2846 dbSNP
rs1302275325 2847 dbSNP
rs1386387619 2849 dbSNP
rs1388676913 2850 dbSNP
rs1300055398 2852 dbSNP
rs1421504438 2853 dbSNP
rs1361087387 2869 dbSNP
rs1157873899 2871 dbSNP
rs1468392263 2871 dbSNP
rs780212286 2881 dbSNP
rs769417302 2890 dbSNP
rs747401611 2893 dbSNP
rs896697924 2896 dbSNP
rs949612468 2899 dbSNP
rs1432166718 2903 dbSNP
rs1266164433 2924 dbSNP
rs528769512 2929 dbSNP
rs1218145920 2935 dbSNP
rs1488941423 2936 dbSNP
rs1045505092 2937 dbSNP
rs1215025927 2944 dbSNP
rs1386496948 2952 dbSNP
rs1256890273 2955 dbSNP
rs905179448 2957 dbSNP
rs1329552293 2960 dbSNP
rs1280255658 2962 dbSNP
rs968376711 2964 dbSNP
rs996019368 2971 dbSNP
rs1163542107 2974 dbSNP
rs1460635927 2976 dbSNP
rs979248828 2979 dbSNP
rs1033491596 2990 dbSNP
rs1404087260 2992 dbSNP
rs1048450538 3007 dbSNP
rs768821831 3008 dbSNP
rs1426763505 3010 dbSNP
rs1296193686 3019 dbSNP
rs371848438 3020 dbSNP
rs1399316664 3041 dbSNP
rs1477848930 3045 dbSNP
rs991854860 3047 dbSNP
rs1191670623 3051 dbSNP
rs917687398 3057 dbSNP
rs1279855280 3060 dbSNP
rs190098347 3067 dbSNP
rs928982762 3068 dbSNP
rs1003963312 3079 dbSNP
rs1226646380 3080 dbSNP
rs1260214967 3082 dbSNP
rs1019403965 3093 dbSNP
rs1317403570 3093 dbSNP
rs965300837 3096 dbSNP
rs1276308582 3100 dbSNP
rs1428562592 3109 dbSNP
rs1312155636 3113 dbSNP
rs1342177974 3115 dbSNP
rs996707610 3117 dbSNP
rs1028432122 3123 dbSNP
rs1403508550 3128 dbSNP
rs1206927994 3134 dbSNP
rs968391646 3141 dbSNP
rs373617975 3149 dbSNP
rs1249909049 3159 dbSNP
rs776892169 3176 dbSNP
rs1165640186 3178 dbSNP
rs1204773237 3179 dbSNP
rs149332426 3182 dbSNP
rs1460404133 3192 dbSNP
rs1180749619 3199 dbSNP
rs1240367842 3201 dbSNP
rs1419641817 3204 dbSNP
rs1457435019 3210 dbSNP
rs1271039769 3229 dbSNP
rs956859124 3243 dbSNP
rs1167888856 3250 dbSNP
rs1422585566 3264 dbSNP
rs1470115790 3275 dbSNP
rs1380315119 3277 dbSNP
rs1333050487 3285 dbSNP
rs988345003 3289 dbSNP
rs769835661 3291 dbSNP
rs1399091906 3299 dbSNP
rs1038526517 3302 dbSNP
rs1447224045 3306 dbSNP
rs1406580756 3308 dbSNP
rs921445088 3315 dbSNP
rs192139100 3318 dbSNP
rs759336649 3334 dbSNP
rs780204294 3346 dbSNP
rs1382564351 3349 dbSNP
rs932835025 3355 dbSNP
rs780361383 3368 dbSNP
rs1276526288 3373 dbSNP
rs1317595230 3375 dbSNP
rs1231363318 3379 dbSNP
rs1224474745 3380 dbSNP
rs1223929124 3389 dbSNP
rs1452278004 3392 dbSNP
rs1289156663 3401 dbSNP
rs767495435 3402 dbSNP
rs185070910 3418 dbSNP
rs891245440 3424 dbSNP
rs1311275425 3436 dbSNP
rs1441142132 3438 dbSNP
rs1009535201 3450 dbSNP
rs1372223104 3454 dbSNP
rs1210074609 3465 dbSNP
rs1042784288 3475 dbSNP
rs1438124031 3495 dbSNP
rs903744556 3497 dbSNP
rs1322237285 3503 dbSNP
rs1486570907 3507 dbSNP
rs1000750424 3514 dbSNP
rs1261977457 3515 dbSNP
rs1439446775 3520 dbSNP
rs760595471 3527 dbSNP
rs1193176626 3528 dbSNP
rs1178259285 3532 dbSNP
rs763806248 3535 dbSNP
rs1033583208 3539 dbSNP
rs1489851406 3547 dbSNP
rs1288053251 3551 dbSNP
rs1217191208 3557 dbSNP
rs1413771556 3558 dbSNP
rs1316158450 3564 dbSNP
rs1159761061 3576 dbSNP
rs1220607757 3579 dbSNP
rs1367848372 3603 dbSNP
rs11797317 3608 dbSNP
rs768851584 3614 dbSNP
rs1402517250 3618 dbSNP
rs1432969874 3621 dbSNP
rs1296468383 3622 dbSNP
rs1340099014 3624 dbSNP
rs1405805666 3625 dbSNP
rs1285540103 3629 dbSNP
rs1343323573 3630 dbSNP
rs1219101091 3631 dbSNP
rs1453625940 3633 dbSNP
rs1343817055 3640 dbSNP
rs1178673860 3643 dbSNP
rs1285562260 3652 dbSNP
rs774885842 3658 dbSNP
rs1424690018 3666 dbSNP
rs1319326436 3683 dbSNP
rs1478858508 3699 dbSNP
rs1263952446 3703 dbSNP
rs1213794595 3710 dbSNP
rs959179318 3736 dbSNP
rs2790965 3745 dbSNP
rs778225987 3749 dbSNP
rs1490398740 3766 dbSNP
rs1201136320 3775 dbSNP
rs772397968 3787 dbSNP
rs1013410679 3788 dbSNP
rs1211964543 3789 dbSNP
rs1244706233 3803 dbSNP
rs749948492 3808 dbSNP
rs1221252262 3814 dbSNP
rs758787231 3814 dbSNP
rs1477566716 3815 dbSNP
rs780637682 3817 dbSNP
rs1278203671 3819 dbSNP
rs1382214534 3820 dbSNP
rs1360484228 3821 dbSNP
rs1305000802 3829 dbSNP
rs755060200 3833 dbSNP
rs1405744518 3843 dbSNP
rs1174581344 3856 dbSNP
rs747356397 3878 dbSNP
rs60232124 3885 dbSNP
rs1427920869 3895 dbSNP
rs1417264466 3897 dbSNP
rs1183432722 3907 dbSNP
rs781391928 3907 dbSNP
rs375399620 3910 dbSNP
rs1201391512 3915 dbSNP
rs962964717 3920 dbSNP
rs974308596 3924 dbSNP
rs181764009 3936 dbSNP
rs1425468597 3939 dbSNP
rs1315461852 3946 dbSNP
rs760667258 3963 dbSNP
rs1382498327 3965 dbSNP
rs1335067594 3966 dbSNP
rs1449358020 3980 dbSNP
rs932804035 3985 dbSNP
rs1436205359 4003 dbSNP
rs1297726527 4020 dbSNP
rs1460512144 4033 dbSNP
rs1051272273 4041 dbSNP
rs1280553707 4049 dbSNP
rs1455767004 4049 dbSNP
rs1445097103 4055 dbSNP
rs1384393852 4072 dbSNP
rs1181519980 4074 dbSNP
rs1441206633 4079 dbSNP
rs772839497 4087 dbSNP
rs1238644119 4091 dbSNP
rs1194824964 4095 dbSNP
rs912608295 4103 dbSNP
rs945470298 4106 dbSNP
rs1042362474 4111 dbSNP
rs1359326214 4122 dbSNP
rs1359549426 4124 dbSNP
rs1242735548 4129 dbSNP
rs1377993140 4137 dbSNP
rs1306590843 4139 dbSNP
rs766483536 4140 dbSNP
rs903836151 4147 dbSNP
rs1425284996 4158 dbSNP
rs1364854361 4161 dbSNP
rs1224146255 4164 dbSNP
rs1287295401 4170 dbSNP
rs1000843396 4176 dbSNP
rs770070400 4198 dbSNP
rs1450722396 4203 dbSNP
rs752518010 4204 dbSNP
rs1013339434 4209 dbSNP
rs200295385 4209 dbSNP
rs185393330 4210 dbSNP
rs1437705105 4231 dbSNP
rs1219370845 4235 dbSNP
rs1260440445 4236 dbSNP
rs1354909853 4236 dbSNP
rs1177940655 4239 dbSNP
rs950475516 4241 dbSNP
rs1005055433 4243 dbSNP
rs1302119897 4249 dbSNP
rs1379712705 4255 dbSNP
rs1445307212 4256 dbSNP
rs771880982 4263 dbSNP
rs1401691619 4279 dbSNP
rs1388815239 4283 dbSNP
rs1157766318 4288 dbSNP
rs1451256543 4288 dbSNP
rs775608222 4314 dbSNP
rs142510006 4320 dbSNP
rs1176594117 4339 dbSNP
rs1329914528 4341 dbSNP
rs1266104931 4342 dbSNP
rs1356642142 4345 dbSNP
rs1016045484 4356 dbSNP
rs1445134619 4360 dbSNP
rs1203751330 4371 dbSNP
rs1309152606 4375 dbSNP
rs963020962 4385 dbSNP
rs764060984 4386 dbSNP
rs764037489 4400 dbSNP
rs1384269391 4405 dbSNP
rs1223089234 4409 dbSNP
rs1247493140 4420 dbSNP
rs1280106943 4434 dbSNP
rs1401826730 4436 dbSNP
rs1281970417 4445 dbSNP
rs1317431032 4445 dbSNP
rs974445916 4449 dbSNP
rs753697242 4454 dbSNP
rs1404031369 4455 dbSNP
rs1337020693 4459 dbSNP
rs1214828835 4469 dbSNP
rs189311657 4470 dbSNP
rs1028573245 4472 dbSNP
rs1274773941 4475 dbSNP
rs764970432 4481 dbSNP
rs751334437 4487 dbSNP
rs1197847266 4488 dbSNP
rs1244054040 4494 dbSNP
rs1203284098 4497 dbSNP
rs1460137828 4511 dbSNP
rs1260147907 4513 dbSNP
rs749851022 4514 dbSNP
rs1215204267 4517 dbSNP
rs986942396 4523 dbSNP
rs1269548796 4537 dbSNP
rs1225105433 4540 dbSNP
rs1166195216 4558 dbSNP
rs1243674538 4571 dbSNP
rs1462630505 4584 dbSNP
rs1315408460 4595 dbSNP
rs1189647184 4596 dbSNP
rs1403434046 4599 dbSNP
rs1366826336 4600 dbSNP
rs1332840752 4605 dbSNP
rs1410062988 4611 dbSNP
rs912735184 4612 dbSNP
rs945594767 4619 dbSNP
rs1474025044 4622 dbSNP
rs1386310226 4624 dbSNP
rs1183358549 4633 dbSNP
rs978561192 4642 dbSNP
rs1464388133 4644 dbSNP
rs551154879 4646 dbSNP
rs925428355 4655 dbSNP
rs1331143146 4665 dbSNP
rs1407447087 4667 dbSNP
rs757979966 4677 dbSNP
rs770339005 4682 dbSNP
rs1455077411 4690 dbSNP
rs1331578569 4697 dbSNP
rs1194019750 4700 dbSNP
rs1361489774 4706 dbSNP
rs1339373657 4725 dbSNP
rs1227628908 4726 dbSNP
rs757103536 4727 dbSNP
rs766769399 4727 dbSNP
rs1442397128 4745 dbSNP
rs1334673857 4753 dbSNP
rs1315753542 4775 dbSNP
rs1326261297 4776 dbSNP
rs1217759960 4780 dbSNP
rs1470466953 4784 dbSNP
rs1366696291 4785 dbSNP
rs780822202 4789 dbSNP
rs1055055462 4792 dbSNP
rs895028758 4795 dbSNP
rs1178003765 4802 dbSNP
rs1325538601 4803 dbSNP
rs1469769017 4804 dbSNP
rs949324561 4810 dbSNP
rs1201089273 4820 dbSNP
rs1490831870 4828 dbSNP
rs1046202982 4834 dbSNP
rs1254098571 4848 dbSNP
rs1441901588 4849 dbSNP
rs1357015105 4878 dbSNP
rs752130496 4879 dbSNP
rs1224048320 4903 dbSNP
rs886258517 4905 dbSNP
rs1265567241 4913 dbSNP
rs1004743348 4918 dbSNP
rs1406219976 4920 dbSNP
rs1476992108 4925 dbSNP
rs1303117392 4927 dbSNP
rs1403570428 4932 dbSNP
rs1338954550 4943 dbSNP
rs1398310903 4979 dbSNP
rs1160274669 4984 dbSNP
rs1400415501 4985 dbSNP
rs1170351324 4991 dbSNP
rs1406024571 5005 dbSNP
rs1174440388 5006 dbSNP
rs750099390 5007 dbSNP
rs1268187026 5010 dbSNP
rs1198615873 5023 dbSNP
rs1489835186 5025 dbSNP
rs1243697287 5027 dbSNP
rs1467971766 5042 dbSNP
rs1171352065 5049 dbSNP
rs1402195143 5059 dbSNP
rs1382296953 5076 dbSNP
rs1281723427 5080 dbSNP
rs1299547967 5091 dbSNP
rs1224929939 5098 dbSNP
rs755325993 5102 dbSNP
rs898950853 5110 dbSNP
rs995802128 5110 dbSNP
rs1028681130 5112 dbSNP
rs5939034 5121 dbSNP
rs987446210 5126 dbSNP
rs1430434520 5136 dbSNP
rs111342933 5148 dbSNP
rs748517716 5181 dbSNP
rs967275387 5196 dbSNP
rs1255335768 5212 dbSNP
rs978317209 5214 dbSNP
rs1174361527 5218 dbSNP
rs1479437271 5219 dbSNP
rs1421538057 5220 dbSNP
rs1485441568 5223 dbSNP
rs756251590 5228 dbSNP
rs1351359980 5229 dbSNP
rs1461482583 5230 dbSNP
rs1262041666 5231 dbSNP
rs139646721 5245 dbSNP
rs1309836691 5246 dbSNP
rs1288278442 5254 dbSNP
rs1487408470 5256 dbSNP
rs1193223421 5267 dbSNP
rs1360327715 5270 dbSNP
rs1269980480 5272 dbSNP
rs1317598095 5272 dbSNP
rs925324923 5275 dbSNP
rs1405580121 5280 dbSNP
rs868518819 5281 dbSNP
rs749295147 5289 dbSNP
rs1435266995 5297 dbSNP
rs1463608876 5312 dbSNP
rs936761505 5316 dbSNP
rs1171070187 5326 dbSNP
rs990758034 5332 dbSNP
rs1417204105 5334 dbSNP
rs1185199553 5338 dbSNP
rs1444907549 5341 dbSNP
rs1242120203 5359 dbSNP
rs1201335280 5360 dbSNP
rs201469341 5365 dbSNP
rs1197283655 5366 dbSNP
rs199691966 5368 dbSNP
rs1377532166 5373 dbSNP
rs916594407 5376 dbSNP
rs1306265236 5377 dbSNP
rs371873636 5381 dbSNP
rs1294452366 5383 dbSNP
rs1159884001 5399 dbSNP
rs949416904 5399 dbSNP
rs1382426360 5413 dbSNP
rs1046728092 5414 dbSNP
rs1393295771 5416 dbSNP
rs1358075344 5418 dbSNP
rs1418650001 5423 dbSNP
rs1297670783 5426 dbSNP
rs1461483127 5437 dbSNP
rs1303363530 5438 dbSNP
rs1425091442 5449 dbSNP
rs771108892 5454 dbSNP
rs1384338524 5458 dbSNP
rs1184977296 5459 dbSNP
rs1420488623 5460 dbSNP
rs778296016 5462 dbSNP
rs940512865 5472 dbSNP
rs1479970591 5479 dbSNP
rs1384831415 5480 dbSNP
rs1223824369 5493 dbSNP
rs1359176227 5505 dbSNP
rs1289977102 5509 dbSNP
rs867175275 5513 dbSNP
rs1241521313 5515 dbSNP
rs1300387698 5517 dbSNP
rs1306442213 5523 dbSNP
rs1389722428 5532 dbSNP
rs181422077 5537 dbSNP
rs111361441 5540 dbSNP
rs1405412105 5542 dbSNP
rs898890465 5542 dbSNP
rs1241136046 5547 dbSNP
rs41305403 5551 dbSNP
rs1363996735 5554 dbSNP
rs1455060036 5554 dbSNP
rs1157849281 5566 dbSNP
rs1430704087 5567 dbSNP
rs1471339560 5567 dbSNP
rs768715214 5568 dbSNP
rs1200800902 5569 dbSNP
rs1490326625 5575 dbSNP
rs1267298009 5581 dbSNP
rs769252734 5594 dbSNP
rs1486344833 5595 dbSNP
rs1260385061 5599 dbSNP
rs150622486 5611 dbSNP
rs1325766623 5618 dbSNP
rs1283985770 5620 dbSNP
rs1224116362 5624 dbSNP
rs1344768234 5627 dbSNP
rs748506655 5635 dbSNP
rs761688338 5635 dbSNP
rs4579679 5650 dbSNP
rs995937960 5654 dbSNP
rs1385345967 5658 dbSNP
rs1028772653 5659 dbSNP
rs764778002 5667 dbSNP
rs772960968 5668 dbSNP
rs1008602013 5671 dbSNP
rs1480421979 5672 dbSNP
rs762369621 5681 dbSNP
rs1020277519 5695 dbSNP
rs186430406 5722 dbSNP
rs1000061785 5727 dbSNP
rs1032491670 5743 dbSNP
rs1207074400 5745 dbSNP
rs958087732 5746 dbSNP
rs751083366 5757 dbSNP
rs1263874253 5769 dbSNP
rs1280876176 5771 dbSNP
rs1203090486 5780 dbSNP
rs990851305 5784 dbSNP
rs916689434 5792 dbSNP
rs1379060807 5793 dbSNP
rs1326816068 5794 dbSNP
rs1438533669 5801 dbSNP
rs971136134 5812 dbSNP
rs1163709500 5827 dbSNP
rs1351234014 5836 dbSNP
rs1336878968 5841 dbSNP
rs773502032 5845 dbSNP
rs907751800 5846 dbSNP
rs1170155647 5847 dbSNP
rs1292691338 5848 dbSNP
rs3187158 5855 dbSNP
rs1396952847 5893 dbSNP
rs1372932412 5898 dbSNP
rs747267010 5909 dbSNP
rs1448827548 5927 dbSNP
rs1329212087 5928 dbSNP
rs940636042 5937 dbSNP
rs1183175422 5950 dbSNP
rs1376158493 5963 dbSNP
rs1037909325 5966 dbSNP
rs1197540123 5970 dbSNP
rs1339991312 5989 dbSNP
rs908151154 5991 dbSNP
rs1273702262 5998 dbSNP
rs1225877710 6002 dbSNP
rs920411490 6003 dbSNP
rs1315348116 6018 dbSNP
rs3735 6025 dbSNP
rs1451377068 6027 dbSNP
rs1338207789 6034 dbSNP
rs1330297125 6035 dbSNP
rs931823974 6037 dbSNP
rs1323684599 6048 dbSNP
rs1242926797 6050 dbSNP
rs1265164977 6051 dbSNP
rs1163187358 6067 dbSNP
rs1386176556 6067 dbSNP
rs1471923897 6070 dbSNP
rs1481154671 6084 dbSNP
rs890244000 6089 dbSNP
rs1251024292 6092 dbSNP
rs1438379111 6092 dbSNP
rs1200986694 6096 dbSNP
rs755411809 6098 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000373504.6 | 3UTR | CUUUCACUGCUGCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000373504.6 | 3UTR | AACUUUCACUGCUGCUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000373504.6 | 3UTR | ACUUUCACUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000373504.6 | 3UTR | AAACUUUCACUGCUGCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000373504.6 | 3UTR | ACUUUCACUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000373504.6 | 3UTR | AAACUUUCACUGCUGCUUCUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000373504.6 | 3UTR | AAACUUUCACUGCUGCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000373504.6 | 3UTR | AAACUUUCACUGCUGCUUCUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000373504.6 | 3UTR | CUUUCACUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.813 1.2e-6 0.656 3.4e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.592 3.0e-3 0.729 1.3e-4 20 Click to see details
GSE19536 Breast cancer 0.232 1.0e-2 0.247 6.6e-3 100 Click to see details
GSE19783 ER- ER- breast cancer 0.252 1.3e-2 0.266 8.9e-3 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.4 2.4e-2 0.153 2.3e-1 25 Click to see details
GSE38226 Liver fibrosis -0.408 3.3e-2 -0.388 4.1e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.144 8.8e-2 0.082 2.2e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.382 1.1e-1 0.357 1.3e-1 12 Click to see details
GSE28544 Breast cancer -0.234 1.4e-1 -0.604 8.9e-4 24 Click to see details
GSE28260 Renal cortex and medulla -0.288 1.7e-1 -0.214 2.4e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer 0.196 2.0e-1 0.253 1.4e-1 20 Click to see details
GSE21849 B cell lymphoma -0.139 2.4e-1 0.119 2.7e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells 0.125 2.8e-1 0.148 2.5e-1 24 Click to see details
GSE17306 Multiple myeloma 0.059 3.4e-1 0.108 2.3e-1 49 Click to see details
GSE21032 Prostate cancer 0.037 3.7e-1 0.117 1.5e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.061 3.9e-1 -0.114 2.9e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.023 4.5e-1 0.040 4.1e-1 32 Click to see details
GSE21687 Ependynoma primary tumors 0.009 4.7e-1 0.027 4.2e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.009 4.7e-1 0.027 4.2e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.505 0 -0.491 0 32 Click to see details
BLCA -0.585 0.01 -0.633 0 18 Click to see details
HNSC -0.384 0.01 -0.440 0 42 Click to see details
LUAD 0.632 0.01 0.490 0.05 12 Click to see details
COAD -0.692 0.03 -0.905 0 8 Click to see details
PRAD -0.217 0.07 -0.142 0.16 50 Click to see details
THCA -0.182 0.08 -0.178 0.09 59 Click to see details
PCPG -0.882 0.16 -1.000 0.5 3 Click to see details
ESCA -0.327 0.16 -0.082 0.41 11 Click to see details
KIRC 0.097 0.22 0.119 0.17 68 Click to see details
PAAD 0.56 0.22 0.400 0.3 4 Click to see details
BRCA -0.071 0.26 -0.062 0.29 84 Click to see details
UCEC 0.149 0.27 -0.035 0.44 19 Click to see details
CHOL -0.184 0.32 0.033 0.47 9 Click to see details
KICH 0.099 0.32 0.136 0.26 25 Click to see details
KIRP 0.085 0.32 0.086 0.32 32 Click to see details
LUSC 0.057 0.37 0.085 0.31 38 Click to see details
CESC -0.358 0.38 -0.500 0.33 3 Click to see details
LIHC -0.033 0.41 -0.057 0.35 49 Click to see details
LIHC -0.033 0.41 -0.057 0.35 49 Click to see details
LIHC -0.033 0.41 -0.057 0.35 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2