miRTarBase - #MIRT324839 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IFT74   
Synonyms BBS20, CCDC2, CMG-1, CMG1
Description intraflagellar transport 74
Transcript NM_001099222   
Other Transcripts NM_001099223 , NM_001099224 , NM_025103   
Expression
Putative miRNA Targets on IFT74
3'UTR of IFT74
(miRNA target sites are highlighted)
>IFT74|NM_001099222|3'UTR
   1 GTTTAAGTCCACTGAAAGTCTCTAAGGAAGTATCCTCTTGCTGCTAAACTTGGTACAAGTTGACTACCAAAAAAAAAAAA
  81 AGCTTACTTTTGGAGTTTACCTAAAATTTCTGAATGTTATAATTTTTGTGGCCTCTTTTAAGAATGATATTTTAAAATAG
 161 TAAATAGTTCAATAAATGGTTTGCATATTAAAAAGTACCATCTTCTTTTCTTTTTATGCTACTTGTATTTGAACCAAGAG
 241 ATAAAGAAACTAAAAGTGACCGTTGAAATTTATTTAGCTGGTATAATCCATCTATGGCAACAAATGAGATAAGCTTTTCT
 321 TGTATCAACTCTAGGACGGATGCATGGAGTATGATTCTGATTTAGCACTTAGATCAACCTTGTCAATTTTTACTTCTAGA
 401 AAAAATTAGTAAGATTAGAAGGGAGATTTTTAGCTTTGAATGTTACTTCTCAAATAGGTTATATTTGATGTGTATTAGAC
 481 CATATAATGTCACAGGTAAATATATAACATATATTCTTTATATAGCAGTTATACCTAAAGATTTGGAATTAGAAACTTTT
 561 AATCTTTGCAATTCTTAAAATATTTTTTCACATATATATACCTGGAAGAACATTAGGTAAAAGACTACATTTATAGTGGG
 641 CTGTTTTGGACTATGGCTACTGCTGTTCATTGCCACCCTGCAGTATGCATTTACTCTCTTGTACTATTAGGAGAACTTAA
 721 GTAGATTAATTTATAAACATTAGCCAGAATATTTGGGGAAAAAAGCTAGAAGAGGTAGGATTGGGAGAGAGGCATAGAGT
 801 CTGGAAGACATTATATTAACTGTAGATGTATCTTCTCTTATCGTGCAGGAATGAGTCACCTTGGCCAGCATAAAATATTA
 881 CTTAAAACTATCCTGTTTTTGCTCTGATATCATGTTCACTAAGTAACTCTACTTTTCAGTATTTCTGAAACAACACATTG
 961 ATTTCTTAAACCAAAATAGCTTTATTGAGATATTATTTACATACTTTAAAATTTACTCATATATGTTGATTTTTAAAAAT
1041 AAATATTTATAATGGTAAATTATTCAAATTCAGTCTATATACATTTAAATAAAGGAGTGAGCATTGTTGAGTTTGCTGAA
1121 CTCTGGATTACTAATATGGCTGAAGATCCTGGACATTCATTAAGGTAGCATTCATAAAATGTGTTCCATAAATCCTGAGC
1201 ATCTTGAGTTATTAATAGTGTTATGCCTCCAAAGGATTCATGGTCAAAGAAGTTTGGGAAACGTTGTCTGAAACAAAGGT
1281 GAATTATTTTATTTTTTCTTGACTGCTCATAACCCTTAATATGCTAATGTATAATAAGCTCAAGAAGAATATATACTGTA
1361 AAGCATTTCCCAGAGATAGTTGTCCACAAAACCCTAACTTTCACAGAGCCTAGGTCACATGAGATGTGTCATTCCAAGAA
1441 ATAGACTTTGTACACCAAATAGACTTCATACACTAAAATAATTTCATCTACTCAAGTCCTCTGGGTGGCTCTATGGCCTT
1521 TTTCAGATGACTCCTGAGTATGTCTCTTTTTAGCCACCCTCAGCTGTTTTATGCTGTGATTGTATGGGGTTTTCTATTGG
1601 AAATTGGTAGCAGAAAGTGCTTATAAAATTTCACAAGGGAAAAAAACTCTTTTAGCAGTTAAAGAGAATGAAATCTGAAA
1681 TTCAGTAGATAAAACAGGTAATAGATTTTGATGACAGTTTGCAGCCCTTCGTTCATTCATAAAGTATTACTGTAATTTGG
1761 TGATTAGGAGCCTTTATGGATATACCCGACTGCTGAAAAACATTCATCTTTTATACAGTAACAAACAGAGGTATGATTGA
1841 GCATAGAGTTTAGGCAAGAGAACTGACTACTATGGTCTCTTAATCACATTGATTCTATTTCGTGGATACTTCCAAGGAGG
1921 AAGGGAATCTGGAAAACATGTTTGTGGATAGGTAATCTTTGTTTTCCTCATTTGAAAGCAAATTTAAATGCCTTTACTTT
2001 TTCCTTAGGTTTTTTTTTATGATTTCTACTTAAGTGTTCTTGACATTTTACTGCACCCTTTTAAATAACCAACTTAGTAA
2081 TTTTTACTATTAGTAATAAGGGTTTTTTTCTGAGTGGTGGGATTATGGGTGATTGTAATCTTCCTTGGGCTTTTTGGTAT
2161 TTTCAAAATTGTCTGTGATGTACATTTAATACTTAGAAATGCAATAAAATTCAAATAAAGTACTATATGCAGTTACTACT
2241 TTAACTGACAGAAAGGATGTAGTAAAAACTCTTAAGTCCTTGACTCTAGAACTGAACCAATCTTTACGCAGAAAGAAAGT
2321 AGGAGGAAGATTGGCCTGTCCATTAAATATATGTGTTTGCATTATAACAATGGGAAATTTGGCAGGAAAAAAATTTCTTG
2401 ACAAAAAGCAAGGCTTTCAATTTCCATCCTAATTTATTCATATGTAATATTGGTGGGGGGCAAATAATTGAGCAGGATTT
2481 CTTTAAATTAAAACATGTTTTATCTGAGGGAAATTCTCACTAATGTCTCTCTTCCTTCCTCTGAGAGCCTTTCCACAAAT
2561 CCAACAAGAATATTCTCTTTACTGGGATAGAACTGGAGGCTAATAGCTGCATGAACTGGCTCTTCCTGAGTCAGTCACAT
2641 TACTCAGGGGGTTCCATTCATGCTAAAATAACACCTTGTAAGTCACATGGAAAGAAGCTGCAGACTGAACAAACATGCTG
2721 AGCAGTTTTACTAGTGAAGATCAACATGGGAAAGTTAGCAAGTCTTTGTTTTTCCCATCCTTATCTTTTATCAGTAAATA
2801 AACATGAGTTCTTGATATTCTTTTTCCTGTGGAGCCCCTCGTTTGGACAATACTATAGTCTCATTTTAAGGTACAAAATT
2881 CAGTGCCTGCTTAGAGGATTACAGCATGGAGTAATCATATTCACACCAGAGATGAAAGGCCAGTTAGTAGTAGTTCCAGG
2961 GGTTTTTGCTGTTCCCTTGCTCAGTTTCTCTAGACTTCTTTCCTTTTGCTATACAATTGCAGTGTAAACAACCTTAGGGA
3041 AATTATAATGTTTAGACTCAAAGTAAGAAGAAATAAAGATGGACCACTAGAGAATTGTAGTAATCTATTTTTAAATTGAT
3121 ATTGTGTCTCATTTTTGTATAACTTTTGAAATAAAAGTAGATTATGTCTTAAAATTGTAAGTTTACAGTTTGATAACTGA
3201 AAAACATTTTTAAAAAGGCAATTTTTAATACAAAGGTAGATAATTTAGGAAGACAGATAAATAAAATGAAGAAAGTAAGT
3281 TACTTGTGATCTCACCAGTCTTTTTAGATACGCATCTATATTTATGTCACACATATCTGTTTTATTTATGTATTTATGCA
3361 CCTTTAATTAAATTAAAATTATATTGTTTTTAATTTTAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUA--AUACACGACGAu 5'
             :|| :||  | | ||||||| 
Target 5' aagGAAGTATCCTCT-TGCTGCTa 3'
24 - 46 148.00 -13.80
2
miRNA  3' guGUUUGGUA---AUACACGACGAu 5'
            :::||:||   ||  |||||:| 
Target 5' ttTGGACTATGGCTA-CTGCTGTTc 3'
645 - 668 135.00 -10.00
3
miRNA  3' guGUUUGGUAAUACAC-GACGAu 5'
            ||||  |||  ||| ||||| 
Target 5' taCAAA--ATTCAGTGCCTGCTt 3'
2872 - 2892 132.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30486493 7 COSMIC
COSN24311560 28 COSMIC
COSN19656510 69 COSMIC
COSN27374051 82 COSMIC
COSN27508291 82 COSMIC
COSN31532447 112 COSMIC
COSN19708575 137 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777791918 2 dbSNP
rs567648616 7 dbSNP
rs770771280 10 dbSNP
rs1229533190 12 dbSNP
rs781018602 15 dbSNP
rs745511755 17 dbSNP
rs377624020 23 dbSNP
rs1271608649 24 dbSNP
rs769475958 25 dbSNP
rs1209643101 29 dbSNP
rs1446926801 30 dbSNP
rs371011235 42 dbSNP
rs1484969711 44 dbSNP
rs535158089 57 dbSNP
rs553671179 60 dbSNP
rs937540963 63 dbSNP
rs1366903996 65 dbSNP
rs1406029598 66 dbSNP
rs1303148218 68 dbSNP
rs1290659854 69 dbSNP
rs1397700131 69 dbSNP
rs774904497 69 dbSNP
rs78285541 70 dbSNP
rs991642749 74 dbSNP
rs1414167728 78 dbSNP
rs572235719 82 dbSNP
rs917529000 83 dbSNP
rs950298008 96 dbSNP
rs1414794088 101 dbSNP
rs1418481544 102 dbSNP
rs539668265 120 dbSNP
rs910804577 121 dbSNP
rs1478892038 132 dbSNP
rs1325037396 134 dbSNP
rs897490574 137 dbSNP
rs930285857 140 dbSNP
rs1049322491 142 dbSNP
rs563698798 143 dbSNP
rs1307312748 144 dbSNP
rs375746055 145 dbSNP
rs1293967739 147 dbSNP
rs1043233780 151 dbSNP
rs1018713147 161 dbSNP
rs558053622 162 dbSNP
rs901658389 165 dbSNP
rs1232129999 179 dbSNP
rs566025405 180 dbSNP
rs934717007 184 dbSNP
rs543396016 186 dbSNP
rs183547380 191 dbSNP
rs1328963039 196 dbSNP
rs1262211852 199 dbSNP
rs978779031 201 dbSNP
rs573646485 206 dbSNP
rs541147829 211 dbSNP
rs369859631 222 dbSNP
rs559204120 241 dbSNP
rs1424788068 251 dbSNP
rs1182968706 252 dbSNP
rs757610734 253 dbSNP
rs1005450167 262 dbSNP
rs781596716 263 dbSNP
rs1200900334 266 dbSNP
rs972311883 269 dbSNP
rs1458852337 281 dbSNP
rs919512711 284 dbSNP
rs1364194766 287 dbSNP
rs930337657 295 dbSNP
rs1048707919 302 dbSNP
rs961249941 306 dbSNP
rs910315298 314 dbSNP
rs943137055 321 dbSNP
rs528469393 322 dbSNP
rs1401349563 338 dbSNP
rs1325509360 340 dbSNP
rs1456535859 345 dbSNP
rs1380729705 354 dbSNP
rs1351694361 360 dbSNP
rs998311214 361 dbSNP
rs1029417692 367 dbSNP
rs1419065655 371 dbSNP
rs1378983197 373 dbSNP
rs901688051 376 dbSNP
rs1009354490 378 dbSNP
rs1383577714 399 dbSNP
rs1252708823 404 dbSNP
rs1042732820 406 dbSNP
rs1487262396 415 dbSNP
rs953968928 422 dbSNP
rs1266764686 433 dbSNP
rs903757478 434 dbSNP
rs1352955358 435 dbSNP
rs1283754511 440 dbSNP
rs1000629419 441 dbSNP
rs4463511 442 dbSNP
rs1385381522 443 dbSNP
rs796998949 444 dbSNP
rs1294248147 446 dbSNP
rs1453110459 447 dbSNP
rs1358661298 449 dbSNP
rs866034961 452 dbSNP
rs1420781944 456 dbSNP
rs1394860603 458 dbSNP
rs1197193519 463 dbSNP
rs1485456213 465 dbSNP
rs968939896 468 dbSNP
rs1268993045 472 dbSNP
rs1186243751 473 dbSNP
rs1191305922 477 dbSNP
rs1487691726 484 dbSNP
rs979025565 484 dbSNP
rs1260340129 489 dbSNP
rs1218718932 499 dbSNP
rs924743068 501 dbSNP
rs188489433 504 dbSNP
rs1255254774 505 dbSNP
rs1230769923 507 dbSNP
rs1244645280 509 dbSNP
rs148184782 512 dbSNP
rs1399580084 517 dbSNP
rs917335114 532 dbSNP
rs948837767 543 dbSNP
rs971594318 545 dbSNP
rs1401214237 547 dbSNP
rs1375358506 556 dbSNP
rs1171241194 578 dbSNP
rs1467869389 583 dbSNP
rs1444884434 585 dbSNP
rs1378529508 586 dbSNP
rs1182394521 595 dbSNP
rs1477256339 597 dbSNP
rs972248019 601 dbSNP
rs756688721 603 dbSNP
rs888467896 606 dbSNP
rs952309661 611 dbSNP
rs779962625 615 dbSNP
rs531154098 622 dbSNP
rs1484125476 624 dbSNP
rs1005397794 626 dbSNP
rs985422039 627 dbSNP
rs548954398 633 dbSNP
rs372618840 637 dbSNP
rs896942996 641 dbSNP
rs1219302870 642 dbSNP
rs1183549861 644 dbSNP
rs1040139572 649 dbSNP
rs1398250700 654 dbSNP
rs1407048011 658 dbSNP
rs1399606388 661 dbSNP
rs998027480 679 dbSNP
rs1464834712 687 dbSNP
rs1420995875 689 dbSNP
rs1312936224 691 dbSNP
rs1172247882 694 dbSNP
rs1375639868 695 dbSNP
rs1225384060 697 dbSNP
rs1029943598 701 dbSNP
rs1307663334 702 dbSNP
rs1185347738 705 dbSNP
rs953807013 707 dbSNP
rs141373427 711 dbSNP
rs1021944605 718 dbSNP
rs779283704 721 dbSNP
rs1000802840 725 dbSNP
rs967717503 729 dbSNP
rs978973042 736 dbSNP
rs1199458387 738 dbSNP
rs924889735 739 dbSNP
rs1282440303 748 dbSNP
rs894481767 748 dbSNP
rs956526948 754 dbSNP
rs1235228832 756 dbSNP
rs1481365779 757 dbSNP
rs993000543 758 dbSNP
rs1341582847 759 dbSNP
rs1012918832 760 dbSNP
rs917431209 761 dbSNP
rs1407956328 767 dbSNP
rs1024428385 769 dbSNP
rs534787624 775 dbSNP
rs1402864499 778 dbSNP
rs547045811 782 dbSNP
rs994093355 783 dbSNP
rs909853361 792 dbSNP
rs1469434443 793 dbSNP
rs1160946843 800 dbSNP
rs571668387 805 dbSNP
rs1332513681 806 dbSNP
rs1356353421 811 dbSNP
rs1443081922 820 dbSNP
rs539606229 826 dbSNP
rs1177820889 827 dbSNP
rs941368470 829 dbSNP
rs985064557 833 dbSNP
rs1037479421 836 dbSNP
rs1287896464 842 dbSNP
rs150786054 843 dbSNP
rs1357726164 844 dbSNP
rs998538964 863 dbSNP
rs934290868 865 dbSNP
rs1276606163 867 dbSNP
rs1379592243 869 dbSNP
rs1310363075 872 dbSNP
rs945165832 879 dbSNP
rs1324074277 881 dbSNP
rs748449636 901 dbSNP
rs1330136599 903 dbSNP
rs139153625 911 dbSNP
rs1050929516 921 dbSNP
rs889641926 928 dbSNP
rs537385402 931 dbSNP
rs1222517057 937 dbSNP
rs1406568745 939 dbSNP
rs1276113353 949 dbSNP
rs1006615187 952 dbSNP
rs1417718039 954 dbSNP
rs193237591 955 dbSNP
rs1231843671 956 dbSNP
rs111466918 962 dbSNP
rs1245171941 973 dbSNP
rs1201234014 976 dbSNP
rs1452282005 980 dbSNP
rs1202248332 981 dbSNP
rs184841561 982 dbSNP
rs779371483 993 dbSNP
rs895055635 994 dbSNP
rs1218983331 1002 dbSNP
rs999195358 1019 dbSNP
rs1272749394 1020 dbSNP
rs1438106701 1026 dbSNP
rs1045741115 1030 dbSNP
rs1296964719 1030 dbSNP
rs1398141834 1036 dbSNP
rs1159616784 1037 dbSNP
rs907177819 1037 dbSNP
rs1413734406 1052 dbSNP
rs1171012065 1056 dbSNP
rs1174554035 1057 dbSNP
rs1480847997 1061 dbSNP
rs1031116090 1067 dbSNP
rs956300227 1074 dbSNP
rs887993268 1075 dbSNP
rs1006795370 1079 dbSNP
rs1017843103 1084 dbSNP
rs1368804834 1089 dbSNP
rs776528743 1091 dbSNP
rs540685566 1105 dbSNP
rs1304950508 1109 dbSNP
rs145992226 1112 dbSNP
rs1277081380 1119 dbSNP
rs1216222060 1125 dbSNP
rs1435562432 1127 dbSNP
rs1272883099 1144 dbSNP
rs1340988765 1149 dbSNP
rs1214802617 1151 dbSNP
rs1271614015 1156 dbSNP
rs115651717 1159 dbSNP
rs779153529 1164 dbSNP
rs1470459815 1171 dbSNP
rs1225366222 1172 dbSNP
rs1293196063 1175 dbSNP
rs1168670378 1196 dbSNP
rs909968588 1200 dbSNP
rs1478861078 1204 dbSNP
rs941483941 1211 dbSNP
rs1490335201 1212 dbSNP
rs972746064 1218 dbSNP
rs563234615 1219 dbSNP
rs933899956 1221 dbSNP
rs1051465551 1222 dbSNP
rs889588325 1228 dbSNP
rs936551605 1230 dbSNP
rs545191419 1236 dbSNP
rs990637573 1242 dbSNP
rs1461527259 1243 dbSNP
rs563578714 1248 dbSNP
rs1257069380 1253 dbSNP
rs140094210 1263 dbSNP
rs533338416 1263 dbSNP
rs116140020 1264 dbSNP
rs1227738432 1269 dbSNP
rs903595318 1273 dbSNP
rs1285786936 1275 dbSNP
rs80157293 1282 dbSNP
rs1030644614 1283 dbSNP
rs528455542 1290 dbSNP
rs1165368486 1294 dbSNP
rs1366063149 1295 dbSNP
rs1006412643 1298 dbSNP
rs1164162076 1308 dbSNP
rs1321263582 1309 dbSNP
rs1404153967 1309 dbSNP
rs1184711787 1310 dbSNP
rs546689764 1315 dbSNP
rs571668735 1316 dbSNP
rs879082773 1318 dbSNP
rs187773186 1320 dbSNP
rs774799954 1322 dbSNP
rs1251444567 1327 dbSNP
rs1220159783 1329 dbSNP
rs1319898656 1330 dbSNP
rs1014476420 1331 dbSNP
rs1293897240 1334 dbSNP
rs1246559542 1342 dbSNP
rs1017746773 1347 dbSNP
rs1362366026 1348 dbSNP
rs560506527 1359 dbSNP
rs997731886 1366 dbSNP
rs1293063812 1373 dbSNP
rs970324587 1379 dbSNP
rs980232328 1385 dbSNP
rs1030500755 1386 dbSNP
rs796145788 1388 dbSNP
rs1378930990 1392 dbSNP
rs1160810854 1399 dbSNP
rs999589220 1409 dbSNP
rs551593325 1413 dbSNP
rs962750318 1414 dbSNP
rs1487231143 1419 dbSNP
rs1310905011 1431 dbSNP
rs747677531 1442 dbSNP
rs569901524 1443 dbSNP
rs1286765193 1446 dbSNP
rs1448005495 1459 dbSNP
rs1215290340 1465 dbSNP
rs537264619 1466 dbSNP
rs191127573 1468 dbSNP
rs1240888691 1482 dbSNP
rs796728035 1494 dbSNP
rs567458153 1496 dbSNP
rs1446698221 1499 dbSNP
rs1184246365 1509 dbSNP
rs918566408 1514 dbSNP
rs1217633017 1529 dbSNP
rs1384692538 1533 dbSNP
rs933992192 1535 dbSNP
rs1399991340 1547 dbSNP
rs982066634 1547 dbSNP
rs986693785 1559 dbSNP
rs1454664289 1562 dbSNP
rs7023787 1568 dbSNP
rs1386871619 1571 dbSNP
rs1401116791 1574 dbSNP
rs1174929493 1575 dbSNP
rs1431024089 1581 dbSNP
rs1319449790 1588 dbSNP
rs143657194 1598 dbSNP
rs1487949496 1612 dbSNP
rs1260894026 1617 dbSNP
rs1454248189 1629 dbSNP
rs1206779101 1633 dbSNP
rs1486081099 1634 dbSNP
rs1315064136 1635 dbSNP
rs1339421884 1637 dbSNP
rs1255131320 1638 dbSNP
rs1243247668 1640 dbSNP
rs942624958 1641 dbSNP
rs769683994 1647 dbSNP
rs369447809 1649 dbSNP
rs1284061768 1650 dbSNP
rs1218063157 1652 dbSNP
rs1338474022 1653 dbSNP
rs1298404336 1654 dbSNP
rs1043564603 1664 dbSNP
rs71510411 1665 dbSNP
rs761505829 1667 dbSNP
rs1401947236 1670 dbSNP
rs935069355 1671 dbSNP
rs767745382 1675 dbSNP
rs1464279051 1681 dbSNP
rs1407817782 1682 dbSNP
rs1176572547 1690 dbSNP
rs1228115106 1705 dbSNP
rs1420765076 1720 dbSNP
rs1195246637 1727 dbSNP
rs1266661966 1729 dbSNP
rs1429045764 1731 dbSNP
rs909192277 1732 dbSNP
rs1052622235 1736 dbSNP
rs896116090 1740 dbSNP
rs1039062414 1753 dbSNP
rs900680735 1757 dbSNP
rs1198196859 1768 dbSNP
rs373656865 1772 dbSNP
rs1316156910 1773 dbSNP
rs1242596291 1779 dbSNP
rs997635443 1788 dbSNP
rs577307642 1789 dbSNP
rs749126503 1808 dbSNP
rs902750528 1811 dbSNP
rs999221488 1813 dbSNP
rs1032438945 1820 dbSNP
rs750835607 1822 dbSNP
rs1464719224 1824 dbSNP
rs1397584428 1826 dbSNP
rs957697655 1833 dbSNP
rs1365517809 1834 dbSNP
rs544736961 1837 dbSNP
rs1185284220 1838 dbSNP
rs1023388475 1842 dbSNP
rs1158055326 1844 dbSNP
rs1178260044 1845 dbSNP
rs1456605527 1858 dbSNP
rs1275271358 1868 dbSNP
rs73643135 1873 dbSNP
rs906112514 1899 dbSNP
rs1001765426 1902 dbSNP
rs575407083 1903 dbSNP
rs1308987059 1905 dbSNP
rs1445659236 1907 dbSNP
rs1017033751 1919 dbSNP
rs1393839712 1932 dbSNP
rs542869675 1939 dbSNP
rs1401593024 1953 dbSNP
rs1330332055 1965 dbSNP
rs951394476 1968 dbSNP
rs1391498173 1972 dbSNP
rs1389329829 1982 dbSNP
rs909214695 1986 dbSNP
rs984026293 1986 dbSNP
rs963217763 1990 dbSNP
rs532517811 1995 dbSNP
rs7865919 1997 dbSNP
rs922011242 1998 dbSNP
rs955521171 2001 dbSNP
rs540619396 2004 dbSNP
rs1224354040 2006 dbSNP
rs1265284338 2010 dbSNP
rs933519026 2010 dbSNP
rs986790146 2011 dbSNP
rs565176007 2017 dbSNP
rs963936504 2018 dbSNP
rs1285818911 2020 dbSNP
rs56737191 2022 dbSNP
rs1251336388 2023 dbSNP
rs925075353 2027 dbSNP
rs774095861 2029 dbSNP
rs935165186 2037 dbSNP
rs551064607 2040 dbSNP
rs893476648 2045 dbSNP
rs1297394635 2050 dbSNP
rs1011913482 2055 dbSNP
rs1159378285 2057 dbSNP
rs141043531 2057 dbSNP
rs771458926 2057 dbSNP
rs1427359610 2060 dbSNP
rs1201659398 2063 dbSNP
rs1052317500 2078 dbSNP
rs917652350 2092 dbSNP
rs1449113390 2093 dbSNP
rs949192856 2099 dbSNP
rs1376665332 2103 dbSNP
rs72711795 2105 dbSNP
rs904885722 2113 dbSNP
rs879093890 2115 dbSNP
rs1001712927 2126 dbSNP
rs1169076594 2127 dbSNP
rs1038596323 2133 dbSNP
rs1280862403 2135 dbSNP
rs1224775492 2139 dbSNP
rs951213193 2149 dbSNP
rs1428481613 2155 dbSNP
rs189733473 2156 dbSNP
rs1318713410 2161 dbSNP
rs76795451 2165 dbSNP
rs79176276 2166 dbSNP
rs1404143637 2172 dbSNP
rs779193892 2178 dbSNP
rs114523964 2179 dbSNP
rs1405992459 2180 dbSNP
rs974701831 2193 dbSNP
rs1476673735 2196 dbSNP
rs567544854 2198 dbSNP
rs534648222 2200 dbSNP
rs536908497 2217 dbSNP
rs148916537 2224 dbSNP
rs1441523610 2232 dbSNP
rs1260895690 2233 dbSNP
rs964050263 2236 dbSNP
rs1251951190 2237 dbSNP
rs775606464 2239 dbSNP
rs1323640519 2241 dbSNP
rs924111629 2250 dbSNP
rs1212795880 2260 dbSNP
rs935472921 2262 dbSNP
rs796585751 2264 dbSNP
rs1270592306 2269 dbSNP
rs538271324 2272 dbSNP
rs1380247423 2294 dbSNP
rs1338965652 2301 dbSNP
rs894051551 2303 dbSNP
rs979306592 2308 dbSNP
rs181398005 2309 dbSNP
rs1003713256 2310 dbSNP
rs1443188890 2310 dbSNP
rs1025354030 2318 dbSNP
rs886981724 2321 dbSNP
rs1005375334 2332 dbSNP
rs1201790194 2335 dbSNP
rs185231018 2339 dbSNP
rs956684493 2343 dbSNP
rs575006897 2350 dbSNP
rs1191514957 2353 dbSNP
rs1266415506 2354 dbSNP
rs1316889482 2362 dbSNP
rs917782385 2368 dbSNP
rs1376407411 2378 dbSNP
rs949116580 2388 dbSNP
rs1028961367 2395 dbSNP
rs1444493767 2396 dbSNP
rs1044805402 2402 dbSNP
rs926258129 2403 dbSNP
rs1194958091 2405 dbSNP
rs1355136118 2409 dbSNP
rs941701623 2410 dbSNP
rs780800808 2414 dbSNP
rs898733602 2421 dbSNP
rs1423216729 2431 dbSNP
rs73438253 2434 dbSNP
rs1444907880 2436 dbSNP
rs554912497 2455 dbSNP
rs891311478 2456 dbSNP
rs190158550 2459 dbSNP
rs1481338089 2461 dbSNP
rs540606063 2464 dbSNP
rs899959448 2472 dbSNP
rs1000861157 2489 dbSNP
rs1293730357 2491 dbSNP
rs1246395432 2495 dbSNP
rs1032374433 2497 dbSNP
rs1316071897 2504 dbSNP
rs534300990 2505 dbSNP
rs1384127398 2507 dbSNP
rs769547784 2516 dbSNP
rs1374152137 2517 dbSNP
rs1293010031 2519 dbSNP
rs956816904 2520 dbSNP
rs1403698664 2524 dbSNP
rs775490472 2528 dbSNP
rs948299812 2530 dbSNP
rs1419504741 2537 dbSNP
rs988093885 2548 dbSNP
rs1156504686 2551 dbSNP
rs1025199784 2555 dbSNP
rs927617349 2557 dbSNP
rs970542363 2562 dbSNP
rs1361421971 2565 dbSNP
rs1222236459 2578 dbSNP
rs980448006 2585 dbSNP
rs1479437229 2589 dbSNP
rs1264624901 2594 dbSNP
rs1487422639 2598 dbSNP
rs1223065598 2604 dbSNP
rs1485427539 2612 dbSNP
rs565258574 2612 dbSNP
rs1258668756 2618 dbSNP
rs1206497337 2621 dbSNP
rs1047287040 2623 dbSNP
rs1342331969 2634 dbSNP
rs764013600 2636 dbSNP
rs926371214 2638 dbSNP
rs941816751 2640 dbSNP
rs1221798242 2646 dbSNP
rs1005821106 2649 dbSNP
rs114645187 2650 dbSNP
rs544626188 2660 dbSNP
rs768130518 2666 dbSNP
rs1383344678 2670 dbSNP
rs918950682 2673 dbSNP
rs796209470 2678 dbSNP
rs1386567172 2688 dbSNP
rs1424887418 2689 dbSNP
rs562922762 2699 dbSNP
rs1345380971 2706 dbSNP
rs1175209038 2707 dbSNP
rs1467792813 2723 dbSNP
rs1430715503 2725 dbSNP
rs1164774158 2727 dbSNP
rs1348465603 2729 dbSNP
rs930193846 2729 dbSNP
rs899645054 2731 dbSNP
rs530178424 2739 dbSNP
rs891251970 2740 dbSNP
rs549151716 2741 dbSNP
rs996725536 2742 dbSNP
rs1388131209 2757 dbSNP
rs151127288 2759 dbSNP
rs1325766603 2765 dbSNP
rs1039931258 2766 dbSNP
rs1227418587 2776 dbSNP
rs1325180693 2779 dbSNP
rs1298244193 2787 dbSNP
rs899905673 2789 dbSNP
rs761417861 2805 dbSNP
rs1449926777 2810 dbSNP
rs1383695505 2812 dbSNP
rs1176502620 2814 dbSNP
rs1461464355 2815 dbSNP
rs1371236447 2821 dbSNP
rs754391051 2821 dbSNP
rs1228816351 2825 dbSNP
rs1172386318 2830 dbSNP
rs1032734770 2835 dbSNP
rs1182054416 2837 dbSNP
rs1462817596 2841 dbSNP
rs767225659 2842 dbSNP
rs528365540 2844 dbSNP
rs1024894762 2853 dbSNP
rs989944971 2855 dbSNP
rs1253614467 2875 dbSNP
rs970656933 2885 dbSNP
rs1359176373 2918 dbSNP
rs773390602 2920 dbSNP
rs141095952 2921 dbSNP
rs551400605 2927 dbSNP
rs1464113215 2928 dbSNP
rs1334289035 2929 dbSNP
rs1206492966 2935 dbSNP
rs117630423 2957 dbSNP
rs1393620859 2958 dbSNP
rs963078215 2963 dbSNP
rs765735672 2970 dbSNP
rs928195246 2972 dbSNP
rs939042756 2974 dbSNP
rs973192740 2983 dbSNP
rs1181766442 2985 dbSNP
rs918887593 2989 dbSNP
rs1386131763 2993 dbSNP
rs1181294109 2997 dbSNP
rs1436161862 2999 dbSNP
rs1421428752 3008 dbSNP
rs928992634 3010 dbSNP
rs987583546 3012 dbSNP
rs912813435 3023 dbSNP
rs908179328 3025 dbSNP
rs941132389 3026 dbSNP
rs1038048313 3029 dbSNP
rs146828304 3046 dbSNP
rs1447457383 3057 dbSNP
rs1360567716 3068 dbSNP
rs1301195055 3077 dbSNP
rs1376839837 3091 dbSNP
rs1237799020 3099 dbSNP
rs1039877293 3101 dbSNP
rs1308506189 3105 dbSNP
rs1393077025 3111 dbSNP
rs1410410296 3119 dbSNP
rs1050997002 3124 dbSNP
rs1274953637 3125 dbSNP
rs921451677 3127 dbSNP
rs891028653 3133 dbSNP
rs1391105202 3138 dbSNP
rs1158214120 3147 dbSNP
rs1288689916 3149 dbSNP
rs1468790427 3154 dbSNP
rs1365665216 3164 dbSNP
rs936723399 3165 dbSNP
rs1182588567 3168 dbSNP
rs1328295457 3169 dbSNP
rs999157103 3172 dbSNP
rs550164112 3178 dbSNP
rs1225294725 3186 dbSNP
rs568608745 3187 dbSNP
rs1284003542 3188 dbSNP
rs892420628 3195 dbSNP
rs1264667912 3198 dbSNP
rs181918889 3199 dbSNP
rs1208766486 3202 dbSNP
rs1482593233 3206 dbSNP
rs1344274731 3207 dbSNP
rs769087684 3216 dbSNP
rs1009567902 3219 dbSNP
rs1406619537 3222 dbSNP
rs1046865414 3223 dbSNP
rs1331532854 3228 dbSNP
rs1317353451 3229 dbSNP
rs1399224052 3232 dbSNP
rs906445096 3237 dbSNP
rs754733225 3239 dbSNP
rs969579562 3246 dbSNP
rs1002097615 3255 dbSNP
rs1202309890 3255 dbSNP
rs1478636425 3260 dbSNP
rs1241948864 3261 dbSNP
rs1191448932 3265 dbSNP
rs1285944400 3268 dbSNP
rs1449064216 3268 dbSNP
rs1208897589 3281 dbSNP
rs1033448990 3285 dbSNP
rs1322219686 3291 dbSNP
rs963194216 3295 dbSNP
rs766722198 3301 dbSNP
rs1225333592 3310 dbSNP
rs994958605 3310 dbSNP
rs1026062530 3312 dbSNP
rs371245802 3313 dbSNP
rs1428421221 3315 dbSNP
rs1183609738 3319 dbSNP
rs1327928909 3320 dbSNP
rs1321474817 3327 dbSNP
rs1452186257 3331 dbSNP
rs1404076019 3332 dbSNP
rs987143973 3335 dbSNP
rs17694631 3337 dbSNP
rs1419467625 3338 dbSNP
rs983409634 3340 dbSNP
rs1476603729 3345 dbSNP
rs1248957415 3349 dbSNP
rs965596520 3362 dbSNP
rs1460587263 3364 dbSNP
rs1240777078 3366 dbSNP
rs1426078643 3368 dbSNP
rs146767166 3378 dbSNP
rs57508614 3378 dbSNP
rs908207771 3378 dbSNP
rs1212676174 3379 dbSNP
rs1341296382 3381 dbSNP
rs573387846 3383 dbSNP
rs755579579 3393 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.322 1.5e-3 0.282 4.9e-3 83 Click to see details
GSE21687 Ependynoma primary tumors 0.326 4.3e-3 0.355 2.0e-3 64 Click to see details
GSE14794 Lymphoblastoid cells -0.27 5.0e-3 -0.262 6.3e-3 90 Click to see details
GSE19536 Breast cancer 0.253 5.5e-3 0.318 6.3e-4 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.495 1.3e-2 0.562 5.0e-3 20 Click to see details
GSE19783 ER- ER- breast cancer 0.238 1.7e-2 0.300 3.6e-3 79 Click to see details
GSE21849 B cell lymphoma -0.371 2.4e-2 -0.038 4.2e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.464 3.5e-2 -0.379 7.4e-2 16 Click to see details
GSE19350 CNS germ cell tumors 0.531 3.8e-2 0.336 1.4e-1 12 Click to see details
GSE17306 Multiple myeloma 0.211 7.3e-2 0.252 4.0e-2 49 Click to see details
GSE28260 Renal cortex and medulla -0.414 8.0e-2 -0.368 1.1e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.256 1.1e-1 0.286 8.3e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.162 1.9e-1 -0.350 2.5e-2 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.179 2.3e-1 0.236 1.6e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.134 2.6e-1 0.113 3.0e-1 25 Click to see details
GSE38226 Liver fibrosis -0.113 3.1e-1 -0.103 3.3e-1 21 Click to see details
GSE17498 Multiple myeloma -0.069 3.4e-1 -0.028 4.3e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.073 3.7e-1 -0.111 3.0e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.011 4.8e-1 0.064 3.9e-1 23 Click to see details
GSE28544 Breast cancer 0.002 5.0e-1 0.080 3.6e-1 24 Click to see details
GSE28544 Breast cancer 0.002 5.0e-1 0.080 3.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.52 0.01 -0.752 0 18 Click to see details
STAD -0.347 0.03 -0.457 0 32 Click to see details
BRCA -0.212 0.03 -0.192 0.04 84 Click to see details
KICH -0.289 0.08 -0.186 0.19 25 Click to see details
THCA -0.175 0.09 -0.174 0.09 59 Click to see details
LUSC -0.197 0.12 -0.171 0.15 38 Click to see details
CESC 0.906 0.14 1.000 0.5 3 Click to see details
PAAD -0.645 0.18 -0.800 0.1 4 Click to see details
KIRC -0.108 0.19 -0.086 0.24 68 Click to see details
HNSC 0.05 0.38 -0.007 0.48 42 Click to see details
LIHC 0.044 0.38 -0.005 0.49 49 Click to see details
ESCA 0.096 0.39 0.109 0.37 11 Click to see details
PRAD -0.037 0.4 -0.057 0.35 50 Click to see details
KIRP 0.044 0.41 0.151 0.2 32 Click to see details
COAD -0.101 0.41 -0.452 0.13 8 Click to see details
LUAD -0.062 0.42 0.105 0.37 12 Click to see details
CHOL 0.02 0.48 -0.167 0.33 9 Click to see details
UCEC -0.009 0.49 0.082 0.37 19 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*