miRTarBase - #MIRT319331 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CAPZA2   
Synonyms CAPPA2, CAPZ
Description capping actin protein of muscle Z-line alpha subunit 2
Transcript NM_006136   
Expression
Putative miRNA Targets on CAPZA2
3'UTR of CAPZA2
(miRNA target sites are highlighted)
>CAPZA2|NM_006136|3'UTR
   1 GATGAACATTGCATGACCGGATCATTTTAGTGTCTTTGCGTTAAAAAATCATTGCAAAAGTATTCTGAACTGTCAAGCTG
  81 CCCAGTCAGATGGGCTGTTGCCATTTAAAATCACTGTAATTAATTAGTTTGATTAGAGCACAAAGCTTAGCTAATCAACC
 161 ATTATTTTTCATTTTGTTTGTTCTAAGAGGATTGAAAATCAGTTTAGTTTAAATGTCTTTCTGTTAGGCCTTTCTTTCTT
 241 ACAATGAAGAGATGATTCTTCTAGTTTATGGTTAAAAGTTTTTGAAGTGTCTCAAAAATATTTTACTAACTGTAACCCTA
 321 AAATTGATGTCTTTTGGTTTATGAAATCAGTAATTTTTGATATTTCCCCAGTTCTTTTTAATGGGGTCAATAATGGACAT
 401 TCTAGTTTAAGGTGGTTGATGGATTTAGCCATATATGCTGCTAAAGAAATTGTCTACCTTTTCTTCCTCACCTGTTCCAT
 481 TTATGTAAAGTTGAGATTAGAGGGAAAGCATTTTCTATATCAATTGTGTTTAAACCTTTCAAGAAGGTTATTTAGCTAGC
 561 TTAGTGTTGAACTAAATTTTTTTTAAACAAGGCAAGGTCTAATGCTGTTTTGAGATTCTGAAATTAATGAAAATACTTAT
 641 TTCAGAAATGCATTTAATGCTTTTTTTCTTGTGACAGTTACGCAAATCAGCTTGAATTCCATATGTCCCTGAGTTATTTT
 721 TATCATAAAGCCACAAATGTATTATAACAAGGCAAATTGTAATATATATAATCCTGAACTCATGACCATGTCTCGGTTTA
 801 TTTTTTTTTTCTTGGATTGAAAAGTACTGAAATTCAATGTGACATTAAAATGCAAATTTTCCTATTTATTTGAGTAGAAA
 881 ATCACTTACCAGTGAGCATATATATTTTAAAATACTTTCTTTGGATATTGTAATTCTTAACTGGTTGTAAATTAGAAAAG
 961 CTGGGATTACATATGGTGTGCGGTTACAGTCTAAATTTTTTCATCCTCCTATGCATCATAAGCATGTTTGTAATATTTTC
1041 AAAAATAGTTCTACTGATGCTACAGGAATTTCAAGCCTGTGGTGAATGTTAGTATTTACCATAGGGAGTGAAGTGGAGTT
1121 ATGGTTTCATTCAATAGAGTATTGCTGATTATACTTGAGTGGAATCCTTTCCTCACGTACTCCCACAGACGTCTGGGCCT
1201 GGAAATTTTTTTTTTATTTTATTTTATTGTTTTTTTTTTTAGAAAAACACCACTTTTATTATGTACAATAAAATATTTCA
1281 TTAGCTTGAATTGTATAGATTTTTAAAAATTCAATGAAAGCATGTTGTTTAATTTCTTTTTAAAATCACTGTTGGGCTTT
1361 GAAAGCATTGAGAATATAATATGAAATTATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |:||| ||| ||||||| 
Target 5' atttAGCCA-TATATGCTGCTa 3'
423 - 443 165.00 -16.60
2
miRNA  3' guGUUUGGUAAUA---CACGACGAu 5'
            |||: ||  :|    |||||:| 
Target 5' aaCAAGGCAAGGTCTAATGCTGTTt 3'
586 - 610 132.00 -11.60
3
miRNA  3' gugUUUGGUAAUA-CACGACGAu 5'
             |||: :|| |  || |||| 
Target 5' caaAAATAGTTCTACTGATGCTa 3'
1040 - 1062 123.00 -6.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30178216 14 COSMIC
COSN26969174 15 COSMIC
COSN26969175 19 COSMIC
COSN31564287 20 COSMIC
COSN30448923 35 COSMIC
COSN14254258 41 COSMIC
COSN5853650 49 COSMIC
COSN30535668 75 COSMIC
COSN30483910 83 COSMIC
COSN31559772 145 COSMIC
COSN20075874 163 COSMIC
COSN30115440 165 COSMIC
COSN31608305 325 COSMIC
COSN31569752 423 COSMIC
COSN26554039 527 COSMIC
COSN24302296 586 COSMIC
COSN20091672 702 COSMIC
COSN20856466 710 COSMIC
COSN29559494 811 COSMIC
COSN21954430 1063 COSMIC
COSN1341097 1097 COSMIC
COSN21265071 1150 COSMIC
COSN31568749 1216 COSMIC
COSN29591715 1252 COSMIC
COSN31531306 1255 COSMIC
COSN31520985 1280 COSMIC
COSN9823167 1552 COSMIC
COSN25296066 1783 COSMIC
COSN9823168 2076 COSMIC
COSN6346102 2635 COSMIC
COSN6346103 2703 COSMIC
COSN2518308 2786 COSMIC
COSN16978821 2863 COSMIC
COSN16708038 2890 COSMIC
COSN25577270 3151 COSMIC
COSN9823169 3203 COSMIC
COSN7953704 3419 COSMIC
COSN23931070 3709 COSMIC
COSN23938124 3710 COSMIC
COSN25265778 3923 COSMIC
COSN27680004 4033 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765156950 5 dbSNP
rs199663256 6 dbSNP
rs1237604735 7 dbSNP
rs759947881 9 dbSNP
rs370584896 12 dbSNP
rs1399441148 13 dbSNP
rs373748413 18 dbSNP
rs3173936 19 dbSNP
rs200821333 20 dbSNP
rs1205521979 25 dbSNP
rs767161651 32 dbSNP
rs750066287 40 dbSNP
rs755895548 41 dbSNP
rs752748452 43 dbSNP
rs758254911 43 dbSNP
rs1189618191 49 dbSNP
rs1370231196 52 dbSNP
rs920764987 54 dbSNP
rs755824576 55 dbSNP
rs756166240 61 dbSNP
rs1487690127 66 dbSNP
rs749634146 78 dbSNP
rs1039395637 86 dbSNP
rs1187352588 88 dbSNP
rs374858444 94 dbSNP
rs569386278 98 dbSNP
rs1217825605 99 dbSNP
rs999838504 101 dbSNP
rs1801056 110 dbSNP
rs1275637283 116 dbSNP
rs1218194633 117 dbSNP
rs1031356085 133 dbSNP
rs1300039425 143 dbSNP
rs955779398 146 dbSNP
rs1333309254 153 dbSNP
rs775497509 155 dbSNP
rs1426950364 170 dbSNP
rs780149044 173 dbSNP
rs929459787 186 dbSNP
rs1420859066 188 dbSNP
rs1047878858 191 dbSNP
rs150060817 193 dbSNP
rs1801055 197 dbSNP
rs528279761 200 dbSNP
rs1486520045 205 dbSNP
rs1170881882 216 dbSNP
rs1237377615 216 dbSNP
rs1388949764 230 dbSNP
rs1405124452 233 dbSNP
rs1009337167 234 dbSNP
rs79368474 237 dbSNP
rs1433045529 239 dbSNP
rs971338616 242 dbSNP
rs1316231543 244 dbSNP
rs566979467 245 dbSNP
rs1219321394 246 dbSNP
rs996784888 247 dbSNP
rs1283549625 253 dbSNP
rs760529969 256 dbSNP
rs1445681825 262 dbSNP
rs1360690124 270 dbSNP
rs11540710 299 dbSNP
rs1337088091 312 dbSNP
rs1464834966 326 dbSNP
rs1397672565 333 dbSNP
rs11540708 350 dbSNP
rs1172239539 360 dbSNP
rs192068878 361 dbSNP
rs963348837 365 dbSNP
rs1180654557 367 dbSNP
rs1474020821 368 dbSNP
rs1230438430 370 dbSNP
rs776641771 375 dbSNP
rs551153254 377 dbSNP
rs1031411830 378 dbSNP
rs1456662625 380 dbSNP
rs1355455200 384 dbSNP
rs763122630 391 dbSNP
rs1291632067 414 dbSNP
rs1321229514 422 dbSNP
rs183238714 423 dbSNP
rs1226553970 425 dbSNP
rs1381240916 426 dbSNP
rs1315557875 429 dbSNP
rs1444902009 432 dbSNP
rs1187422308 436 dbSNP
rs1374253712 445 dbSNP
rs1248030038 450 dbSNP
rs1450652651 452 dbSNP
rs1462140185 457 dbSNP
rs1348795734 465 dbSNP
rs1191114334 473 dbSNP
rs145428392 478 dbSNP
rs577266926 479 dbSNP
rs1438249971 491 dbSNP
rs915590862 492 dbSNP
rs1367228910 499 dbSNP
rs1178002655 503 dbSNP
rs970092201 504 dbSNP
rs1245117814 505 dbSNP
rs929356628 509 dbSNP
rs973721548 510 dbSNP
rs1393170566 511 dbSNP
rs748810390 514 dbSNP
rs1361559365 516 dbSNP
rs766319231 518 dbSNP
rs929491145 536 dbSNP
rs1047910214 545 dbSNP
rs1239272415 548 dbSNP
rs1319981285 551 dbSNP
rs1389400324 560 dbSNP
rs1437354201 571 dbSNP
rs1310570568 573 dbSNP
rs1311093836 575 dbSNP
rs1391624675 577 dbSNP
rs1366451035 586 dbSNP
rs912041005 589 dbSNP
rs944822488 592 dbSNP
rs1291351853 594 dbSNP
rs1339774598 596 dbSNP
rs1039496066 620 dbSNP
rs911718862 624 dbSNP
rs1418338707 634 dbSNP
rs1382570128 636 dbSNP
rs1160276261 641 dbSNP
rs943203214 650 dbSNP
rs900504707 652 dbSNP
rs1011321250 658 dbSNP
rs1490539471 659 dbSNP
rs1262511385 661 dbSNP
rs188298828 670 dbSNP
rs1215811116 682 dbSNP
rs556304912 683 dbSNP
rs1262328382 686 dbSNP
rs1042987912 695 dbSNP
rs757120037 702 dbSNP
rs1268353392 708 dbSNP
rs1465914123 709 dbSNP
rs1239497011 712 dbSNP
rs1038910967 721 dbSNP
rs1298711007 723 dbSNP
rs904463130 734 dbSNP
rs998666820 745 dbSNP
rs1345600222 750 dbSNP
rs1000098302 759 dbSNP
rs1254743034 764 dbSNP
rs1031482135 769 dbSNP
rs1442294625 779 dbSNP
rs960112495 787 dbSNP
rs1188724301 789 dbSNP
rs1370500175 790 dbSNP
rs1471742868 791 dbSNP
rs1014011165 795 dbSNP
rs1049618 796 dbSNP
rs1178539564 801 dbSNP
rs1357731613 801 dbSNP
rs891504372 801 dbSNP
rs1013953586 802 dbSNP
rs1191578394 805 dbSNP
rs1476838099 809 dbSNP
rs1263724959 811 dbSNP
rs1458924280 812 dbSNP
rs1301145345 815 dbSNP
rs1401440271 816 dbSNP
rs1396467333 817 dbSNP
rs969785665 823 dbSNP
rs1253957749 836 dbSNP
rs973468140 838 dbSNP
rs1323791800 840 dbSNP
rs1277095941 854 dbSNP
rs920873283 859 dbSNP
rs536611448 863 dbSNP
rs541641530 864 dbSNP
rs561916344 865 dbSNP
rs1400518346 873 dbSNP
rs950962767 874 dbSNP
rs1288628168 876 dbSNP
rs755176407 884 dbSNP
rs1230460697 890 dbSNP
rs1470457443 893 dbSNP
rs1002801803 916 dbSNP
rs1168670511 920 dbSNP
rs983675946 931 dbSNP
rs912073623 944 dbSNP
rs944833245 946 dbSNP
rs529214573 957 dbSNP
rs974893536 967 dbSNP
rs1423117117 970 dbSNP
rs922002300 971 dbSNP
rs1185198277 975 dbSNP
rs946767078 977 dbSNP
rs1257008058 988 dbSNP
rs1196316794 994 dbSNP
rs376798528 1005 dbSNP
rs1340908634 1011 dbSNP
rs759717075 1012 dbSNP
rs902496195 1022 dbSNP
rs950728993 1049 dbSNP
rs559966061 1051 dbSNP
rs1421056330 1054 dbSNP
rs1174050070 1055 dbSNP
rs1393293152 1058 dbSNP
rs1052932100 1067 dbSNP
rs556582964 1073 dbSNP
rs1457403229 1077 dbSNP
rs895651826 1082 dbSNP
rs767721345 1088 dbSNP
rs567222311 1103 dbSNP
rs1014496855 1123 dbSNP
rs1445038312 1129 dbSNP
rs139804182 1135 dbSNP
rs1176405763 1144 dbSNP
rs905591137 1154 dbSNP
rs1208723722 1161 dbSNP
rs1277103146 1166 dbSNP
rs73473228 1170 dbSNP
rs1308351069 1175 dbSNP
rs745640308 1177 dbSNP
rs536170916 1178 dbSNP
rs1307455408 1191 dbSNP
rs1300012128 1192 dbSNP
rs112216235 1195 dbSNP
rs1188639116 1197 dbSNP
rs551179009 1206 dbSNP
rs775384305 1206 dbSNP
rs935917669 1206 dbSNP
rs1053002410 1207 dbSNP
rs1379473358 1212 dbSNP
rs550960315 1212 dbSNP
rs983708725 1216 dbSNP
rs1470998025 1217 dbSNP
rs1019206454 1218 dbSNP
rs116900901 1220 dbSNP
rs1449401966 1228 dbSNP
rs1340633999 1229 dbSNP
rs1045462970 1230 dbSNP
rs1223899628 1230 dbSNP
rs1284407843 1230 dbSNP
rs561844821 1231 dbSNP
rs922062135 1233 dbSNP
rs1231280005 1241 dbSNP
rs1347469222 1243 dbSNP
rs1481749094 1248 dbSNP
rs1189753402 1250 dbSNP
rs1033827369 1252 dbSNP
rs1316013714 1253 dbSNP
rs1402213790 1261 dbSNP
rs899368778 1262 dbSNP
rs995079222 1263 dbSNP
rs1479214366 1270 dbSNP
rs1430866441 1280 dbSNP
rs946808590 1286 dbSNP
rs979456890 1292 dbSNP
rs923950429 1296 dbSNP
rs1195554286 1303 dbSNP
rs570579243 1305 dbSNP
rs935294095 1306 dbSNP
rs778329984 1315 dbSNP
rs192613841 1317 dbSNP
rs1053000928 1318 dbSNP
rs895709422 1323 dbSNP
rs987894145 1323 dbSNP
rs1218061660 1328 dbSNP
rs1339817668 1332 dbSNP
rs949938653 1347 dbSNP
rs1268368135 1353 dbSNP
rs1018975828 1361 dbSNP
rs1326809741 1368 dbSNP
rs530272068 1373 dbSNP
rs1168990298 1377 dbSNP
rs1407804642 1389 dbSNP
rs1176583030 1398 dbSNP
rs1044639982 1399 dbSNP
rs1464666301 1400 dbSNP
rs1416717627 1409 dbSNP
rs182600016 1416 dbSNP
rs1475991883 1417 dbSNP
rs965139418 1421 dbSNP
rs974895154 1432 dbSNP
rs1372118572 1438 dbSNP
rs905670259 1447 dbSNP
rs925783171 1456 dbSNP
rs935846208 1473 dbSNP
rs988651824 1481 dbSNP
rs994598587 1487 dbSNP
rs1027369681 1488 dbSNP
rs886146862 1504 dbSNP
rs1388061482 1507 dbSNP
rs1283421768 1508 dbSNP
rs569255743 1512 dbSNP
rs1294708215 1514 dbSNP
rs1363684762 1516 dbSNP
rs539476702 1521 dbSNP
rs1191810464 1526 dbSNP
rs1004542701 1527 dbSNP
rs1445493678 1528 dbSNP
rs1045795500 1551 dbSNP
rs1019220802 1553 dbSNP
rs1413669564 1554 dbSNP
rs1162120326 1555 dbSNP
rs1446846747 1558 dbSNP
rs1244088952 1559 dbSNP
rs966675598 1560 dbSNP
rs1479747951 1562 dbSNP
rs905549414 1563 dbSNP
rs534771612 1565 dbSNP
rs1205270239 1569 dbSNP
rs143193301 1592 dbSNP
rs1290973283 1593 dbSNP
rs1029588439 1599 dbSNP
rs758059077 1605 dbSNP
rs77211639 1610 dbSNP
rs1361331207 1613 dbSNP
rs558735534 1617 dbSNP
rs995005570 1619 dbSNP
rs1488900085 1620 dbSNP
rs1370724500 1627 dbSNP
rs924023922 1628 dbSNP
rs1215664110 1632 dbSNP
rs1442276493 1649 dbSNP
rs752094683 1651 dbSNP
rs1301872559 1652 dbSNP
rs956734868 1658 dbSNP
rs879759073 1660 dbSNP
rs1009176596 1661 dbSNP
rs1019362027 1665 dbSNP
rs1410412757 1667 dbSNP
rs746800134 1673 dbSNP
rs1488214839 1676 dbSNP
rs917901966 1688 dbSNP
rs950022640 1689 dbSNP
rs768529101 1695 dbSNP
rs1044287625 1701 dbSNP
rs1292308900 1708 dbSNP
rs1214774821 1709 dbSNP
rs927124729 1716 dbSNP
rs1314818603 1719 dbSNP
rs776729148 1723 dbSNP
rs1421880745 1725 dbSNP
rs1223958523 1726 dbSNP
rs1048876648 1727 dbSNP
rs546430263 1727 dbSNP
rs886174749 1728 dbSNP
rs1366700261 1729 dbSNP
rs186929871 1733 dbSNP
rs1462656791 1735 dbSNP
rs1298023266 1736 dbSNP
rs1317964367 1738 dbSNP
rs1452107936 1754 dbSNP
rs1347276631 1762 dbSNP
rs570794406 1765 dbSNP
rs553209837 1766 dbSNP
rs1299042857 1770 dbSNP
rs1040459827 1771 dbSNP
rs200507520 1771 dbSNP
rs980134728 1774 dbSNP
rs1226985016 1775 dbSNP
rs1269492875 1777 dbSNP
rs1312402719 1782 dbSNP
rs901477951 1783 dbSNP
rs920373287 1786 dbSNP
rs1235301831 1788 dbSNP
rs748083240 1790 dbSNP
rs1266463499 1793 dbSNP
rs1464556247 1795 dbSNP
rs1209406707 1796 dbSNP
rs769737422 1802 dbSNP
rs996839335 1803 dbSNP
rs1345542652 1809 dbSNP
rs1181102555 1810 dbSNP
rs1414168601 1814 dbSNP
rs1475992154 1815 dbSNP
rs191400153 1824 dbSNP
rs1410727257 1826 dbSNP
rs1457354529 1840 dbSNP
rs1364536783 1841 dbSNP
rs1289800924 1842 dbSNP
rs1319659329 1846 dbSNP
rs968225771 1854 dbSNP
rs185109655 1855 dbSNP
rs1031069414 1856 dbSNP
rs971700377 1859 dbSNP
rs956805433 1860 dbSNP
rs992227707 1869 dbSNP
rs981419401 1870 dbSNP
rs1263657012 1871 dbSNP
rs1186884331 1872 dbSNP
rs1460634592 1874 dbSNP
rs917920894 1875 dbSNP
rs1205127750 1888 dbSNP
rs1323630190 1889 dbSNP
rs1250205716 1891 dbSNP
rs775049826 1892 dbSNP
rs1309773103 1897 dbSNP
rs1356573356 1907 dbSNP
rs937030493 1912 dbSNP
rs1417010039 1913 dbSNP
rs1038086968 1916 dbSNP
rs1328729666 1920 dbSNP
rs1229113670 1923 dbSNP
rs1453572651 1923 dbSNP
rs535230052 1924 dbSNP
rs553591207 1926 dbSNP
rs930490628 1930 dbSNP
rs1171000709 1931 dbSNP
rs1237980695 1935 dbSNP
rs1486551667 1937 dbSNP
rs368950847 1938 dbSNP
rs1250642286 1947 dbSNP
rs1481933221 1948 dbSNP
rs1472689261 1949 dbSNP
rs1159795855 1950 dbSNP
rs907683547 1953 dbSNP
rs940432224 1954 dbSNP
rs1040088459 1955 dbSNP
rs1247065445 1956 dbSNP
rs901507683 1960 dbSNP
rs1417068743 1963 dbSNP
rs1306511581 1967 dbSNP
rs995853615 1967 dbSNP
rs886650256 1981 dbSNP
rs1051150710 1985 dbSNP
rs1397251101 1986 dbSNP
rs1443119050 1989 dbSNP
rs1281364933 1998 dbSNP
rs1222424316 2002 dbSNP
rs1250538229 2002 dbSNP
rs546732285 2002 dbSNP
rs564725308 2002 dbSNP
rs573753357 2002 dbSNP
rs900464714 2002 dbSNP
rs904095941 2002 dbSNP
rs111387458 2005 dbSNP
rs1033029427 2008 dbSNP
rs957437482 2008 dbSNP
rs1350295687 2010 dbSNP
rs1278032952 2013 dbSNP
rs1218687877 2022 dbSNP
rs1010298037 2023 dbSNP
rs1282710197 2025 dbSNP
rs572004666 2027 dbSNP
rs545806561 2032 dbSNP
rs1363599887 2037 dbSNP
rs190211647 2041 dbSNP
rs1279302095 2045 dbSNP
rs1304780139 2046 dbSNP
rs1031142714 2051 dbSNP
rs981731958 2061 dbSNP
rs1156453016 2062 dbSNP
rs1202796773 2064 dbSNP
rs927234914 2068 dbSNP
rs1198062450 2078 dbSNP
rs564422415 2082 dbSNP
rs1479766064 2087 dbSNP
rs1273560707 2088 dbSNP
rs958591708 2088 dbSNP
rs1446789634 2089 dbSNP
rs973746268 2097 dbSNP
rs930364890 2098 dbSNP
rs1207177791 2106 dbSNP
rs575817754 2107 dbSNP
rs1351663153 2108 dbSNP
rs1262629245 2114 dbSNP
rs1221736654 2117 dbSNP
rs956836067 2118 dbSNP
rs1244620776 2129 dbSNP
rs1285153033 2137 dbSNP
rs1437027522 2138 dbSNP
rs1325657409 2144 dbSNP
rs1014091926 2145 dbSNP
rs575921382 2150 dbSNP
rs1388877487 2158 dbSNP
rs1175151921 2160 dbSNP
rs1477433444 2161 dbSNP
rs1191250362 2162 dbSNP
rs1430705707 2164 dbSNP
rs1396239136 2166 dbSNP
rs1025058221 2171 dbSNP
rs969830580 2174 dbSNP
rs1475366511 2175 dbSNP
rs1437083348 2188 dbSNP
rs1195736754 2192 dbSNP
rs543408730 2193 dbSNP
rs1242785184 2201 dbSNP
rs1034290530 2205 dbSNP
rs1370278988 2206 dbSNP
rs1325768762 2212 dbSNP
rs1410867489 2213 dbSNP
rs1219804730 2215 dbSNP
rs982563573 2215 dbSNP
rs1365601726 2220 dbSNP
rs149874182 2220 dbSNP
rs951959724 2220 dbSNP
rs544607912 2225 dbSNP
rs1331174175 2227 dbSNP
rs984675073 2235 dbSNP
rs6952406 2236 dbSNP
rs529041421 2239 dbSNP
rs767735295 2242 dbSNP
rs1170095862 2247 dbSNP
rs1450509019 2248 dbSNP
rs561311657 2249 dbSNP
rs923036775 2250 dbSNP
rs1296762274 2251 dbSNP
rs1238195185 2252 dbSNP
rs1203872114 2255 dbSNP
rs1437216677 2266 dbSNP
rs931665890 2271 dbSNP
rs1054365351 2274 dbSNP
rs36160915 2277 dbSNP
rs761052257 2282 dbSNP
rs533000740 2284 dbSNP
rs903501411 2285 dbSNP
rs936932787 2296 dbSNP
rs530394184 2303 dbSNP
rs892677228 2304 dbSNP
rs906990811 2304 dbSNP
rs1221705513 2307 dbSNP
rs1254263518 2309 dbSNP
rs1352216988 2327 dbSNP
rs983612849 2333 dbSNP
rs1455978276 2334 dbSNP
rs527975604 2337 dbSNP
rs1365412190 2340 dbSNP
rs1162057909 2342 dbSNP
rs1187292785 2345 dbSNP
rs1446718746 2348 dbSNP
rs753129632 2356 dbSNP
rs1390099124 2358 dbSNP
rs1176785202 2361 dbSNP
rs1013748520 2364 dbSNP
rs1234608040 2367 dbSNP
rs1029289442 2369 dbSNP
rs958597791 2370 dbSNP
rs974026173 2374 dbSNP
rs1169957188 2378 dbSNP
rs1222781770 2380 dbSNP
rs1313024665 2380 dbSNP
rs143647896 2380 dbSNP
rs372824572 2380 dbSNP
rs760916105 2380 dbSNP
rs754202694 2382 dbSNP
rs552558124 2397 dbSNP
rs1411051689 2400 dbSNP
rs1345405632 2414 dbSNP
rs1301736577 2424 dbSNP
rs571143718 2427 dbSNP
rs765764727 2436 dbSNP
rs537801773 2437 dbSNP
rs1026999253 2441 dbSNP
rs1399160561 2441 dbSNP
rs952654347 2444 dbSNP
rs976266529 2445 dbSNP
rs550156226 2446 dbSNP
rs1432982308 2448 dbSNP
rs1319858310 2451 dbSNP
rs1472905186 2453 dbSNP
rs1326933968 2458 dbSNP
rs1268117939 2459 dbSNP
rs1229373818 2462 dbSNP
rs922116578 2463 dbSNP
rs1282176625 2464 dbSNP
rs1265748488 2470 dbSNP
rs1355215528 2471 dbSNP
rs1233457848 2475 dbSNP
rs1274650520 2478 dbSNP
rs1228453278 2479 dbSNP
rs1463214189 2482 dbSNP
rs984709148 2483 dbSNP
rs1207526777 2488 dbSNP
rs1014846766 2489 dbSNP
rs1161742910 2490 dbSNP
rs75563509 2496 dbSNP
rs1247973836 2497 dbSNP
rs1368768844 2499 dbSNP
rs962219787 2513 dbSNP
rs1448041785 2516 dbSNP
rs1195786348 2517 dbSNP
rs975927459 2523 dbSNP
rs796486293 2528 dbSNP
rs1054666400 2533 dbSNP
rs1160113350 2545 dbSNP
rs749910677 2552 dbSNP
rs1427205615 2555 dbSNP
rs931765253 2557 dbSNP
rs1174198672 2561 dbSNP
rs1239607930 2561 dbSNP
rs985810153 2569 dbSNP
rs924953120 2575 dbSNP
rs1042170577 2582 dbSNP
rs757911494 2586 dbSNP
rs1185686688 2587 dbSNP
rs146686402 2591 dbSNP
rs1484719545 2592 dbSNP
rs936340816 2594 dbSNP
rs1052672821 2597 dbSNP
rs1322224344 2599 dbSNP
rs1260643387 2602 dbSNP
rs1236155058 2605 dbSNP
rs755665764 2609 dbSNP
rs1367738854 2610 dbSNP
rs1158461444 2611 dbSNP
rs892707107 2615 dbSNP
rs1404070823 2624 dbSNP
rs949608855 2635 dbSNP
rs1338779810 2644 dbSNP
rs535599282 2645 dbSNP
rs1046575557 2652 dbSNP
rs905329129 2654 dbSNP
rs1169600976 2663 dbSNP
rs1378116225 2663 dbSNP
rs779881968 2665 dbSNP
rs1027030473 2670 dbSNP
rs1339716484 2676 dbSNP
rs888487224 2681 dbSNP
rs553529740 2686 dbSNP
rs1004207945 2687 dbSNP
rs1415166391 2690 dbSNP
rs80123532 2696 dbSNP
rs1483262079 2704 dbSNP
rs539642419 2707 dbSNP
rs962006828 2710 dbSNP
rs1227277931 2711 dbSNP
rs1202952554 2727 dbSNP
rs997815649 2730 dbSNP
rs1260733389 2731 dbSNP
rs1298777240 2735 dbSNP
rs1030173190 2738 dbSNP
rs1352049149 2745 dbSNP
rs953295184 2746 dbSNP
rs1396702757 2751 dbSNP
rs1395812949 2772 dbSNP
rs1297543439 2774 dbSNP
rs1460351146 2788 dbSNP
rs985884568 2800 dbSNP
rs951006390 2804 dbSNP
rs1383026143 2814 dbSNP
rs1443680797 2814 dbSNP
rs925028492 2823 dbSNP
rs140295725 2840 dbSNP
rs1423893441 2840 dbSNP
rs1249138796 2846 dbSNP
rs1484319099 2850 dbSNP
rs957730512 2850 dbSNP
rs987750852 2856 dbSNP
rs1019728010 2858 dbSNP
rs746607977 2862 dbSNP
rs1357680784 2868 dbSNP
rs949673532 2875 dbSNP
rs1304945752 2879 dbSNP
rs1407995363 2880 dbSNP
rs1352229464 2886 dbSNP
rs922094474 2887 dbSNP
rs576296200 2899 dbSNP
rs1047050884 2904 dbSNP
rs1388222167 2907 dbSNP
rs868036727 2910 dbSNP
rs953552155 2921 dbSNP
rs926813068 2928 dbSNP
rs1362779915 2937 dbSNP
rs1179011772 2939 dbSNP
rs938158359 2941 dbSNP
rs1471712725 2942 dbSNP
rs1253198188 2944 dbSNP
rs1199278673 2948 dbSNP
rs1048544023 2952 dbSNP
rs1489964408 2964 dbSNP
rs990320950 2965 dbSNP
rs543043028 2968 dbSNP
rs1269845551 2971 dbSNP
rs914844146 2976 dbSNP
rs1350227934 2980 dbSNP
rs1478738672 2982 dbSNP
rs555451296 2990 dbSNP
rs946021928 3012 dbSNP
rs888517903 3014 dbSNP
rs573759088 3015 dbSNP
rs1329885411 3016 dbSNP
rs1037048920 3017 dbSNP
rs1455399942 3017 dbSNP
rs1404198565 3018 dbSNP
rs193166685 3026 dbSNP
rs901136241 3029 dbSNP
rs997445489 3041 dbSNP
rs1387032403 3043 dbSNP
rs559507890 3054 dbSNP
rs560853096 3061 dbSNP
rs928650294 3068 dbSNP
rs953274007 3071 dbSNP
rs938772815 3072 dbSNP
rs1435126493 3080 dbSNP
rs753333061 3086 dbSNP
rs1056291970 3090 dbSNP
rs532566615 3095 dbSNP
rs1248889447 3097 dbSNP
rs1199991229 3099 dbSNP
rs1446732316 3116 dbSNP
rs1259948243 3121 dbSNP
rs1210749029 3126 dbSNP
rs995357769 3127 dbSNP
rs1262574895 3131 dbSNP
rs1342744165 3138 dbSNP
rs1007337435 3145 dbSNP
rs1233737731 3145 dbSNP
rs1048315292 3146 dbSNP
rs1348246051 3147 dbSNP
rs1032076810 3154 dbSNP
rs1388809857 3155 dbSNP
rs1335495133 3159 dbSNP
rs79636475 3161 dbSNP
rs75985187 3162 dbSNP
rs78247092 3163 dbSNP
rs527856791 3169 dbSNP
rs987819607 3175 dbSNP
rs887013535 3192 dbSNP
rs1475292115 3194 dbSNP
rs913575035 3196 dbSNP
rs1190814155 3200 dbSNP
rs970757229 3206 dbSNP
rs1242651233 3209 dbSNP
rs982421852 3217 dbSNP
rs1337081041 3220 dbSNP
rs546377733 3222 dbSNP
rs552749379 3225 dbSNP
rs1254810139 3234 dbSNP
rs143528065 3241 dbSNP
rs910023369 3242 dbSNP
rs781170925 3244 dbSNP
rs1212088924 3245 dbSNP
rs532070364 3248 dbSNP
rs1037484341 3253 dbSNP
rs747969821 3255 dbSNP
rs933980394 3282 dbSNP
rs1313806272 3292 dbSNP
rs1445212104 3294 dbSNP
rs1051716753 3308 dbSNP
rs889014855 3309 dbSNP
rs1007409599 3320 dbSNP
rs1028030391 3321 dbSNP
rs1409879242 3322 dbSNP
rs1482207203 3324 dbSNP
rs953522714 3332 dbSNP
rs1032147068 3334 dbSNP
rs893604706 3335 dbSNP
rs150985243 3343 dbSNP
rs914770493 3348 dbSNP
rs1251511971 3349 dbSNP
rs1473820615 3352 dbSNP
rs1238066713 3366 dbSNP
rs1188239192 3370 dbSNP
rs1482687393 3374 dbSNP
rs1272263997 3375 dbSNP
rs140856609 3379 dbSNP
rs1342555639 3381 dbSNP
rs1290581100 3387 dbSNP
rs202018142 3393 dbSNP
rs1394433840 3395 dbSNP
rs970452832 3396 dbSNP
rs571002696 3404 dbSNP
rs1454607100 3408 dbSNP
rs1175296870 3409 dbSNP
rs1349148982 3414 dbSNP
rs150164947 3419 dbSNP
rs1463854478 3430 dbSNP
rs565839808 3430 dbSNP
rs1428858772 3431 dbSNP
rs1298429486 3432 dbSNP
rs539220236 3434 dbSNP
rs1407282794 3443 dbSNP
rs1384594073 3445 dbSNP
rs1299945208 3447 dbSNP
rs1370920282 3450 dbSNP
rs1235588930 3451 dbSNP
rs778789695 3452 dbSNP
rs959628863 3452 dbSNP
rs1340568425 3455 dbSNP
rs557974910 3457 dbSNP
rs910055956 3458 dbSNP
rs1252158053 3464 dbSNP
rs940168540 3465 dbSNP
rs1481716990 3467 dbSNP
rs1245895509 3468 dbSNP
rs1219010934 3476 dbSNP
rs745751291 3479 dbSNP
rs886982312 3481 dbSNP
rs530568173 3493 dbSNP
rs1326415573 3496 dbSNP
rs865815388 3501 dbSNP
rs185025702 3502 dbSNP
rs1292146934 3508 dbSNP
rs900795857 3509 dbSNP
rs1350666082 3510 dbSNP
rs1388208632 3511 dbSNP
rs1427752119 3513 dbSNP
rs1323561136 3514 dbSNP
rs1424250463 3514 dbSNP
rs1472873279 3514 dbSNP
rs34989681 3514 dbSNP
rs56955030 3514 dbSNP
rs72239655 3514 dbSNP
rs922668015 3515 dbSNP
rs1374470058 3517 dbSNP
rs1489311248 3521 dbSNP
rs1207639171 3526 dbSNP
rs1456003394 3526 dbSNP
rs934034014 3526 dbSNP
rs1463172409 3527 dbSNP
rs779652325 3528 dbSNP
rs1396186376 3529 dbSNP
rs1442458797 3530 dbSNP
rs1328567740 3533 dbSNP
rs957770169 3544 dbSNP
rs1050210159 3545 dbSNP
rs889757773 3548 dbSNP
rs1021745026 3550 dbSNP
rs943295679 3554 dbSNP
rs967958748 3555 dbSNP
rs1391003450 3570 dbSNP
rs1053592032 3574 dbSNP
rs1457749148 3583 dbSNP
rs1309497410 3584 dbSNP
rs1173816530 3585 dbSNP
rs1434691118 3593 dbSNP
rs1425539760 3594 dbSNP
rs1242958532 3620 dbSNP
rs10215574 3630 dbSNP
rs1249394763 3634 dbSNP
rs1208790434 3641 dbSNP
rs773136664 3652 dbSNP
rs1468992650 3657 dbSNP
rs1254798494 3661 dbSNP
rs745965225 3662 dbSNP
rs960039777 3664 dbSNP
rs1020731084 3667 dbSNP
rs906256294 3673 dbSNP
rs138967006 3674 dbSNP
rs915940054 3676 dbSNP
rs1186896861 3678 dbSNP
rs1298545960 3681 dbSNP
rs1263518912 3684 dbSNP
rs1421824721 3688 dbSNP
rs1163845398 3692 dbSNP
rs1033357843 3694 dbSNP
rs958988175 3697 dbSNP
rs573648013 3700 dbSNP
rs1301028752 3709 dbSNP
rs1462607431 3710 dbSNP
rs1359596176 3716 dbSNP
rs1467511921 3716 dbSNP
rs1017190752 3717 dbSNP
rs1167696269 3726 dbSNP
rs143813972 3746 dbSNP
rs1391659730 3754 dbSNP
rs908334838 3756 dbSNP
rs566959822 3759 dbSNP
rs775526854 3760 dbSNP
rs146411855 3762 dbSNP
rs546069056 3764 dbSNP
rs1483844813 3765 dbSNP
rs1274428877 3769 dbSNP
rs1394616258 3770 dbSNP
rs564747103 3775 dbSNP
rs1292955321 3777 dbSNP
rs1335658616 3778 dbSNP
rs1332846517 3780 dbSNP
rs531888903 3789 dbSNP
rs1235247197 3792 dbSNP
rs922772468 3793 dbSNP
rs934083717 3802 dbSNP
rs1266247963 3805 dbSNP
rs1316287348 3807 dbSNP
rs1216487665 3809 dbSNP
rs901098470 3815 dbSNP
rs567465268 3823 dbSNP
rs985526514 3824 dbSNP
rs189920432 3829 dbSNP
rs562059470 3834 dbSNP
rs1049364944 3841 dbSNP
rs1053662795 3842 dbSNP
rs1372109339 3850 dbSNP
rs1186932784 3853 dbSNP
rs893511372 3858 dbSNP
rs1475962209 3877 dbSNP
rs1010579174 3893 dbSNP
rs1251764989 3896 dbSNP
rs529203895 3898 dbSNP
rs1406681584 3909 dbSNP
rs115949766 3910 dbSNP
rs1484248419 3912 dbSNP
rs776923250 3917 dbSNP
rs1209540354 3919 dbSNP
rs1347438502 3930 dbSNP
rs1267356603 3932 dbSNP
rs1245645317 3935 dbSNP
rs565827733 3940 dbSNP
rs906337413 3972 dbSNP
rs533515802 3974 dbSNP
rs1328529328 3987 dbSNP
rs1003707030 3990 dbSNP
rs551267678 4004 dbSNP
rs536261389 4005 dbSNP
rs1226441739 4016 dbSNP
rs999443332 4026 dbSNP
rs1035894238 4030 dbSNP
rs574784393 4040 dbSNP
rs762184416 4043 dbSNP
rs1372780879 4044 dbSNP
rs1294879635 4054 dbSNP
rs1461511016 4055 dbSNP
rs1410507137 4057 dbSNP
rs1157661575 4067 dbSNP
rs1224382697 4071 dbSNP
rs991781544 4071 dbSNP
rs1413212451 4072 dbSNP
rs1286324018 4073 dbSNP
rs1310320312 4075 dbSNP
rs908031913 4076 dbSNP
rs1209932146 4078 dbSNP
rs1280702900 4079 dbSNP
rs1486520493 4082 dbSNP
rs1198572583 4083 dbSNP
rs1022966521 4086 dbSNP
rs1269780737 4091 dbSNP
rs1202665033 4093 dbSNP
rs952696860 4104 dbSNP
rs1470241926 4109 dbSNP
rs536869949 4113 dbSNP
rs116338736 4114 dbSNP
rs1280013801 4122 dbSNP
rs1017223132 4132 dbSNP
rs552964341 4142 dbSNP
rs181278528 4150 dbSNP
rs1453043621 4154 dbSNP
rs1329069816 4158 dbSNP
rs1302972825 4163 dbSNP
rs1441165068 4163 dbSNP
rs567567558 4171 dbSNP
rs535783709 4173 dbSNP
rs994404480 4183 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |:||| ||| ||||||| 
Target 5' auuuAGCCA-UAUAUGCUGCUa 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000361183.3 | 3UTR | AUUUAGCCAUAUAUGCUGCUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.745 2.3e-5 0.783 5.0e-6 23 Click to see details
GSE38226 Liver fibrosis 0.681 3.4e-4 0.512 8.8e-3 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.604 2.4e-3 0.611 2.1e-3 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.525 3.5e-3 0.635 3.2e-4 25 Click to see details
GSE21032 Prostate cancer 0.258 9.3e-3 0.209 2.9e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.621 1.2e-2 -0.621 1.2e-2 13 Click to see details
GSE17306 Multiple myeloma 0.221 6.4e-2 0.236 5.1e-2 49 Click to see details
GSE19536 Breast cancer -0.117 1.2e-1 -0.085 2.0e-1 100 Click to see details
GSE14794 Lymphoblastoid cells 0.1 1.7e-1 0.113 1.4e-1 90 Click to see details
GSE28544 Breast cancer 0.185 1.9e-1 0.551 2.6e-3 24 Click to see details
GSE17498 Multiple myeloma -0.124 2.2e-1 -0.059 3.6e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.235 2.3e-1 0.448 7.2e-2 12 Click to see details
GSE21849 B cell lymphoma 0.135 2.4e-1 0.202 1.5e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.184 2.5e-1 -0.121 3.3e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.125 2.5e-1 0.328 3.3e-2 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.154 2.6e-1 0.235 1.6e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.036 3.8e-1 -0.050 3.3e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.056 4.0e-1 0.132 2.7e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.027 4.5e-1 -0.058 3.9e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.014 4.6e-1 0.079 2.7e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.014 4.6e-1 0.079 2.7e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.423 0 -0.327 0.01 59 Click to see details
BLCA -0.659 0 -0.571 0.01 18 Click to see details
BRCA 0.238 0.01 0.285 0 84 Click to see details
STAD -0.366 0.02 -0.390 0.01 32 Click to see details
PRAD -0.272 0.03 -0.122 0.2 50 Click to see details
KIRC 0.15 0.11 0.123 0.16 68 Click to see details
LUSC -0.193 0.12 -0.153 0.18 38 Click to see details
LIHC -0.166 0.13 -0.144 0.16 49 Click to see details
COAD -0.457 0.13 -0.714 0.02 8 Click to see details
ESCA 0.371 0.13 0.209 0.27 11 Click to see details
PAAD -0.68 0.16 -0.400 0.3 4 Click to see details
LUAD -0.224 0.24 -0.056 0.43 12 Click to see details
UCEC 0.128 0.3 0.161 0.26 19 Click to see details
CHOL -0.142 0.36 0.100 0.4 9 Click to see details
KICH 0.061 0.39 0.096 0.32 25 Click to see details
CESC 0.337 0.39 0.500 0.33 3 Click to see details
PCPG 0.249 0.42 0.500 0.33 3 Click to see details
KIRP -0.026 0.44 -0.163 0.19 32 Click to see details
HNSC 0.015 0.46 -0.009 0.48 42 Click to see details
HNSC 0.015 0.46 -0.009 0.48 42 Click to see details
HNSC 0.015 0.46 -0.009 0.48 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated