miRTarBase - #MIRT302825 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SOCS5   
Synonyms CIS6, CISH6, Cish5, SOCS-5
Description suppressor of cytokine signaling 5
Transcript NM_014011   
Other Transcripts NM_144949   
Expression
Putative miRNA Targets on SOCS5
3'UTR of SOCS5
(miRNA target sites are highlighted)
>SOCS5|NM_014011|3'UTR
   1 ACTCTCCGGTCCCCAAAGGTTGTTAACTAGGTCCGCTTTCATGTGCATCAGACAGTACACCTATAGCAAGCACACGTAGC
  81 AGTGTTAGGCTTTTTCATACAGTATGTAAGCTTAGTGTTAGTATCTGTCAGATGCTACCTGCTGTTACTTATTCAGATAA
 161 ACATGGTGCCTATTGGAACAATAGCGGATAGAGCTACAGGTGTTCAGTAAGACTACAAAAACATTTTGCCTATTTCGCTA
 241 ACAGTTTGGTTTTTAATGGCTGTGGTATTTGAGTGAGGCAACTCTGGGGCATTTGTTATGAAGAATTCTATTTCTTACTG
 321 AAGAACAAATTATTAATATTGGATGAGTATTTCAACAGTGTGACTAATGTTTGAAATTATTTTTTCTAAGAGTTTTTCTA
 401 TAACCTTCCAAAAGTCGTGATGTTTGTAGTTACTATAAATCAAGCTTTGGAAGTCCAAAAAGAATAAAAGACTGCCTTCC
 481 TTTTAGAAAAAAATGCAATTTTCTGGCCACAAGGGCATAGTGCAGTTCACTTACGTGTTGATGTAGTTTATAATCAGACG
 561 CCTTTTCTCTTCTGCAAAAGGTACTGTTAAGTAAACCAGATTTTCTAAATAGGCATTCTTAAAATTTCAGACTTACAAAG
 641 CTAGTAGTAGAATTTTATTGAAAGGCCTAGGTATTAATTTTTTAAATGAGTGCTTTAACTTAAAACAGGCGTTTGGAATA
 721 GCTGCTGCAATGTAGTCTTGTGTGTGATTTTTTTTTAAGTTGATGTGCAGTCTAATTGTTGTTTCATAAAAGTTGGATCT
 801 GTTCCTATGCCCAGGATGATTTTGTGAACCGTGAAGTACGTGAGACTAGAAGACGCCCAAACAAGTCAGATAATAGTAAC
 881 TACAATGGTTGCTGATGTTGAGATTATTGTTGAACTATAATTAATAATTTGGATGGCAGAATTTATCTCTTTTTTGTAAA
 961 CTCTCATAACTGAATTGCTTAAGTATAATTTATAGAATTTCAGTGCAGTTCATTCTTAATGGAAAATCTGAAACCTAAAT
1041 TGCAGATTTAAAAGGTACTGTACAACCATTATATCTGTAAATAACTTAGCACCTTTTTGTCACTTAGAATAATATGTACT
1121 ACTACTTGAGTGAGCGCTTTTGGAAGTTATATCAAGTTCTAGTGTTTGCTTCTTAGTAACTGAACTGAATTTACAGTTCT
1201 GTCCTAGACATTTTGCACTAAAGTAGCCGAATCCACTCTCATGTCTTTTCGTTAATGTGCTCTGTACCACTGGTGAGTGC
1281 TCCATAGTTTCCTTACCTGCTGCTACAGAATGTTATTTTACATCCCTATGGCTATTGCCAAGGCTACAAAAAAGGAAAGC
1361 TATATTTGTATGCAACACTAACCTTTTGACTGCTAATGTATGTTTCTGCTTGCTGTGCCTTGTTATGGCTGCTTTTTTTG
1441 TGCTAATAAAGTATGTTTGGTGTTCTCCTTGTATATCTGCTGTTTTATACATTTGCAACAATTTCTCTTGTAAATGGAAT
1521 GGTTTGGGGTTTTTAAATAAGCATTAACTAACAACCTTTCTATAGTTAATGCAGAGTTAATGAACAGTCTAATATTGACT
1601 TATCAGAATAAGCTAACTCTAAATTTAATGCTCTACATCTTATCAGTCATAATTATATATACTGTGGAACAGTATCTGTA
1681 GTTACTGCAAATTACTGTACAGTTTAGGTTATAACAGAAAACTGACAGAGAAGTAATAAACCTATTGATTTCTCTGCTTA
1761 TAAATGAAAGATTGAAACTATCCAATGACATATTATAGTAAATGAGTATCTGTAACCTCCCACTGCATCAGAAGCAGGTT
1841 AAATGAAGTCTTGTGAATTTGTAATAGATCAGTACCATTTATTGGTTTGGGGACCATCTTAATTAAAAATAAATGCCCAA
1921 AATGTAGAACTTTAACCAAAGACTTGTCCCTTTTAAAGCAAAATGGGGATTGAAGGGACTTATAATTTCTGTTGTTTCTA
2001 ATTAAAGTCCCTGAAGATCATATACCAAAGTGTTTGAGAACTTCATCCAAACCTACTTTAAAGCATTATGTGCAATTAAG
2081 TTGTTATGACATAATTATATTGCCTAATTGTTGGGTCTTTTTTCTTGAGCTTATAATGTACCTGGAAAATAAACCTCTTG
2161 AGAAAAAGAAAAGTTCATACTGATTATTGGAAAAGGACTATATATGTGAGCAAGATTGTGTTTTAGAGAGGAAACTTGAA
2241 ACTCCAAGAAAGCACTTGATGTTTTTATATGCTTGTAGCAAATTGATGTTCTAACTGTAGTTTTATAGAAAGTATTAATG
2321 CTTTTATGTATTTCAAAACTTTCATATGTTAAATGGAAATTGTTTTAAATGTGTTTGAGTTTATGTAAGCATGTATACAC
2401 TGTGCTAAAAGTCACATGTTTCAGTTTGTGTATAATATTAATATGCAATTTTTGGTTTAAATTTTTGTCTTAAAATATTA
2481 GTGGCTTACATTTTAAAAAAGAAAAATCACCAGCATGAACTTGCACCTAAGTCTATATTCACTGTGTCCTTTTCTGAATC
2561 CCATTGTAGCCTGTCAACTAAATTTGAGTGTTAACGGTCTTTTTAAAGTGCATTTAAATACAAACCAGGAATTTCTTTAG
2641 AAGTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :| |||  ||||||| 
Target 5' atagttTCCTTACCTGCTGCTa 3'
1284 - 1305 152.00 -12.40
2
miRNA  3' guguuugguaAUACACGACGAu 5'
                    ||| |||||:| 
Target 5' tctccttgtaTATCTGCTGTTt 3'
1464 - 1485 136.00 -8.90
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:| :: ||  |||||:| 
Target 5' gtCAGA-TGCTACCTGCTGTTa 3'
127 - 147 135.00 -9.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26996322 8 COSMIC
COSN6183377 9 COSMIC
COSN30479615 12 COSMIC
COSN30457817 13 COSMIC
COSN30486216 14 COSMIC
COSN28654562 21 COSMIC
COSN24387604 35 COSMIC
COSN31524305 72 COSMIC
COSN26559401 121 COSMIC
COSN31492256 233 COSMIC
COSN31533021 237 COSMIC
COSN26585171 238 COSMIC
COSN30121162 309 COSMIC
COSN30158461 334 COSMIC
COSN30174773 471 COSMIC
COSN26582036 535 COSMIC
COSN15626342 568 COSMIC
COSN31588521 606 COSMIC
COSN30142662 692 COSMIC
COSN30531143 741 COSMIC
COSN31536632 757 COSMIC
COSN31491793 799 COSMIC
COSN22093002 854 COSMIC
COSN31553254 856 COSMIC
COSN15626343 950 COSMIC
COSN30113228 950 COSMIC
COSN28719130 996 COSMIC
COSN15626344 1102 COSMIC
COSN26578312 1137 COSMIC
COSN30131321 1137 COSMIC
COSN30530289 1157 COSMIC
COSN31529719 1166 COSMIC
COSN15626345 1251 COSMIC
COSN18887772 1292 COSMIC
COSN6183378 1316 COSMIC
COSN26560234 1385 COSMIC
COSN30529845 1402 COSMIC
COSN31513537 1419 COSMIC
COSN23012744 1440 COSMIC
COSN30510644 1487 COSMIC
COSN26958215 1573 COSMIC
COSN20844822 1605 COSMIC
COSN15626346 1627 COSMIC
COSN28201281 1698 COSMIC
COSN31519251 1753 COSMIC
COSN31568948 1753 COSMIC
COSN21365348 1951 COSMIC
COSN26678267 1995 COSMIC
COSN5504771 2046 COSMIC
COSN31567829 2118 COSMIC
COSN20878689 2141 COSMIC
COSN31572199 2161 COSMIC
COSN30113912 2173 COSMIC
COSN31607953 2177 COSMIC
COSN30141858 2323 COSMIC
COSN31516696 2325 COSMIC
COSN10001300 2368 COSMIC
COSN6183379 2371 COSMIC
COSN8609264 2419 COSMIC
COSN9375672 2549 COSMIC
COSN28801318 2590 COSMIC
COSN30159308 2597 COSMIC
COSN24848931 2748 COSMIC
COSN10001301 2824 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1312694016 2 dbSNP
rs1169397191 4 dbSNP
rs1353985826 5 dbSNP
rs371033916 6 dbSNP
rs1421610780 7 dbSNP
rs182123759 8 dbSNP
rs1307356159 9 dbSNP
rs754504759 10 dbSNP
rs1253132173 12 dbSNP
rs778354010 13 dbSNP
rs921459989 14 dbSNP
rs1255612685 18 dbSNP
rs752263009 19 dbSNP
rs368018361 20 dbSNP
rs3768720 21 dbSNP
rs891365866 27 dbSNP
rs1309726841 28 dbSNP
rs777279172 29 dbSNP
rs1228040362 30 dbSNP
rs746892330 31 dbSNP
rs1354677732 32 dbSNP
rs770568483 34 dbSNP
rs745756282 35 dbSNP
rs1465072057 40 dbSNP
rs1171385560 42 dbSNP
rs1376831548 46 dbSNP
rs769820415 48 dbSNP
rs1422706074 51 dbSNP
rs775757336 52 dbSNP
rs1393522614 54 dbSNP
rs1008572343 56 dbSNP
rs41379147 59 dbSNP
rs549776925 60 dbSNP
rs41432848 62 dbSNP
rs1295263556 64 dbSNP
rs1320121637 65 dbSNP
rs568613450 70 dbSNP
rs1027349100 72 dbSNP
rs1445420751 75 dbSNP
rs1379938417 76 dbSNP
rs1176791631 82 dbSNP
rs1481661452 102 dbSNP
rs969218587 105 dbSNP
rs1058153 112 dbSNP
rs1221452027 113 dbSNP
rs547759277 116 dbSNP
rs1207037052 127 dbSNP
rs565987127 133 dbSNP
rs530170062 136 dbSNP
rs1359650453 138 dbSNP
rs1482719305 149 dbSNP
rs1374872363 152 dbSNP
rs185674192 153 dbSNP
rs1348095816 171 dbSNP
rs960866262 171 dbSNP
rs570229445 173 dbSNP
rs547615073 174 dbSNP
rs190148407 176 dbSNP
rs1304676005 182 dbSNP
rs1425079757 189 dbSNP
rs1379845971 200 dbSNP
rs988175512 207 dbSNP
rs558915482 214 dbSNP
rs1163571526 219 dbSNP
rs1421163854 224 dbSNP
rs913873214 226 dbSNP
rs1373304322 230 dbSNP
rs1477302206 231 dbSNP
rs1271713079 232 dbSNP
rs1223615052 233 dbSNP
rs571111726 235 dbSNP
rs1284409460 238 dbSNP
rs1213195607 246 dbSNP
rs1318406543 252 dbSNP
rs1306640264 257 dbSNP
rs565737841 260 dbSNP
rs1343499952 263 dbSNP
rs150799974 264 dbSNP
rs41320947 265 dbSNP
rs1405552651 266 dbSNP
rs1314799724 272 dbSNP
rs1359644173 274 dbSNP
rs867611628 282 dbSNP
rs1051666444 285 dbSNP
rs1455511017 285 dbSNP
rs1346042542 288 dbSNP
rs1175391193 289 dbSNP
rs181482748 290 dbSNP
rs940242924 292 dbSNP
rs1200781919 299 dbSNP
rs1477813819 300 dbSNP
rs1395552018 304 dbSNP
rs1036002367 309 dbSNP
rs897526410 315 dbSNP
rs569527942 318 dbSNP
rs1320790754 327 dbSNP
rs1264521290 328 dbSNP
rs1224017539 334 dbSNP
rs1296475580 335 dbSNP
rs1293125210 343 dbSNP
rs1383726051 351 dbSNP
rs1362855207 365 dbSNP
rs41318648 367 dbSNP
rs1230318062 368 dbSNP
rs1048838306 373 dbSNP
rs904905944 380 dbSNP
rs368723751 391 dbSNP
rs1465538123 396 dbSNP
rs1422150451 399 dbSNP
rs1172913134 403 dbSNP
rs1429483252 412 dbSNP
rs764772689 418 dbSNP
rs1180906274 419 dbSNP
rs1035239729 436 dbSNP
rs1244411174 437 dbSNP
rs896413955 449 dbSNP
rs1317171042 463 dbSNP
rs185579264 468 dbSNP
rs1307856469 475 dbSNP
rs1239157396 479 dbSNP
rs1244685961 484 dbSNP
rs1009515890 487 dbSNP
rs1337429008 487 dbSNP
rs1481955835 487 dbSNP
rs10221923 488 dbSNP
rs1300408923 497 dbSNP
rs968078957 508 dbSNP
rs979418178 514 dbSNP
rs1429995192 517 dbSNP
rs1028420943 522 dbSNP
rs954232483 523 dbSNP
rs756760243 525 dbSNP
rs1442350984 530 dbSNP
rs1386729770 536 dbSNP
rs571025820 544 dbSNP
rs879363838 545 dbSNP
rs1389994106 546 dbSNP
rs200279817 551 dbSNP
rs1176028211 555 dbSNP
rs777631599 560 dbSNP
rs972985557 563 dbSNP
rs1361799496 572 dbSNP
rs1315996631 573 dbSNP
rs1239776178 577 dbSNP
rs1334039914 578 dbSNP
rs1331026713 581 dbSNP
rs1392449560 584 dbSNP
rs1390682477 587 dbSNP
rs145839990 593 dbSNP
rs1447378025 613 dbSNP
rs1289577298 620 dbSNP
rs1366981382 631 dbSNP
rs1364318672 633 dbSNP
rs1469362761 634 dbSNP
rs930347120 637 dbSNP
rs1419564102 650 dbSNP
rs3768719 656 dbSNP
rs1219907184 662 dbSNP
rs543586080 666 dbSNP
rs937727381 667 dbSNP
rs1056201679 668 dbSNP
rs1348856540 669 dbSNP
rs896333391 672 dbSNP
rs1281313573 678 dbSNP
rs564972383 682 dbSNP
rs781455468 687 dbSNP
rs1020916701 691 dbSNP
rs750910861 692 dbSNP
rs903739064 693 dbSNP
rs1346529574 699 dbSNP
rs11682181 700 dbSNP
rs1310439605 702 dbSNP
rs1028718635 710 dbSNP
rs1159748703 711 dbSNP
rs540970611 712 dbSNP
rs1260854942 725 dbSNP
rs1197170218 730 dbSNP
rs1465953108 742 dbSNP
rs1019678881 748 dbSNP
rs201491081 748 dbSNP
rs961886217 763 dbSNP
rs1286625329 764 dbSNP
rs1205720767 771 dbSNP
rs779834849 786 dbSNP
rs559744582 789 dbSNP
rs530133016 793 dbSNP
rs17823065 794 dbSNP
rs931540333 800 dbSNP
rs1423664532 802 dbSNP
rs570144975 806 dbSNP
rs984432431 808 dbSNP
rs1324264206 813 dbSNP
rs780216711 820 dbSNP
rs1319888163 823 dbSNP
rs926308247 827 dbSNP
rs1404688073 836 dbSNP
rs937673164 840 dbSNP
rs1159882550 841 dbSNP
rs1474305480 850 dbSNP
rs1243698568 855 dbSNP
rs1056655995 856 dbSNP
rs896227546 858 dbSNP
rs749266580 863 dbSNP
rs1241322536 876 dbSNP
rs1205685159 879 dbSNP
rs190171457 880 dbSNP
rs1324841490 886 dbSNP
rs1272945009 888 dbSNP
rs1213111907 892 dbSNP
rs945198426 894 dbSNP
rs1320071898 897 dbSNP
rs1271186192 900 dbSNP
rs1227656451 901 dbSNP
rs1381620403 903 dbSNP
rs1334061679 904 dbSNP
rs1454130685 912 dbSNP
rs1406641621 918 dbSNP
rs1395498730 929 dbSNP
rs1328094160 933 dbSNP
rs1441362106 950 dbSNP
rs1408196063 955 dbSNP
rs1421362909 966 dbSNP
rs1042206925 967 dbSNP
rs1444194499 969 dbSNP
rs903791548 979 dbSNP
rs1185436345 980 dbSNP
rs1000755853 981 dbSNP
rs1365381289 986 dbSNP
rs1058157 996 dbSNP
rs889810836 1003 dbSNP
rs1008228744 1004 dbSNP
rs1020152822 1009 dbSNP
rs571007033 1011 dbSNP
rs1307658484 1012 dbSNP
rs1330548968 1014 dbSNP
rs1222240389 1016 dbSNP
rs1206302871 1026 dbSNP
rs1312468763 1028 dbSNP
rs961410202 1035 dbSNP
rs994312465 1041 dbSNP
rs1267093802 1045 dbSNP
rs535280049 1059 dbSNP
rs1027079982 1061 dbSNP
rs572347333 1062 dbSNP
rs1423786994 1068 dbSNP
rs1363876700 1072 dbSNP
rs952866848 1076 dbSNP
rs1445519409 1079 dbSNP
rs1407305214 1082 dbSNP
rs1175583460 1087 dbSNP
rs980782644 1090 dbSNP
rs927565312 1103 dbSNP
rs959332654 1107 dbSNP
rs553402476 1116 dbSNP
rs1294476407 1117 dbSNP
rs1477922709 1122 dbSNP
rs1321993047 1125 dbSNP
rs1178230815 1126 dbSNP
rs1414855877 1130 dbSNP
rs1471612831 1136 dbSNP
rs917662284 1156 dbSNP
rs945085389 1160 dbSNP
rs368305281 1197 dbSNP
rs1425490949 1205 dbSNP
rs1407344514 1208 dbSNP
rs1325249027 1210 dbSNP
rs925137484 1216 dbSNP
rs1156934664 1218 dbSNP
rs1408892248 1220 dbSNP
rs144092501 1221 dbSNP
rs1271458793 1225 dbSNP
rs1050149587 1228 dbSNP
rs41449746 1230 dbSNP
rs1008654971 1237 dbSNP
rs1318198545 1243 dbSNP
rs1268279932 1245 dbSNP
rs1222805003 1246 dbSNP
rs1321360451 1251 dbSNP
rs1284901197 1256 dbSNP
rs1387146331 1258 dbSNP
rs1361451524 1262 dbSNP
rs542711226 1263 dbSNP
rs1352264799 1265 dbSNP
rs1345837868 1273 dbSNP
rs1175848582 1275 dbSNP
rs575720402 1278 dbSNP
rs1226020793 1281 dbSNP
rs181058888 1284 dbSNP
rs1428300348 1285 dbSNP
rs1260171098 1291 dbSNP
rs372239270 1294 dbSNP
rs1184394708 1297 dbSNP
rs1486672465 1298 dbSNP
rs994238976 1304 dbSNP
rs1202506135 1306 dbSNP
rs1459877560 1308 dbSNP
rs774990437 1312 dbSNP
rs769910708 1314 dbSNP
rs1229633464 1329 dbSNP
rs1287327597 1338 dbSNP
rs1451334091 1342 dbSNP
rs1205665674 1346 dbSNP
rs1306689982 1346 dbSNP
rs1027006478 1347 dbSNP
rs1216515700 1348 dbSNP
rs1254588023 1348 dbSNP
rs952920958 1349 dbSNP
rs558671937 1350 dbSNP
rs1035021876 1351 dbSNP
rs1408856885 1355 dbSNP
rs576973670 1356 dbSNP
rs1418718301 1361 dbSNP
rs185091771 1364 dbSNP
rs1173045143 1366 dbSNP
rs1161632952 1371 dbSNP
rs1390415823 1376 dbSNP
rs917561528 1381 dbSNP
rs1442234577 1388 dbSNP
rs1413366612 1397 dbSNP
rs1200941748 1413 dbSNP
rs1480291247 1418 dbSNP
rs1249363903 1423 dbSNP
rs1206390743 1426 dbSNP
rs1343070292 1427 dbSNP
rs1314639351 1432 dbSNP
rs1244147609 1433 dbSNP
rs1321176043 1433 dbSNP
rs966354096 1437 dbSNP
rs1391294652 1439 dbSNP
rs1394992139 1443 dbSNP
rs1404482001 1446 dbSNP
rs41483045 1447 dbSNP
rs1430806742 1465 dbSNP
rs1365416729 1470 dbSNP
rs1162517945 1474 dbSNP
rs1372301422 1477 dbSNP
rs925023269 1496 dbSNP
rs563575419 1505 dbSNP
rs936525169 1507 dbSNP
rs184073268 1511 dbSNP
rs374087214 1520 dbSNP
rs1178657786 1525 dbSNP
rs943939271 1526 dbSNP
rs41418645 1541 dbSNP
rs1220512531 1543 dbSNP
rs1361920028 1544 dbSNP
rs1266070870 1549 dbSNP
rs111672860 1551 dbSNP
rs1238434223 1555 dbSNP
rs1449601272 1556 dbSNP
rs1281997330 1558 dbSNP
rs748657651 1559 dbSNP
rs1411035798 1563 dbSNP
rs1345247593 1572 dbSNP
rs563715351 1573 dbSNP
rs531033768 1576 dbSNP
rs191708882 1577 dbSNP
rs1277276931 1588 dbSNP
rs888497325 1592 dbSNP
rs1002111059 1596 dbSNP
rs1034501571 1607 dbSNP
rs1161270383 1614 dbSNP
rs1267884824 1617 dbSNP
rs1472906815 1617 dbSNP
rs1197054511 1620 dbSNP
rs112267674 1622 dbSNP
rs764745339 1626 dbSNP
rs1268318444 1629 dbSNP
rs1014536554 1637 dbSNP
rs1348609632 1642 dbSNP
rs1262617146 1645 dbSNP
rs1020530762 1649 dbSNP
rs1185519656 1657 dbSNP
rs1323489979 1669 dbSNP
rs1281719293 1676 dbSNP
rs1407162837 1677 dbSNP
rs775081189 1679 dbSNP
rs1381362053 1685 dbSNP
rs1382117478 1700 dbSNP
rs1160799573 1701 dbSNP
rs1457671400 1706 dbSNP
rs1173901007 1716 dbSNP
rs977747622 1716 dbSNP
rs1032103459 1727 dbSNP
rs1378046954 1727 dbSNP
rs1192715609 1732 dbSNP
rs62134767 1734 dbSNP
rs957774124 1736 dbSNP
rs1249933951 1741 dbSNP
rs1209463793 1742 dbSNP
rs1168955246 1743 dbSNP
rs1391740734 1745 dbSNP
rs1261821350 1746 dbSNP
rs985708550 1753 dbSNP
rs1427601825 1758 dbSNP
rs1346136896 1761 dbSNP
rs1167820686 1766 dbSNP
rs1270035253 1767 dbSNP
rs911084813 1771 dbSNP
rs943848404 1781 dbSNP
rs564665156 1783 dbSNP
rs1402827221 1786 dbSNP
rs1404802233 1787 dbSNP
rs1334587484 1791 dbSNP
rs557452740 1792 dbSNP
rs1416149400 1797 dbSNP
rs976675104 1806 dbSNP
rs918495654 1811 dbSNP
rs1474520935 1815 dbSNP
rs528698409 1821 dbSNP
rs929986935 1826 dbSNP
rs1444081632 1830 dbSNP
rs546816851 1832 dbSNP
rs568397480 1839 dbSNP
rs1435415492 1863 dbSNP
rs762304268 1864 dbSNP
rs535785023 1868 dbSNP
rs1212833783 1871 dbSNP
rs1443542175 1877 dbSNP
rs1272697261 1878 dbSNP
rs1299406947 1880 dbSNP
rs547778322 1883 dbSNP
rs1228146462 1884 dbSNP
rs1281592071 1885 dbSNP
rs1336983534 1886 dbSNP
rs888547770 1895 dbSNP
rs879223186 1902 dbSNP
rs1228756054 1908 dbSNP
rs569313529 1915 dbSNP
rs764085673 1920 dbSNP
rs183103594 1923 dbSNP
rs937414428 1925 dbSNP
rs1359693803 1928 dbSNP
rs1056270488 1930 dbSNP
rs1408005627 1933 dbSNP
rs772627005 1938 dbSNP
rs896010102 1939 dbSNP
rs1014835008 1944 dbSNP
rs1424320235 1958 dbSNP
rs1383429547 1968 dbSNP
rs1183705740 1969 dbSNP
rs17771942 1983 dbSNP
rs755097834 1984 dbSNP
rs999195629 1992 dbSNP
rs765058436 2001 dbSNP
rs1031989301 2010 dbSNP
rs1358323371 2011 dbSNP
rs147300018 2014 dbSNP
rs985249903 2018 dbSNP
rs1190698322 2020 dbSNP
rs1379714493 2021 dbSNP
rs1246436643 2035 dbSNP
rs1278881842 2043 dbSNP
rs1447364002 2055 dbSNP
rs1352074543 2056 dbSNP
rs1308453727 2065 dbSNP
rs1404529116 2067 dbSNP
rs1187770892 2071 dbSNP
rs1363973898 2072 dbSNP
rs534497794 2074 dbSNP
rs1018435511 2092 dbSNP
rs1406035908 2095 dbSNP
rs1407419117 2104 dbSNP
rs553240553 2111 dbSNP
rs976519938 2114 dbSNP
rs1170264675 2117 dbSNP
rs72882824 2122 dbSNP
rs1457333584 2124 dbSNP
rs1223401718 2130 dbSNP
rs757097484 2133 dbSNP
rs951276041 2134 dbSNP
rs78047345 2151 dbSNP
rs1434804036 2162 dbSNP
rs984098585 2168 dbSNP
rs909914978 2169 dbSNP
rs937321528 2178 dbSNP
rs1333316273 2182 dbSNP
rs1231651605 2184 dbSNP
rs976938445 2197 dbSNP
rs1274812850 2199 dbSNP
rs1459239202 2202 dbSNP
rs1413359205 2210 dbSNP
rs922859482 2213 dbSNP
rs934991094 2217 dbSNP
rs191805297 2225 dbSNP
rs367894199 2226 dbSNP
rs1479658980 2237 dbSNP
rs917316192 2244 dbSNP
rs1192549481 2245 dbSNP
rs1488626889 2246 dbSNP
rs1052555973 2247 dbSNP
rs914986256 2250 dbSNP
rs41332745 2252 dbSNP
rs1206310601 2255 dbSNP
rs1466156166 2265 dbSNP
rs1041871317 2268 dbSNP
rs41478148 2274 dbSNP
rs1000476668 2290 dbSNP
rs1303183760 2304 dbSNP
rs1219991917 2314 dbSNP
rs1054693789 2320 dbSNP
rs1207845559 2323 dbSNP
rs1437372166 2336 dbSNP
rs1044836767 2339 dbSNP
rs1468747337 2340 dbSNP
rs1361230074 2345 dbSNP
rs1177290789 2347 dbSNP
rs1433361818 2348 dbSNP
rs1418370969 2356 dbSNP
rs904990598 2359 dbSNP
rs187769621 2372 dbSNP
rs1248155675 2376 dbSNP
rs1434708240 2380 dbSNP
rs1482250401 2382 dbSNP
rs1257501990 2383 dbSNP
rs1210566750 2392 dbSNP
rs1307079403 2394 dbSNP
rs543818683 2394 dbSNP
rs1403488932 2399 dbSNP
rs1230975319 2402 dbSNP
rs1365982623 2408 dbSNP
rs965460562 2415 dbSNP
rs774201354 2416 dbSNP
rs1382004186 2420 dbSNP
rs1303717683 2423 dbSNP
rs1461806237 2432 dbSNP
rs546248545 2444 dbSNP
rs1166322244 2449 dbSNP
rs1431307958 2462 dbSNP
rs897758412 2485 dbSNP
rs1025402397 2490 dbSNP
rs1182482927 2496 dbSNP
rs994167794 2499 dbSNP
rs1026099299 2503 dbSNP
rs1160814797 2506 dbSNP
rs1258200434 2520 dbSNP
rs1409302172 2526 dbSNP
rs1480185021 2527 dbSNP
rs1456411332 2531 dbSNP
rs1293777106 2536 dbSNP
rs1343165345 2540 dbSNP
rs951205885 2545 dbSNP
rs984026683 2547 dbSNP
rs1393281142 2553 dbSNP
rs952795508 2554 dbSNP
rs564399154 2560 dbSNP
rs149802888 2565 dbSNP
rs958769187 2567 dbSNP
rs1348998013 2578 dbSNP
rs546780000 2586 dbSNP
rs1018322790 2587 dbSNP
rs1411235119 2589 dbSNP
rs4953419 2590 dbSNP
rs199610690 2591 dbSNP
rs1245732807 2594 dbSNP
rs1041923852 2596 dbSNP
rs529497056 2597 dbSNP
rs1489300674 2601 dbSNP
rs1483465484 2608 dbSNP
rs1207852862 2610 dbSNP
rs1266568301 2627 dbSNP
rs1208342917 2646 dbSNP
rs1489501261 2669 dbSNP
rs1483377976 2674 dbSNP
rs922862438 2675 dbSNP
rs35367575 2686 dbSNP
rs1342125368 2691 dbSNP
rs957208200 2693 dbSNP
rs879001779 2696 dbSNP
rs878873359 2697 dbSNP
rs1248929336 2707 dbSNP
rs987819077 2716 dbSNP
rs1229414428 2722 dbSNP
rs1345342616 2724 dbSNP
rs1322470521 2726 dbSNP
rs550871667 2729 dbSNP
rs1225172148 2733 dbSNP
rs1392231943 2733 dbSNP
rs147266461 2733 dbSNP
rs762635324 2733 dbSNP
rs1409665202 2734 dbSNP
rs914850065 2748 dbSNP
rs1164960516 2754 dbSNP
rs1472786533 2754 dbSNP
rs1376920703 2759 dbSNP
rs748447521 2760 dbSNP
rs889330651 2769 dbSNP
rs751699790 2770 dbSNP
rs1163109522 2773 dbSNP
rs1371679991 2775 dbSNP
rs1463891054 2778 dbSNP
rs375839524 2779 dbSNP
rs1270562249 2784 dbSNP
rs1412279667 2786 dbSNP
rs1323240696 2794 dbSNP
rs1044807220 2796 dbSNP
rs1230551331 2797 dbSNP
rs1306743324 2800 dbSNP
rs926377275 2805 dbSNP
rs1301274578 2806 dbSNP
rs1433727550 2809 dbSNP
rs1385876299 2812 dbSNP
rs939148241 2814 dbSNP
rs1457738826 2822 dbSNP
rs1401203076 2824 dbSNP
rs1396680209 2825 dbSNP
rs1170631832 2835 dbSNP
rs1378443864 2847 dbSNP
rs1188235496 2858 dbSNP
rs1447730627 2861 dbSNP
rs1056728964 2862 dbSNP
rs897733381 2866 dbSNP
rs993861189 2875 dbSNP
rs144718981 2877 dbSNP
rs1189752871 2884 dbSNP
rs1442372842 2886 dbSNP
rs1025330580 2908 dbSNP
rs192690339 2912 dbSNP
rs1362355803 2914 dbSNP
rs1299231511 2922 dbSNP
rs41409850 2931 dbSNP
rs1339814602 2932 dbSNP
rs991526594 2935 dbSNP
rs1415951857 2938 dbSNP
rs1402731396 2940 dbSNP
rs570439052 2941 dbSNP
rs1024700249 2944 dbSNP
rs1428117852 2952 dbSNP
rs534750938 2959 dbSNP
rs1189331295 2963 dbSNP
rs1342754229 2963 dbSNP
rs553203800 2965 dbSNP
rs1207169144 2980 dbSNP
rs1236242588 2982 dbSNP
rs1190287755 2986 dbSNP
rs537901183 2988 dbSNP
rs756563046 2989 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :| |||  ||||||| 
Target 5' ----uuUCCUUACCUGCUGCUa 3'
1 - 18
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000306503.5 | 3UTR | UUUCCUUACCUGCUGCUACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.784 2.2e-5 0.829 3.1e-6 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.706 8.4e-5 0.576 2.0e-3 23 Click to see details
GSE21032 Prostate cancer 0.229 1.9e-2 0.146 9.4e-2 83 Click to see details
GSE19536 Breast cancer -0.161 5.5e-2 -0.181 3.6e-2 100 Click to see details
GSE19350 CNS germ cell tumors 0.456 6.8e-2 0.503 4.8e-2 12 Click to see details
GSE19783 ER- ER- breast cancer -0.161 7.8e-2 -0.213 3.0e-2 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.232 1.4e-1 -0.172 2.1e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.276 1.8e-1 -0.181 2.8e-1 13 Click to see details
GSE21849 B cell lymphoma -0.169 1.9e-1 -0.074 3.5e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.228 2.0e-1 -0.168 2.7e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.155 2.0e-1 0.166 1.8e-1 32 Click to see details
GSE17498 Multiple myeloma 0.137 2.0e-1 0.207 1.0e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.078 2.3e-1 -0.056 3.0e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.151 2.4e-1 0.133 2.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.113 3.0e-1 0.002 5.0e-1 25 Click to see details
GSE17306 Multiple myeloma 0.069 3.2e-1 0.107 2.3e-1 49 Click to see details
GSE28544 Breast cancer 0.076 3.6e-1 0.536 3.5e-3 24 Click to see details
GSE21687 Ependynoma primary tumors 0.038 3.8e-1 0.051 3.4e-1 64 Click to see details
GSE38226 Liver fibrosis -0.037 4.4e-1 0.021 4.6e-1 21 Click to see details
GSE38226 Liver fibrosis -0.037 4.4e-1 0.021 4.6e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0 5.0e-1 0.039 4.4e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.739 0 -0.798 0 32 Click to see details
HNSC -0.484 0 -0.473 0 42 Click to see details
BLCA -0.516 0.01 -0.472 0.02 18 Click to see details
BRCA -0.237 0.01 -0.263 0.01 84 Click to see details
CHOL -0.687 0.02 -0.517 0.08 9 Click to see details
PAAD 0.886 0.06 0.800 0.1 4 Click to see details
KIRC -0.164 0.09 -0.151 0.11 68 Click to see details
PRAD -0.191 0.09 -0.088 0.27 50 Click to see details
THCA -0.159 0.11 -0.150 0.13 59 Click to see details
LIHC 0.159 0.14 0.167 0.13 49 Click to see details
KIRP -0.177 0.17 -0.272 0.07 32 Click to see details
KICH -0.175 0.2 -0.223 0.14 25 Click to see details
COAD -0.158 0.35 -0.619 0.05 8 Click to see details
ESCA 0.115 0.37 0.155 0.32 11 Click to see details
CESC 0.347 0.39 0.500 0.33 3 Click to see details
PCPG -0.327 0.39 -0.500 0.33 3 Click to see details
LUAD -0.072 0.41 -0.168 0.3 12 Click to see details
UCEC 0.036 0.44 -0.098 0.34 19 Click to see details
LUSC -0.012 0.47 -0.044 0.4 38 Click to see details
LUSC -0.012 0.47 -0.044 0.4 38 Click to see details
LUSC -0.012 0.47 -0.044 0.4 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*