miRTarBase - #MIRT302611 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CRIM1   
Synonyms CRIM-1, S52
Description cysteine rich transmembrane BMP regulator 1
Transcript NM_016441   
Expression
Putative miRNA Targets on CRIM1
3'UTR of CRIM1
(miRNA target sites are highlighted)
>CRIM1|NM_016441|3'UTR
   1 AGAAAGGCAACTAGGATGAGGTTTCAAAAGACGGAAGACGACTAAATCTGCTCTAAAAAGTAAACTAGAATTTGTGCACT
  81 TGCTTAGTGGATTGTATTGGATTGTGACTTGATGTACAGCGCTAAGACCTTACTGGGATGGGCTCTGTCTACAGCAATGT
 161 GCAGAACAAGCATTCCCACTTTTCCTCAAGATAACTGACCAAGTGTTTTCTTAGAACCAAAGTTTTTAAAGTTGCTAAGA
 241 TATATTTGCCTGTAAGATAGCTGTAGAGATATTTGGGGTGGGGACAGTGAGTTTGGATGGGGAAATGGGTGGGAGGGTGG
 321 TGTTGGGAAGAAAAATTGGTCAGCTTGGCTCGGGGAGAAACCTGGTAACATAAAAGCAGTTCAGTGGCCCAGAGGTTATT
 401 TTTTTCCTATTGCTCTGAAGACTGCACTGGTTGCTGCAAAGCTCAGGCCTGAATGAGCAGGAAACAAAAAAGGCCTTGCG
 481 ACCCAGCTGCCATAACCACCTTAGAACTACCAGACGAGCACATCAGAACCCTTTGACAGCCATCCCAGGTCTAAAGCCAC
 561 AAGTTTCTTTTCTATACAGTCACAACTGCAGTAGGCAGTGAGGAAGCCAGAGAAATGCGATAGCGGCATTTCTCTAAAGC
 641 GGGTTATTAAGGATATATACAGTTACACTTTTTGCTGCTTTTATTTTCTTCCAAGCCAATCAATCAGCCAGTTCCTAGCA
 721 GAGTCAGCACATGAACAAGATCTAAGTCATTTCTTGATGTGAGCACTGGAGCTTTTTTTTTTTTACAACGTGACAGGAAG
 801 AGGAGGGAGAGGGTGACGAACACCAGGCATTTCCAGGGGCTATATTTCACTGTTTGTTGTTGCTTTGTTCTGTTATATTG
 881 TTGGTTGTTCATAGTTTTTGTTGAAGCTCTAGCTTAAGAAGAAACTTTTTTTAAAAAGACTGTTTGGGGATTCTTTTTCC
 961 TTATTATATACTGATTCTACAAAATAGAAACTACTTCATTTTAATTGTATATTATTCAAGCACCTTTGTTGAAGCTCAAA
1041 AAAAATGATGCCTCTTTAAACTTTAGCAATTATAGGAGTATTTATGTAACTATCTTATGCTTCAAAAAACAAAAGTATTT
1121 GTGTGCATGTGTATATAATATATATATATACATATATATTTATACACATACAATTTATGTTTTCCTGTTGAATGTATTTT
1201 TATGAGATTTTAACCAGAACAAAGGCAGATAAACAGGCATTCCATAGCAGTGCTTTTGATCACTTACAAATTTTTTGAAT
1281 AACACAAAATCTCATTCTACCTGCAGTTTAATTGGAAAGATGTGTGTGTGAGAGTATGTATGTGTGTGTGTGTGTGTGTG
1361 TGTGTGCGCGCGCACGCACGCCTTGAGCAGTCAGCATTGCACCTGCTATGGAGAAGGGTATTCCTTTATTAAAATCTTCC
1441 TCATTTGGATTTGCTTTCAGTTGGTTTTCAATTTGCTCACTGGCCAGAGACATTGATGGCAGTTCTTATCTGCATCACTA
1521 ATCAGCTCCTGGATTTTTTTTTTTTTTTTTTCAAACAATGGTTTGAAACAACTACTGGAATATTGTCCACAATAAGCTGG
1601 AAGTTTGTTGTAGTATGCCTCAAATATAACTGACTGTATACTATAGTGGTAACTTTTCAAACAGCCCTTAGCACTTTTAT
1681 ACTAATTAACCCATTTGTGCATTGAGTTTTCTTTTAAAAATGCTTGTTGTGAAAGACACAGATACCCAGTATGCTTAACG
1761 TGAAAAGAAAATGTGTTCTGTTTTGTAAAGGAACTTTCAAGTATTGTTGTAAATACTTGGACAGAGGTTGCTGAACTTTA
1841 AAAAAAATTAATTTATTATTATAATGACCTAATTTATTAATCTGAAGATTAACCATTTTTTTGTCTTAGAATATCAAAAA
1921 GAAAAAGAAAAAGGTGTTCTAGCTGTTTGCATCAAAGGAAAAAAAGATTTATTATCAAGGGGCAATATTTTTATCTTTTC
2001 CAAAATAAATTTGTTAATGATACATTACAAAAATAGATTGACATCAGCCTGATTAGTATAAATTTTGTTGGTAATTAATC
2081 CATTCCTGGCATAAAAAGTCTTTATCAAAAAAAATTGTAGATGCTTGCTTTTTGTTTTTTCAATCATGGCCATATTATGA
2161 AAATACTAACAGGATATAGGACAAGGTGTAAATTTTTTTATTATTATTTTAAAGATATGATTTATCCTGAGTGCTGTATC
2241 TATTACTCTTTTACTTTGGTTCCTGTTGTGCTCTTGTAAAAGAAAAATATAATTTCCTGAAGAATAAAATAGATATATGG
2321 CACTTGGAGTGCATCATAGTTCTACAGTTTGTTTTTGTTTTCTTCAAAAAAGCTGTAAGAGAATTATCTGCAACTTGATT
2401 CTTGGCAGGAAATAAACATTTTGAGTTGAAATCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG-GUAAUACACGACGAu 5'
            ||: : || | | ||||||| 
Target 5' taCAGTTACACTTTTTGCTGCTt 3'
658 - 680 152.00 -12.30
2
miRNA  3' guguuUGGUAAUAC-ACGACGAu 5'
               ||::|| || ||:|||| 
Target 5' atttcACTGTT-TGTTGTTGCTt 3'
844 - 865 140.00 -9.60
3
miRNA  3' gugUUUG--GUAAUACACGACGau 5'
             |:||  || |:  ||||||  
Target 5' tgaAGACTGCACTGGTTGCTGCaa 3'
416 - 439 133.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31532527 7 COSMIC
COSN30183181 9 COSMIC
COSN31519038 33 COSMIC
COSN26551375 34 COSMIC
COSN30464052 35 COSMIC
COSN30534958 38 COSMIC
COSN30189566 42 COSMIC
COSN30494503 52 COSMIC
COSN507753 69 COSMIC
COSN30493194 73 COSMIC
COSN31582102 104 COSMIC
COSN20096504 210 COSMIC
COSN24742108 212 COSMIC
COSN31480245 267 COSMIC
COSN26564517 312 COSMIC
COSN28647580 428 COSMIC
COSN31557671 452 COSMIC
COSN31567531 505 COSMIC
COSN31489714 516 COSMIC
COSN31595707 638 COSMIC
COSN26634091 712 COSMIC
COSN31607499 754 COSMIC
COSN20096506 785 COSMIC
COSN17076219 802 COSMIC
COSN14515169 815 COSMIC
COSN31534350 850 COSMIC
COSN26561656 895 COSMIC
COSN16240425 933 COSMIC
COSN31608230 954 COSMIC
COSN23856763 978 COSMIC
COSN5791951 1013 COSMIC
COSN31514058 1018 COSMIC
COSN30172457 1038 COSMIC
COSN6180359 1086 COSMIC
COSN31518222 1152 COSMIC
COSN28652132 1189 COSMIC
COSN30165318 1195 COSMIC
COSN30165184 1278 COSMIC
COSN31593322 1364 COSMIC
COSN19657659 1366 COSMIC
COSN20096508 1366 COSMIC
COSN17131994 1368 COSMIC
COSN31532129 1369 COSMIC
COSN31541948 1370 COSMIC
COSN31521443 1377 COSMIC
COSN15860216 1379 COSMIC
COSN31519802 1427 COSMIC
COSN31528264 1504 COSMIC
COSN27595487 1551 COSMIC
COSN20096510 1552 COSMIC
COSN20129326 1623 COSMIC
COSN31523851 1745 COSMIC
COSN23193585 1962 COSMIC
COSN31546548 2086 COSMIC
COSN22289440 2153 COSMIC
COSN31589879 2211 COSMIC
COSN28759859 2230 COSMIC
COSN28757818 2259 COSMIC
COSN31482901 2274 COSMIC
COSN21026084 2283 COSMIC
COSN31566075 2374 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778337585 3 dbSNP
rs751832603 6 dbSNP
rs779025765 7 dbSNP
rs1294344214 13 dbSNP
rs1396121041 15 dbSNP
rs1389889430 16 dbSNP
rs1290646801 17 dbSNP
rs768279576 18 dbSNP
rs1276432468 19 dbSNP
rs756622897 20 dbSNP
rs546070010 22 dbSNP
rs1291936038 26 dbSNP
rs1267654796 27 dbSNP
rs1323006143 30 dbSNP
rs1352602011 33 dbSNP
rs367882463 33 dbSNP
rs768437467 34 dbSNP
rs1057066546 35 dbSNP
rs1206816894 39 dbSNP
rs181652510 40 dbSNP
rs137909490 41 dbSNP
rs373580208 45 dbSNP
rs1415786233 49 dbSNP
rs1048779965 50 dbSNP
rs1157826610 51 dbSNP
rs1441670474 56 dbSNP
rs888843239 60 dbSNP
rs562559638 62 dbSNP
rs1043420795 63 dbSNP
rs1365811030 66 dbSNP
rs1413746682 70 dbSNP
rs903529504 76 dbSNP
rs186000944 78 dbSNP
rs1038939872 79 dbSNP
rs1189347751 80 dbSNP
rs1461753793 81 dbSNP
rs1247305118 88 dbSNP
rs548251637 98 dbSNP
rs1340213333 103 dbSNP
rs998775052 112 dbSNP
rs1269019550 113 dbSNP
rs1032032353 114 dbSNP
rs1217349634 116 dbSNP
rs901795997 117 dbSNP
rs190016134 120 dbSNP
rs1026605875 121 dbSNP
rs763617967 122 dbSNP
rs1432280494 128 dbSNP
rs1390118086 131 dbSNP
rs1318405505 141 dbSNP
rs1404462544 147 dbSNP
rs1411155575 148 dbSNP
rs1004714314 155 dbSNP
rs566460694 158 dbSNP
rs1444972738 159 dbSNP
rs1389503616 160 dbSNP
rs1186528153 172 dbSNP
rs1466310521 174 dbSNP
rs1487334959 175 dbSNP
rs182696126 177 dbSNP
rs1220911937 180 dbSNP
rs1187903008 182 dbSNP
rs962724060 183 dbSNP
rs1292244105 185 dbSNP
rs980741880 186 dbSNP
rs766978014 191 dbSNP
rs961285857 195 dbSNP
rs142231436 196 dbSNP
rs775174810 199 dbSNP
rs1435091713 200 dbSNP
rs1347786100 201 dbSNP
rs11309348 206 dbSNP
rs397872494 206 dbSNP
rs914062718 207 dbSNP
rs920195234 210 dbSNP
rs2075227 211 dbSNP
rs945523965 219 dbSNP
rs1348196364 220 dbSNP
rs1166477904 221 dbSNP
rs1455541695 233 dbSNP
rs570570924 235 dbSNP
rs931584853 239 dbSNP
rs1190725081 243 dbSNP
rs1049856744 245 dbSNP
rs925003904 247 dbSNP
rs1248688575 250 dbSNP
rs1223420200 251 dbSNP
rs1273009929 252 dbSNP
rs943109062 253 dbSNP
rs1308644423 255 dbSNP
rs1385815699 257 dbSNP
rs1038699632 259 dbSNP
rs1301143090 261 dbSNP
rs751952046 265 dbSNP
rs997877735 270 dbSNP
rs1047607951 273 dbSNP
rs538003223 274 dbSNP
rs868181799 275 dbSNP
rs1364805777 279 dbSNP
rs886274940 280 dbSNP
rs1405246905 287 dbSNP
rs1040561038 294 dbSNP
rs1306007646 295 dbSNP
rs1006036200 302 dbSNP
rs556384847 303 dbSNP
rs1052804005 309 dbSNP
rs962818381 310 dbSNP
rs1200220661 317 dbSNP
rs1472417562 320 dbSNP
rs1295467201 324 dbSNP
rs764306471 325 dbSNP
rs568586611 327 dbSNP
rs1314452486 334 dbSNP
rs1264521069 337 dbSNP
rs1223568380 339 dbSNP
rs755372533 341 dbSNP
rs1349535751 344 dbSNP
rs1033711295 346 dbSNP
rs1286026397 347 dbSNP
rs893027978 352 dbSNP
rs1228240138 353 dbSNP
rs960703459 355 dbSNP
rs1311474178 370 dbSNP
rs992821236 377 dbSNP
rs1445808901 383 dbSNP
rs1011505796 389 dbSNP
rs1177299380 391 dbSNP
rs1456742879 396 dbSNP
rs914133096 398 dbSNP
rs1002953206 399 dbSNP
rs559481177 399 dbSNP
rs569920804 400 dbSNP
rs1286231995 402 dbSNP
rs1036215116 403 dbSNP
rs1244256078 404 dbSNP
rs961383180 410 dbSNP
rs1327811361 411 dbSNP
rs754112792 413 dbSNP
rs879174784 415 dbSNP
rs925435924 423 dbSNP
rs943161534 426 dbSNP
rs1045543 428 dbSNP
rs1311807540 431 dbSNP
rs1384951313 436 dbSNP
rs922937716 437 dbSNP
rs1473121606 438 dbSNP
rs952932498 450 dbSNP
rs985713946 462 dbSNP
rs572083841 463 dbSNP
rs944232919 466 dbSNP
rs1425883402 467 dbSNP
rs1386434155 468 dbSNP
rs749541581 469 dbSNP
rs146197830 480 dbSNP
rs756883037 481 dbSNP
rs1160143697 482 dbSNP
rs1037564483 484 dbSNP
rs1206361048 485 dbSNP
rs905684615 493 dbSNP
rs562182757 497 dbSNP
rs1360176088 500 dbSNP
rs1418073150 513 dbSNP
rs1002294759 521 dbSNP
rs1033728009 522 dbSNP
rs765523969 523 dbSNP
rs1315257030 524 dbSNP
rs1361265418 531 dbSNP
rs1315646199 532 dbSNP
rs1227655136 550 dbSNP
rs1301727239 551 dbSNP
rs778435795 552 dbSNP
rs1053165118 553 dbSNP
rs896495701 558 dbSNP
rs1376391447 563 dbSNP
rs1291953404 564 dbSNP
rs1390326990 564 dbSNP
rs1426959725 566 dbSNP
rs1366653904 567 dbSNP
rs1168340752 576 dbSNP
rs1301545563 578 dbSNP
rs1013557774 582 dbSNP
rs1376372934 583 dbSNP
rs1011499098 586 dbSNP
rs373589167 590 dbSNP
rs1266253111 592 dbSNP
rs138572887 596 dbSNP
rs1292299301 600 dbSNP
rs1204145707 612 dbSNP
rs1044369858 613 dbSNP
rs1252958063 618 dbSNP
rs567027662 620 dbSNP
rs979651201 622 dbSNP
rs745379255 624 dbSNP
rs1346366872 625 dbSNP
rs576566383 626 dbSNP
rs544043759 631 dbSNP
rs1282199347 634 dbSNP
rs994272214 641 dbSNP
rs964815292 642 dbSNP
rs1462058392 643 dbSNP
rs758391999 652 dbSNP
rs923023725 653 dbSNP
rs367821035 657 dbSNP
rs1181225652 659 dbSNP
rs1269113376 659 dbSNP
rs1481921393 661 dbSNP
rs985663164 661 dbSNP
rs911498108 662 dbSNP
rs965673465 663 dbSNP
rs149305264 667 dbSNP
rs551480817 669 dbSNP
rs1379752252 673 dbSNP
rs907516342 673 dbSNP
rs934364313 674 dbSNP
rs541925650 675 dbSNP
rs1438139506 678 dbSNP
rs988600115 678 dbSNP
rs914234224 679 dbSNP
rs1426331403 684 dbSNP
rs1400660489 686 dbSNP
rs560213768 689 dbSNP
rs1173681474 692 dbSNP
rs941968082 692 dbSNP
rs1470646995 693 dbSNP
rs1429581667 696 dbSNP
rs1414216633 697 dbSNP
rs947067315 698 dbSNP
rs1044321347 700 dbSNP
rs1182231453 703 dbSNP
rs144279734 704 dbSNP
rs1205677044 709 dbSNP
rs1241156107 709 dbSNP
rs905752504 711 dbSNP
rs3770813 712 dbSNP
rs1353091911 720 dbSNP
rs1280553571 721 dbSNP
rs1244476441 722 dbSNP
rs1339255412 722 dbSNP
rs187048726 727 dbSNP
rs937132720 729 dbSNP
rs531503424 731 dbSNP
rs896990363 733 dbSNP
rs759971509 738 dbSNP
rs1319299136 741 dbSNP
rs896596806 744 dbSNP
rs994650577 744 dbSNP
rs1014068785 745 dbSNP
rs1472316638 746 dbSNP
rs888428778 747 dbSNP
rs1185277713 756 dbSNP
rs1020993027 762 dbSNP
rs902514233 768 dbSNP
rs1444137112 772 dbSNP
rs1247436216 773 dbSNP
rs1285166890 773 dbSNP
rs1317781310 773 dbSNP
rs374212424 773 dbSNP
rs3836073 773 dbSNP
rs397870061 773 dbSNP
rs879040809 773 dbSNP
rs1365074185 774 dbSNP
rs1296284646 776 dbSNP
rs1001080471 778 dbSNP
rs1018241193 782 dbSNP
rs1032517380 784 dbSNP
rs1165230512 785 dbSNP
rs964868501 785 dbSNP
rs1309246828 787 dbSNP
rs1445212959 790 dbSNP
rs1184886216 791 dbSNP
rs977032730 791 dbSNP
rs1031585682 812 dbSNP
rs956930620 813 dbSNP
rs1489919552 814 dbSNP
rs746856880 815 dbSNP
rs1223646428 817 dbSNP
rs112262018 818 dbSNP
rs568143964 819 dbSNP
rs954511812 824 dbSNP
rs1435391040 825 dbSNP
rs1343225774 832 dbSNP
rs1304770336 840 dbSNP
rs1425013297 843 dbSNP
rs983606469 845 dbSNP
rs1420400807 851 dbSNP
rs545597248 851 dbSNP
rs1172054612 854 dbSNP
rs535579425 860 dbSNP
rs1479601900 864 dbSNP
rs1456457842 871 dbSNP
rs547456101 873 dbSNP
rs780203088 874 dbSNP
rs1247471841 876 dbSNP
rs1273162445 877 dbSNP
rs907540376 880 dbSNP
rs1321004409 882 dbSNP
rs929834878 883 dbSNP
rs941635166 885 dbSNP
rs1349575919 886 dbSNP
rs1296236081 891 dbSNP
rs1444362669 891 dbSNP
rs1048233622 893 dbSNP
rs1175491321 898 dbSNP
rs973334501 909 dbSNP
rs1171245717 910 dbSNP
rs565749691 910 dbSNP
rs927173122 914 dbSNP
rs1466602779 916 dbSNP
rs1472385923 916 dbSNP
rs1179301141 919 dbSNP
rs1237368085 925 dbSNP
rs888500525 925 dbSNP
rs937224370 929 dbSNP
rs1006935200 933 dbSNP
rs1264619937 933 dbSNP
rs1398945404 939 dbSNP
rs1018190312 941 dbSNP
rs565441896 941 dbSNP
rs1056994933 945 dbSNP
rs1225219356 946 dbSNP
rs1463567815 951 dbSNP
rs1031282206 954 dbSNP
rs917062333 962 dbSNP
rs1331376933 965 dbSNP
rs1450545945 975 dbSNP
rs1408470882 976 dbSNP
rs1337450490 977 dbSNP
rs1456956492 978 dbSNP
rs1343620435 979 dbSNP
rs1161778795 985 dbSNP
rs949535693 995 dbSNP
rs957075785 1006 dbSNP
rs1435290957 1008 dbSNP
rs1042826553 1013 dbSNP
rs1182213653 1015 dbSNP
rs1272924349 1021 dbSNP
rs539403834 1025 dbSNP
rs11550290 1026 dbSNP
rs989625987 1035 dbSNP
rs531020241 1038 dbSNP
rs1217691871 1041 dbSNP
rs1219187950 1045 dbSNP
rs779890985 1046 dbSNP
rs557866735 1049 dbSNP
rs968423401 1052 dbSNP
rs1384876037 1054 dbSNP
rs748439903 1056 dbSNP
rs770132260 1064 dbSNP
rs1053983512 1069 dbSNP
rs1381682277 1070 dbSNP
rs1185517754 1074 dbSNP
rs1383108994 1074 dbSNP
rs1290798812 1076 dbSNP
rs979851681 1077 dbSNP
rs926950984 1078 dbSNP
rs1215680862 1082 dbSNP
rs900785318 1086 dbSNP
rs1427162582 1087 dbSNP
rs959761219 1088 dbSNP
rs576717381 1090 dbSNP
rs993135363 1090 dbSNP
rs1451311839 1095 dbSNP
rs1197024060 1111 dbSNP
rs1427347858 1116 dbSNP
rs1259239257 1118 dbSNP
rs773479955 1123 dbSNP
rs567465619 1126 dbSNP
rs1187966019 1127 dbSNP
rs1485982038 1132 dbSNP
rs918486542 1132 dbSNP
rs996816478 1135 dbSNP
rs746852394 1137 dbSNP
rs1226806546 1138 dbSNP
rs1345097602 1138 dbSNP
rs1361536699 1138 dbSNP
rs537826144 1138 dbSNP
rs771256199 1138 dbSNP
rs909720553 1138 dbSNP
rs942784123 1138 dbSNP
rs1039825931 1141 dbSNP
rs1030531477 1143 dbSNP
rs1052885004 1148 dbSNP
rs1366749116 1148 dbSNP
rs998222360 1148 dbSNP
rs955039322 1149 dbSNP
rs1267680535 1150 dbSNP
rs1428785474 1150 dbSNP
rs148336318 1150 dbSNP
rs1197044421 1151 dbSNP
rs1164552279 1152 dbSNP
rs1490763794 1152 dbSNP
rs1014654739 1156 dbSNP
rs1404401133 1161 dbSNP
rs1253197059 1164 dbSNP
rs1011171169 1166 dbSNP
rs1323132956 1166 dbSNP
rs754819604 1169 dbSNP
rs1346610058 1170 dbSNP
rs1407150207 1170 dbSNP
rs1328584107 1171 dbSNP
rs1390213529 1172 dbSNP
rs1022432994 1176 dbSNP
rs555956143 1179 dbSNP
rs1174867611 1180 dbSNP
rs1001270892 1185 dbSNP
rs973090759 1188 dbSNP
rs117010940 1189 dbSNP
rs1235050344 1191 dbSNP
rs958684293 1195 dbSNP
rs1173735094 1200 dbSNP
rs1284928906 1201 dbSNP
rs1378052886 1204 dbSNP
rs992476420 1213 dbSNP
rs1355654705 1219 dbSNP
rs1436051637 1232 dbSNP
rs1252529968 1235 dbSNP
rs1196478679 1237 dbSNP
rs1208306839 1238 dbSNP
rs918255037 1242 dbSNP
rs993151813 1246 dbSNP
rs1225642961 1254 dbSNP
rs866790746 1258 dbSNP
rs1324509636 1260 dbSNP
rs1279376787 1262 dbSNP
rs1237281986 1266 dbSNP
rs917092133 1268 dbSNP
rs945835601 1269 dbSNP
rs1446895695 1270 dbSNP
rs1404810820 1278 dbSNP
rs1357091954 1280 dbSNP
rs1470781157 1282 dbSNP
rs1402434317 1286 dbSNP
rs541962650 1286 dbSNP
rs1261460703 1287 dbSNP
rs560250368 1292 dbSNP
rs1042490146 1294 dbSNP
rs1040175018 1299 dbSNP
rs1443914685 1301 dbSNP
rs1188773595 1304 dbSNP
rs1368554605 1305 dbSNP
rs1461960634 1308 dbSNP
rs924002752 1308 dbSNP
rs1472150584 1314 dbSNP
rs572071759 1317 dbSNP
rs922687340 1318 dbSNP
rs1353210572 1320 dbSNP
rs1491147876 1320 dbSNP
rs372424920 1320 dbSNP
rs1245967975 1321 dbSNP
rs1317128059 1321 dbSNP
rs1454083271 1321 dbSNP
rs1491277074 1321 dbSNP
rs551208948 1321 dbSNP
rs561472740 1321 dbSNP
rs934082130 1321 dbSNP
rs997160983 1321 dbSNP
rs1381825920 1323 dbSNP
rs760117364 1325 dbSNP
rs1297419462 1326 dbSNP
rs1044037256 1328 dbSNP
rs1386940192 1328 dbSNP
rs1383255195 1330 dbSNP
rs1423981856 1330 dbSNP
rs905341171 1330 dbSNP
rs1397722565 1331 dbSNP
rs1002350711 1332 dbSNP
rs1035609144 1332 dbSNP
rs1448946430 1332 dbSNP
rs1287255696 1333 dbSNP
rs1334677646 1333 dbSNP
rs1222176934 1334 dbSNP
rs1247552441 1334 dbSNP
rs1294525750 1334 dbSNP
rs1356516807 1334 dbSNP
rs1357969941 1334 dbSNP
rs936738608 1334 dbSNP
rs1053741919 1335 dbSNP
rs1166209852 1337 dbSNP
rs1405882733 1337 dbSNP
rs1418972985 1337 dbSNP
rs1428272097 1337 dbSNP
rs900500447 1337 dbSNP
rs959780695 1337 dbSNP
rs996478753 1338 dbSNP
rs1025260578 1339 dbSNP
rs200946542 1339 dbSNP
rs530094839 1339 dbSNP
rs1175887258 1341 dbSNP
rs1192105548 1341 dbSNP
rs1201836589 1341 dbSNP
rs1231618425 1341 dbSNP
rs1431964066 1341 dbSNP
rs1479570800 1341 dbSNP
rs1480609133 1341 dbSNP
rs190853012 1341 dbSNP
rs768601051 1341 dbSNP
rs879175394 1341 dbSNP
rs1458661240 1342 dbSNP
rs1016830874 1343 dbSNP
rs890645255 1343 dbSNP
rs1339974682 1345 dbSNP
rs1242749515 1346 dbSNP
rs1005439791 1347 dbSNP
rs563915697 1348 dbSNP
rs1401209267 1349 dbSNP
rs1444467399 1349 dbSNP
rs1239688008 1350 dbSNP
rs1284329258 1352 dbSNP
rs1486825205 1353 dbSNP
rs1201554267 1354 dbSNP
rs1256022887 1355 dbSNP
rs753391289 1356 dbSNP
rs1468470999 1357 dbSNP
rs1408520582 1358 dbSNP
rs1418801345 1358 dbSNP
rs1441161775 1358 dbSNP
rs1406427641 1360 dbSNP
rs975244971 1360 dbSNP
rs1182414727 1362 dbSNP
rs1238313592 1362 dbSNP
rs531666321 1362 dbSNP
rs1316047456 1364 dbSNP
rs1470636654 1364 dbSNP
rs549782776 1364 dbSNP
rs1045234 1366 dbSNP
rs1354352241 1366 dbSNP
rs1491181110 1366 dbSNP
rs34148376 1366 dbSNP
rs374839318 1366 dbSNP
rs934053917 1366 dbSNP
rs71396495 1367 dbSNP
rs1381910744 1368 dbSNP
rs529018725 1368 dbSNP
rs11550293 1369 dbSNP
rs946721769 1369 dbSNP
rs1043764161 1370 dbSNP
rs964333724 1370 dbSNP
rs1164826132 1371 dbSNP
rs938268473 1371 dbSNP
rs992766931 1371 dbSNP
rs78894971 1372 dbSNP
rs1220236596 1373 dbSNP
rs879664208 1373 dbSNP
rs3185103 1375 dbSNP
rs925774696 1376 dbSNP
rs1025375108 1377 dbSNP
rs551789233 1380 dbSNP
rs1005152432 1381 dbSNP
rs1301666747 1382 dbSNP
rs1172911464 1385 dbSNP
rs989518034 1394 dbSNP
rs963960063 1397 dbSNP
rs975740668 1400 dbSNP
rs1460993105 1401 dbSNP
rs1421027293 1403 dbSNP
rs1172453092 1405 dbSNP
rs1029497844 1409 dbSNP
rs1464366158 1411 dbSNP
rs921937382 1417 dbSNP
rs1428396600 1419 dbSNP
rs758229990 1424 dbSNP
rs931949112 1435 dbSNP
rs913962945 1438 dbSNP
rs1052042988 1441 dbSNP
rs890728068 1449 dbSNP
rs940940741 1452 dbSNP
rs1199572085 1457 dbSNP
rs1323065190 1471 dbSNP
rs767976190 1472 dbSNP
rs1332192512 1475 dbSNP
rs1306830250 1477 dbSNP
rs899329772 1479 dbSNP
rs1397568084 1486 dbSNP
rs1307289773 1487 dbSNP
rs994592015 1488 dbSNP
rs1034066565 1493 dbSNP
rs894155291 1494 dbSNP
rs1047903909 1498 dbSNP
rs1234472201 1501 dbSNP
rs569929004 1502 dbSNP
rs1023954195 1510 dbSNP
rs1198076152 1511 dbSNP
rs1005266837 1512 dbSNP
rs1437733997 1514 dbSNP
rs967726903 1517 dbSNP
rs1037964658 1520 dbSNP
rs1457779508 1520 dbSNP
rs1261430228 1533 dbSNP
rs899538328 1533 dbSNP
rs10707574 1534 dbSNP
rs1202549252 1534 dbSNP
rs1260487343 1534 dbSNP
rs1331720922 1534 dbSNP
rs1381605941 1534 dbSNP
rs1415820540 1534 dbSNP
rs34414360 1534 dbSNP
rs745929278 1534 dbSNP
rs758100369 1534 dbSNP
rs879018197 1534 dbSNP
rs996770115 1534 dbSNP
rs63410563 1535 dbSNP
rs1417831276 1545 dbSNP
rs1236019187 1550 dbSNP
rs533896399 1550 dbSNP
rs1382041462 1551 dbSNP
rs1491008036 1551 dbSNP
rs1030023955 1552 dbSNP
rs1443190414 1552 dbSNP
rs955334558 1552 dbSNP
rs1261518594 1553 dbSNP
rs199555622 1553 dbSNP
rs1199324983 1554 dbSNP
rs1190421029 1559 dbSNP
rs566602101 1559 dbSNP
rs1422943750 1560 dbSNP
rs1287299962 1566 dbSNP
rs58368969 1567 dbSNP
rs1464542642 1573 dbSNP
rs1281910470 1578 dbSNP
rs1449840360 1580 dbSNP
rs1167419669 1584 dbSNP
rs1009372126 1593 dbSNP
rs977298783 1597 dbSNP
rs1032844134 1600 dbSNP
rs779945094 1607 dbSNP
rs1397844392 1608 dbSNP
rs1362380286 1609 dbSNP
rs1298804804 1611 dbSNP
rs968082280 1612 dbSNP
rs979550730 1615 dbSNP
rs989540216 1624 dbSNP
rs1473264907 1626 dbSNP
rs926636407 1627 dbSNP
rs1191974162 1629 dbSNP
rs959665073 1630 dbSNP
rs921989144 1636 dbSNP
rs932068265 1644 dbSNP
rs555751582 1645 dbSNP
rs1370027526 1646 dbSNP
rs1387505945 1647 dbSNP
rs992404405 1649 dbSNP
rs918140580 1650 dbSNP
rs929588363 1650 dbSNP
rs141956018 1653 dbSNP
rs1269155261 1658 dbSNP
rs1216408851 1659 dbSNP
rs1342206172 1662 dbSNP
rs1278577800 1663 dbSNP
rs987907212 1665 dbSNP
rs1348005941 1667 dbSNP
rs1396051099 1669 dbSNP
rs1405971463 1669 dbSNP
rs752973727 1674 dbSNP
rs1478920148 1683 dbSNP
rs940962530 1685 dbSNP
rs1424851386 1693 dbSNP
rs1199113268 1704 dbSNP
rs1477344982 1704 dbSNP
rs11550291 1713 dbSNP
rs1259237478 1714 dbSNP
rs1451742086 1724 dbSNP
rs146289499 1725 dbSNP
rs1196425203 1726 dbSNP
rs1319517077 1728 dbSNP
rs1218374598 1730 dbSNP
rs145803497 1730 dbSNP
rs572951356 1732 dbSNP
rs1437107266 1736 dbSNP
rs540097681 1736 dbSNP
rs941113747 1742 dbSNP
rs1329375466 1743 dbSNP
rs1249054940 1747 dbSNP
rs1401253838 1760 dbSNP
rs1489261621 1763 dbSNP
rs1413068025 1767 dbSNP
rs1210059610 1772 dbSNP
rs1427691737 1775 dbSNP
rs930770202 1792 dbSNP
rs1266483812 1796 dbSNP
rs1470054511 1796 dbSNP
rs1237071723 1798 dbSNP
rs1038121223 1806 dbSNP
rs879326734 1810 dbSNP
rs996942022 1811 dbSNP
rs1209172795 1818 dbSNP
rs1055570944 1820 dbSNP
rs868810171 1821 dbSNP
rs1352857641 1823 dbSNP
rs1050795107 1827 dbSNP
rs891001920 1829 dbSNP
rs1377947017 1834 dbSNP
rs1424284813 1834 dbSNP
rs1029025668 1837 dbSNP
rs1020795689 1840 dbSNP
rs1177204026 1846 dbSNP
rs1361311336 1846 dbSNP
rs894239229 1846 dbSNP
rs1013990158 1847 dbSNP
rs1378950294 1848 dbSNP
rs1156315398 1849 dbSNP
rs1351620023 1851 dbSNP
rs1440927006 1851 dbSNP
rs1180986815 1852 dbSNP
rs967907329 1864 dbSNP
rs1293141468 1867 dbSNP
rs1389079820 1870 dbSNP
rs1283729941 1872 dbSNP
rs1352930343 1872 dbSNP
rs1402281400 1878 dbSNP
rs1000937557 1880 dbSNP
rs1312062118 1882 dbSNP
rs555438764 1890 dbSNP
rs1381562799 1893 dbSNP
rs1303814193 1894 dbSNP
rs1359190935 1895 dbSNP
rs959504063 1895 dbSNP
rs917933045 1896 dbSNP
rs992541425 1896 dbSNP
rs535176925 1898 dbSNP
rs950929531 1901 dbSNP
rs1415453526 1902 dbSNP
rs1322986083 1904 dbSNP
rs1245131594 1906 dbSNP
rs1264462436 1908 dbSNP
rs1489696989 1912 dbSNP
rs1182250708 1915 dbSNP
rs552271709 1916 dbSNP
rs983709459 1916 dbSNP
rs11550292 1922 dbSNP
rs1218763484 1922 dbSNP
rs909380323 1928 dbSNP
rs998729064 1931 dbSNP
rs1218547243 1934 dbSNP
rs1032854031 1935 dbSNP
rs1481246935 1935 dbSNP
rs1263558298 1937 dbSNP
rs957222391 1940 dbSNP
rs1487923188 1941 dbSNP
rs76299519 1943 dbSNP
rs975242264 1944 dbSNP
rs573812384 1945 dbSNP
rs1191409585 1948 dbSNP
rs942233789 1949 dbSNP
rs1416120027 1954 dbSNP
rs553600058 1954 dbSNP
rs1338986118 1958 dbSNP
rs1280466607 1966 dbSNP
rs1038069329 1967 dbSNP
rs1390597000 1969 dbSNP
rs1292460367 1971 dbSNP
rs1455886899 1978 dbSNP
rs9295 1982 dbSNP
rs1477277263 1986 dbSNP
rs188920782 1989 dbSNP
rs987572156 1991 dbSNP
rs890833290 1994 dbSNP
rs911885101 1996 dbSNP
rs1421695334 2000 dbSNP
rs1195519949 2002 dbSNP
rs1478119885 2011 dbSNP
rs866608672 2014 dbSNP
rs1299197275 2015 dbSNP
rs1266515013 2017 dbSNP
rs962005971 2017 dbSNP
rs1208138449 2018 dbSNP
rs945267653 2018 dbSNP
rs139530200 2021 dbSNP
rs1198309620 2022 dbSNP
rs1316262074 2025 dbSNP
rs1398760027 2029 dbSNP
rs1219583708 2031 dbSNP
rs1299739993 2034 dbSNP
rs920824080 2038 dbSNP
rs1369164528 2039 dbSNP
rs903668964 2043 dbSNP
rs1000676299 2044 dbSNP
rs1397609879 2046 dbSNP
rs115601730 2048 dbSNP
rs895188476 2051 dbSNP
rs537418940 2053 dbSNP
rs1013673941 2059 dbSNP
rs571380945 2064 dbSNP
rs1268197886 2068 dbSNP
rs1178057631 2069 dbSNP
rs1456629288 2071 dbSNP
rs1025393799 2072 dbSNP
rs1240202632 2072 dbSNP
rs1344836103 2073 dbSNP
rs950755555 2078 dbSNP
rs1236117771 2081 dbSNP
rs1313254811 2089 dbSNP
rs1056394851 2093 dbSNP
rs772311915 2099 dbSNP
rs1374204529 2101 dbSNP
rs1445326403 2101 dbSNP
rs1333028769 2105 dbSNP
rs1016495567 2106 dbSNP
rs1170564361 2107 dbSNP
rs916073142 2107 dbSNP
rs963618385 2107 dbSNP
rs543713750 2115 dbSNP
rs949876567 2116 dbSNP
rs975279863 2122 dbSNP
rs1437837662 2126 dbSNP
rs1045444760 2128 dbSNP
rs1240101090 2129 dbSNP
rs1182877656 2131 dbSNP
rs1254544754 2135 dbSNP
rs536859327 2135 dbSNP
rs1181371716 2136 dbSNP
rs902862180 2145 dbSNP
rs1202489161 2151 dbSNP
rs1241285838 2152 dbSNP
rs1285851946 2152 dbSNP
rs561607180 2153 dbSNP
rs1441851284 2154 dbSNP
rs1159462551 2159 dbSNP
rs1350938229 2165 dbSNP
rs1380130546 2168 dbSNP
rs1239373164 2174 dbSNP
rs1054033543 2176 dbSNP
rs1455220091 2177 dbSNP
rs1418220649 2178 dbSNP
rs1331975942 2181 dbSNP
rs193137537 2183 dbSNP
rs567520958 2184 dbSNP
rs1297580414 2185 dbSNP
rs1028615411 2188 dbSNP
rs955196350 2192 dbSNP
rs1159175887 2193 dbSNP
rs1472603065 2193 dbSNP
rs1801605 2193 dbSNP
rs1019001040 2198 dbSNP
rs150137617 2198 dbSNP
rs1379932830 2201 dbSNP
rs1262902696 2204 dbSNP
rs1215144747 2206 dbSNP
rs962056473 2207 dbSNP
rs1489540093 2214 dbSNP
rs3185390 2215 dbSNP
rs1801357 2217 dbSNP
rs972083266 2218 dbSNP
rs1287584245 2224 dbSNP
rs920580121 2228 dbSNP
rs1309496430 2229 dbSNP
rs1355226024 2235 dbSNP
rs1375924047 2236 dbSNP
rs1246534420 2241 dbSNP
rs1355916474 2241 dbSNP
rs1221885379 2243 dbSNP
rs1277312246 2246 dbSNP
rs945048025 2247 dbSNP
rs1362325960 2249 dbSNP
rs1491290891 2249 dbSNP
rs770424835 2250 dbSNP
rs1388661232 2256 dbSNP
rs1042092823 2263 dbSNP
rs149251109 2264 dbSNP
rs1209333328 2265 dbSNP
rs776077135 2265 dbSNP
rs1191907614 2275 dbSNP
rs952306724 2276 dbSNP
rs1261405818 2277 dbSNP
rs991751420 2279 dbSNP
rs1179542252 2282 dbSNP
rs1193282058 2283 dbSNP
rs3185402 2283 dbSNP
rs1450612328 2284 dbSNP
rs1287122530 2287 dbSNP
rs1237836721 2291 dbSNP
rs1468752888 2292 dbSNP
rs538189414 2299 dbSNP
rs1257210035 2307 dbSNP
rs903744084 2308 dbSNP
rs1342294748 2309 dbSNP
rs1270763491 2310 dbSNP
rs916065649 2311 dbSNP
rs1329466940 2316 dbSNP
rs1325571513 2317 dbSNP
rs1462194664 2318 dbSNP
rs1426231014 2320 dbSNP
rs144474788 2322 dbSNP
rs1045514 2323 dbSNP
rs1055327563 2333 dbSNP
rs1420669385 2336 dbSNP
rs1172570069 2337 dbSNP
rs1403325036 2338 dbSNP
rs1466700713 2341 dbSNP
rs751561857 2344 dbSNP
rs573894172 2347 dbSNP
rs1194902149 2349 dbSNP
rs754836788 2351 dbSNP
rs1468651519 2352 dbSNP
rs924389875 2357 dbSNP
rs1014081878 2358 dbSNP
rs1375716101 2363 dbSNP
rs1309098536 2365 dbSNP
rs1025088968 2366 dbSNP
rs1439491071 2372 dbSNP
rs1218615541 2378 dbSNP
rs934400879 2378 dbSNP
rs781105944 2380 dbSNP
rs559109088 2393 dbSNP
rs892803324 2395 dbSNP
rs1016225096 2405 dbSNP
rs1376446234 2407 dbSNP
rs963556656 2409 dbSNP
rs1355534327 2410 dbSNP
rs1449267843 2410 dbSNP
rs1333891183 2416 dbSNP
rs761037188 2418 dbSNP
rs1319862049 2423 dbSNP
rs1199373956 2427 dbSNP
rs1257437342 2432 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 || | | ||||||| 
Target 5' ----uuaCACUUUUUGCUGCUu 3'
1 - 18
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 || | | ||||||| 
Target 5' ----uuaCACUUUUUGCUGCUu 3'
1 - 18
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000280527.2 | 3UTR | UUACACUUUUUGCUGCUUUUAUUUUCUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000280527.2 | 3UTR | UUACACUUUUUGCUGCUUUUAUUUUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000280527.2 | 3UTR | GUUACACUUUUUGCUGCUUUUAUUUUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.542 5.6e-3 -0.634 1.0e-3 21 Click to see details
GSE19783 ER- ER- breast cancer 0.268 8.5e-3 0.233 1.9e-2 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.434 2.8e-2 0.513 1.0e-2 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.409 3.7e-2 -0.371 5.4e-2 20 Click to see details
GSE19536 Breast cancer 0.158 5.8e-2 0.130 9.9e-2 100 Click to see details
GSE27834 Pluripotent stem cells 0.393 6.6e-2 0.359 8.6e-2 16 Click to see details
GSE28260 Renal cortex and medulla -0.334 1.3e-1 -0.269 1.9e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.343 1.4e-1 0.154 3.2e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.217 1.6e-1 0.267 1.1e-1 23 Click to see details
GSE21687 Ependynoma primary tumors 0.123 1.7e-1 0.109 2.0e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.081 2.2e-1 0.231 1.4e-2 90 Click to see details
GSE21032 Prostate cancer 0.079 2.4e-1 0.066 2.8e-1 83 Click to see details
GSE26953 Aortic valvular endothelial cells -0.135 2.6e-1 -0.205 1.7e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.119 2.9e-1 0.010 4.8e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.103 2.9e-1 0.095 3.0e-1 32 Click to see details
GSE17306 Multiple myeloma -0.081 2.9e-1 -0.075 3.0e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.105 3.1e-1 0.089 3.4e-1 25 Click to see details
GSE17498 Multiple myeloma 0.072 3.3e-1 0.112 2.5e-1 40 Click to see details
GSE28544 Breast cancer 0.085 3.5e-1 0.367 3.9e-2 24 Click to see details
GSE21849 B cell lymphoma 0.044 4.1e-1 0.445 7.8e-3 29 Click to see details
GSE21849 B cell lymphoma 0.044 4.1e-1 0.445 7.8e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.78 0 -0.795 0 32 Click to see details
HNSC -0.47 0 -0.504 0 42 Click to see details
KIRP -0.478 0 -0.516 0 32 Click to see details
THCA -0.222 0.05 -0.267 0.02 59 Click to see details
CESC -0.985 0.06 -1.000 0.5 3 Click to see details
UCEC 0.262 0.14 0.170 0.24 19 Click to see details
PAAD 0.71 0.15 0.800 0.1 4 Click to see details
PRAD -0.11 0.22 -0.091 0.26 50 Click to see details
COAD 0.312 0.23 0.286 0.25 8 Click to see details
CHOL -0.286 0.23 -0.400 0.14 9 Click to see details
BRCA 0.059 0.3 0.018 0.44 84 Click to see details
LUAD -0.164 0.31 -0.161 0.31 12 Click to see details
KIRC -0.034 0.39 -0.043 0.36 68 Click to see details
BLCA -0.041 0.44 -0.005 0.49 18 Click to see details
ESCA 0.047 0.45 0.127 0.35 11 Click to see details
PCPG 0.16 0.45 -0.500 0.33 3 Click to see details
LIHC -0.016 0.46 -0.039 0.4 49 Click to see details
LUSC -0.014 0.47 -0.015 0.46 38 Click to see details
KICH -0.015 0.47 0.072 0.37 25 Click to see details
KICH -0.015 0.47 0.072 0.37 25 Click to see details
KICH -0.015 0.47 0.072 0.37 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1