miRTarBase - #MIRT300992 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTMR3   
Synonyms FYVE-DSP1, ZFYVE10
Description myotubularin related protein 3
Transcript NM_021090   
Other Transcripts NM_153050 , NM_153051   
Expression
Putative miRNA Targets on MTMR3
3'UTR of MTMR3
(miRNA target sites are highlighted)
>MTMR3|NM_021090|3'UTR
   1 AGCTCAGTGACCTGGGTGGGCAGTGGCCAAGCTGCTGTTCCTATGACAGGCCCACTCAACCTGGGCAGACCGAGAGGCCC
  81 GTGCACTTTGGAATGGGAGCGTGGAACCACCTGTACAGAGTGACAGATTTGGGATGCACCACTGGATTGTAGATTGATTT
 161 TTCTTTCCTGTCCCCCTACTCCCTCCCTACCTTTTCCATCCTCCTCCTCTGCCTTCAAAAAAGGAAACTTTCCCTTGGTT
 241 GTCTTAATTTTTTTTTTTTTTGATGGAAGACCAAGGGTTGCCAGGCCCACTGTAACTGCCGAGCTGCCTGCTGTCACGTG
 321 ACACTGAGGGATGGCTTGTTTCTTCCGGGTGGGAGGATGGTGGTCAGAGCCAGGAGTATGGAGATCTGAGACCGTGAGCA
 401 GGGAAGAAAGCCAGTGCTAACATGCAACCATTCCTCACGCCACCGCCACATCAGAGCTGGTTGGGAACCCTTTGCTGCTG
 481 GGGAGGCTGGAAGCATATTCCCCAAGAGCACTGCCCTGGGCATCATCTCCCTCCTGCGAGGAGCTGAGCCAGTCCCCTCA
 561 CAGATGGATAAATGAGGCTGATGTTTGGAGGGAGAGGCACACGGTAAATGGCATCCCCTTAGGCGCCTCTTTGGGAAAGG
 641 AAAGTGGATGCTCCTTTGAGGCAGGCGAGGGGCTGGGAGTGGGTAGCCGTCATGTTGTCCCCCGTGGGATCCCATTTTTA
 721 ACTTGACCCAGATTGTCTTGGGCTCCTTTTACTTTCAGGGGGCTGCTTTCCTGGGCCAGGCTGTGTAGCACTTCCCACCC
 801 TCAGGCATGAGTACAGACTGGTCAAAATGTTTATGCAGTCAAGGCCAAAGCCTGCCCTGAGCCCAGACACACCTGGGTCC
 881 CCATTCTGGGGCCTGGTCCCCTAAACAATCTCTTCCTCAGCCAGCACAGGGAAATCCAGACTCAGGGTTCCAGAAATCCC
 961 CCGTTCCCAAACCAAACCAATCATGGATCTTCCCTTTAAGGGGTAGAATCAGCCTTTAGAGTTACAAGCCCCTGGAAAAG
1041 GGAGCAGGTCCCATACAATCAGCCTTTCTCCTCTTCTCTTCTTGGGACAGGAATAACTGCTGAGCAGTCCCCCTTTGCCA
1121 CTCCTGGCTGTCTGAGTGGGCACTTGTCTGGCTGCTGGCCAGCAGTGAAGGGCCACTTGGTGACTTCGTAGGGTTCCTTA
1201 GAGAAGTGACATGGCCTTGAGGAGATTCAGGGCACCTTTCCTCAGTGAGCTTTGATATGGTCCAAAAACAGCCTTAAATC
1281 AAGAATATTTGTGGAGGTAGGTGTGGGGAAGGTTGGAGAAGAGTTAGGTTTGTGCTTTGTAATCTTGGCATCCATGTTTT
1361 GTGCCTGCCCTCCCTCTTGGGGAGGCCATGCTTGACTCTGCTGAAAGCTGCTAACTGGTGACAGGGTGGATCATGGTGAG
1441 GACTAGGGGTAAGGTCAGGGAATGCTTAAGCTCTGGCCCTGCCCTGTATTCCTCTTCCCCTTGGTAGCAGTTCCCTGACC
1521 AAGGGCAAGGTGTGTCTCAGGAAGGTGGTTCTGTGCATGCCTGGGTGTGGTTAAGGCGTGGCCCAGAAGGCTTCCCTGGT
1601 GCTCTCAGTCCAGGCAAAGCCCAGAGCATCTGAGCACGTCTCTGACTTCCAGTGGCAACACAGTTTGAACGTGGTGAAAC
1681 AGGGTGTAGTTCTTTTCCACATTCTGTGTCATCTAGTCGTGCAGGTAGGGAAAAAGTTGGTCTAATTGAAGATTGTGCAT
1761 TTCCTAGTGACAGGTGCCAAGAGGTTATGATACGGGTTTCTTGGGTCTGATGTACAGTGTGAATAAATGCTTGCAGCTCT
1841 TAGCTCTTTTTTGATCGATGAAGCACTTTTTTATTAATATTTTCCTTTGTTAAAGGAGGAACCGTAACTCTCCATAGCTG
1921 TACATATAACCCTTTTCTCCTAAAGAGGAGTCAGTCAGTGCTCCTATATTTTTCATTTTTTGTCAAAGCAAGAAGTAAAT
2001 ACTTTAGAATTGTTAAATATATAAATAAAGCAAATAAAGTTGAGTGTTCCACATGGTAGCATTTGCTAACACTTCCTAAT
2081 TCTTTGCCCTGTGGTTTATCCCCTCTTCGTCCCTTTTCCCTCTCACACAGAAGTGTTTGAGGGCCTGCTGGGAAACTGAC
2161 CTTTGGCAAAGGAAAGCTACAGATAGCCTTCCGACTCTAGACCTTGGCAAGGAGCCTCACCATGATGTTCAAGCACTGAA
2241 CGCATTTCCTCAGTGATTTTGCTCCTAAAATCTCCCAGGCTAAAAGAGGGCAAAGCAGTCAGGGATCTGACCTGGCAGCT
2321 ATTCCTCCTTCTCTGAAGAGTTCCCATCAGTAGTCATTACAACTACCTCTCGCCTCAAGGCTCCATTTTTAGCTGCTGCT
2401 CTGATTTCAGGGCAGCCAGTACTCTGGCCCCTTCAGTCGGGGAGTGGAAGGAGATGTGGGGTGGGGGTGAGAAAATGCTT
2481 CTGCCTGTTGTTCTTGAAGGATAGACTATGGGTGGGCAGAGAGAACTGGGGGCAGAAATGGAATTAGATGTGATTGGGTT
2561 ATGCAGTCAACTAGAGGTCTCCTTCCCGCCCTCTCTCCACACAGAGAGGAACCTCTGCTCCTTAGCTCTTACAGCAGGAC
2641 TGTGGCATCTAGTCACTTCAATACTAGTTCTTGCTCTTCACAGAGGTAGATTTTTCTTTACCCTACAGCACTGTTGGGCA
2721 TCCCTCCCATCACATGGGTCTGTGGGTGAGATATGTTATGCTGTTCCTCCCTCGGGAAGGTTGGTATTGAGGGGTGCCTT
2801 GCTCCAGAGGCGCCAGCCCAGCATCTGTGGTGAGTTGGCTAAGATCCAGAGTGACCTGCTCAGAGCTCCCCAGAGGCCTT
2881 CACTCTTTGGGGCAGTCTCTCTAGGGTCACTTTCTGAATGTACCTTCTACCTAAAGTATACAAACACAAAGAGCCAGCTG
2961 AGCTGGTTCTAGTGTGAAAGCCGTAAGTGCCACCCAGCAGGCGTTTGAAAACAAGAAATCATTCTTCTGTGGAAGGAGAA
3041 TGTGCCATCTCAGCTACCCTCAGTCCGCCAGGCAGCCCAGTCTGTGTATTCATATGAAGTTGTGAAAACCATGAGTGTGT
3121 GCCATGGCCATCGTGTCTACACACAGCCACTATTGTTCCTGTGGGCTAGTCTCCAGCAAATTAAAACACTGGCATGGCCT
3201 AGGAAGGGCGTTGCGAGCTCCTAAATGGAAAGCTTCTCTGGGGGTAGGGAGATGAAGAGCCAAGATGCTGGTGAAGCAGG
3281 TGCAGTGAGGATCCAAGGCAAGGAATTGCCCTGAGGGAGGTGGCTGCATATGGAGAAAGGCAGTTCTCTGTGGGCAAGGC
3361 CAGCTTGCTTCAGGCTGTAGAGGGAATTTGGTCTGAAGCAACAGGGCATGAACTGTGACTTTGAGCTGCCAGGTTGTCTT
3441 CATCTCAGAACTTTCCTATCCTGGCACTCTCGTTACCTTTCTTCTATACCTTGGCCTCTGTAACTGCAGTCCAAAACAAG
3521 TTACAGCTGCCTTAATCCACTGAGATTCTCTATGAGGATGTACAGAAAAGTTTTCCTGTAATAATTTTGCTTATATGCTA
3601 ACTCTTTTCATGTTAGCAAAGAATATTCTATGAATTAGAATGTTACTGTGGTAGATCTAAAGGAGAATGAACAGAAGGTG
3681 CTGGAGGACCTGTTAAACAATCTCTGGCTATTAAAAAACATCAAGATGAGAATTAAAGGCATATCCTGATATACTTGCCT
3761 GCTTGCACATGAGGCTGGGAGATCCCATGCCTGTTGAAGTTAACTCTAGCCCTGACCTCTATTGATCTTTTGGGAATGAG
3841 GGCTGATTTGAAGGTGCTGTTGCAGGATTTCATTTAGCTGCTGCCAGTTCAAGTGACCTGTCCCCAGGGCTGCAGCTGTA
3921 TCCACCTGATTGCAGTAGGTGAGGGCTAACAGCAGAATTTAAAGTGGACCCTGGGCTGTGGAGCAAAGTGACTATCCATT
4001 TGGACTTTTGGATAATGTGGCAGGAGTCCCAGCTGTTTAATTTCTAGTCACATTTTCCAGAAAGTTGTTCTAAGTTGAGA
4081 TTACTGACAAGATTTCTCAAGGGCAGGACCAGATATGTGAGAGACTTCTAGTTCAGAGCTGACCCCTCTAAGCCTCTGAC
4161 ACTTAAACACGAGTCCTGCTGTCCCCAGCACACAACTGCACTGAAGCCTTGTTCCTCTCGGCTGGTGTAGAGCTCATCTG
4241 CATGTTGTGTGCAGATACCAGTAGCCTCCCTGCTTGAACAGGCCTCTCCTAGGCTAGGCAGGTGTTCAGAGGCATGAAGG
4321 TCTGGGCAGGGGAAGGGCGTCTTCTGAAATGGGAGTTACCAGGTTTTTAAATGCTGCTATTGTTTTATTTACCATTTAAG
4401 GTCTTTTCTATTATATCTGAGTAACTAGTCAGTTTTTCTTACAGTGCTCATAGCAGTTGTATTTGAATTGTATTTTCAGT
4481 GAAATTTGTTTTACATTGCCATTTAAAATTGGCCTTTAACAGCTTCCCAACTAGCTTATAAGATTTTTTTTTTTAATGAA
4561 AACATAACCCATGAGGCTCAGATGCTGTTGAAGAAATAAATGGTATGTTGCTGCTGACAGTAGTGCTTGCCTATTGTAAC
4641 AGCATTGGTTCTGCTGTAGCCTCGGTGACCATTTAAGTTGAATAAATCTGTCATTTTCACCCACAAACAGTTGTTGAGCC
4721 CCTGGATTTGGGTTGTCACTGTGGTTCTCCTGCCAGTGCTATAATCCAGTGTCGTAGGTGCAGGGTATGAATCAGCTCAG
4801 CCTCTTAGGAGAGAGGGGCTCTCAGCGAGGAGGGGGCGGGGGGGGGGTCACTATTTATCTTCCAGAGGCAGGGTTCATGG
4881 ATTCCTGATGTTTAGAGGCGGAAGGGACCTTAGGTCACCTACTTCCACGGTTTTCATACTGTTCTCTGGGGCCTCGTGGA
4961 GAGGGAGCCTCCAGGCCCATTCAAAGCTTTATTAGATTTAAAAGTAAGATCTGGTATGAAGAAAGGTTTTGTTTGTTTCT
5041 TAAAATAAAAAGTCTGAAAATCACTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:::: |||  ||||||| 
Target 5' acCAGGTTTTTAAATGCTGCTa 3'
4358 - 4379 160.00 -15.00
2
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            :||| :: |||| ||||||| 
Target 5' aaTAAA-TGGTATGTTGCTGCTg 3'
4595 - 4616 159.00 -16.00
3
miRNA  3' guGUUU---GGUAAUA--C-ACGACGAu 5'
            |||:   ||||| |  | ||||||| 
Target 5' ctCAAGGCTCCATTTTTAGCTGCTGCTc 3'
2374 - 2401 158.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30149009 41 COSMIC
COSN15783555 77 COSMIC
COSN13909455 102 COSMIC
COSN13909457 105 COSMIC
COSN30503394 144 COSMIC
COSN30158061 201 COSMIC
COSN1260673 262 COSMIC
COSN27486553 262 COSMIC
COSN28793448 318 COSMIC
COSN8997261 538 COSMIC
COSN17075892 577 COSMIC
COSN10029400 671 COSMIC
COSN26664795 878 COSMIC
COSN31531793 963 COSMIC
COSN31582862 1188 COSMIC
COSN26637318 1194 COSMIC
COSN28457157 1273 COSMIC
COSN1897052 1389 COSMIC
COSN31486306 1392 COSMIC
COSN31597367 1578 COSMIC
COSN31484796 1607 COSMIC
COSN30542259 1645 COSMIC
COSN28663199 1671 COSMIC
COSN26481993 1813 COSMIC
COSN15585972 2396 COSMIC
COSN32170803 2684 COSMIC
COSN19187273 2844 COSMIC
COSN22505731 3290 COSMIC
COSN5990807 3388 COSMIC
COSN22766222 3501 COSMIC
COSN22269746 3555 COSMIC
COSN25654035 3592 COSMIC
COSN21785622 3699 COSMIC
COSN21805719 3835 COSMIC
COSN20117348 4542 COSMIC
COSN28943688 4555 COSMIC
COSN16857671 4619 COSMIC
COSN1260674 4832 COSMIC
COSN27286832 4848 COSMIC
COSN27337813 4848 COSMIC
COSN29063703 4848 COSMIC
COSN27431013 4849 COSMIC
rs12537 1671 GWAS
rs41174 4280 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs754355752 6 dbSNP
rs772641960 11 dbSNP
rs764278708 13 dbSNP
rs751653620 14 dbSNP
rs1272646136 15 dbSNP
rs1465504603 16 dbSNP
rs1210895397 18 dbSNP
rs757883073 27 dbSNP
rs113609747 29 dbSNP
rs1432276049 32 dbSNP
rs1446835160 36 dbSNP
rs781531718 38 dbSNP
rs528603691 41 dbSNP
rs200478028 44 dbSNP
rs1313703414 56 dbSNP
rs568468616 61 dbSNP
rs746220322 64 dbSNP
rs769504497 71 dbSNP
rs535898774 72 dbSNP
rs1178813467 73 dbSNP
rs1470214012 78 dbSNP
rs900803896 81 dbSNP
rs115041927 82 dbSNP
rs112814851 90 dbSNP
rs951278547 101 dbSNP
rs768076956 102 dbSNP
rs1000014903 103 dbSNP
rs1310741370 135 dbSNP
rs879791742 138 dbSNP
rs773875152 143 dbSNP
rs539330465 144 dbSNP
rs1016701993 147 dbSNP
rs988655182 157 dbSNP
rs1383881100 158 dbSNP
rs1302485411 173 dbSNP
rs922526757 174 dbSNP
rs1357158731 175 dbSNP
rs1161231005 177 dbSNP
rs1401179566 180 dbSNP
rs1379581321 186 dbSNP
rs1176294875 197 dbSNP
rs1446416059 204 dbSNP
rs955019761 206 dbSNP
rs1204431760 212 dbSNP
rs1180860087 213 dbSNP
rs1482493375 226 dbSNP
rs761883912 228 dbSNP
rs990831719 232 dbSNP
rs1216911262 235 dbSNP
rs1353678877 239 dbSNP
rs916584456 242 dbSNP
rs1242643862 246 dbSNP
rs970700432 246 dbSNP
rs1440728679 247 dbSNP
rs1290455164 248 dbSNP
rs1376742687 248 dbSNP
rs139430397 248 dbSNP
rs1394466372 248 dbSNP
rs200777264 248 dbSNP
rs755847785 248 dbSNP
rs1400360748 255 dbSNP
rs1359888480 261 dbSNP
rs1156693432 262 dbSNP
rs145992551 263 dbSNP
rs982420135 264 dbSNP
rs1475332167 266 dbSNP
rs1163673604 281 dbSNP
rs1421725837 290 dbSNP
rs1263376141 291 dbSNP
rs985106146 292 dbSNP
rs767546118 293 dbSNP
rs548689266 301 dbSNP
rs1225299840 302 dbSNP
rs1490541829 305 dbSNP
rs1264899396 307 dbSNP
rs111541457 309 dbSNP
rs920724725 313 dbSNP
rs1296547232 316 dbSNP
rs41171 318 dbSNP
rs113173466 324 dbSNP
rs1406651928 325 dbSNP
rs1391321232 326 dbSNP
rs1039430668 329 dbSNP
rs1455919721 335 dbSNP
rs896081534 340 dbSNP
rs758604828 347 dbSNP
rs764118263 348 dbSNP
rs1421877089 360 dbSNP
rs183282847 377 dbSNP
rs905944555 379 dbSNP
rs1225034214 381 dbSNP
rs1267246849 384 dbSNP
rs1208200122 386 dbSNP
rs1000722456 387 dbSNP
rs1033106889 394 dbSNP
rs1224378414 395 dbSNP
rs1331662312 409 dbSNP
rs1300494440 410 dbSNP
rs573396380 414 dbSNP
rs958494491 415 dbSNP
rs1012326003 425 dbSNP
rs891585242 426 dbSNP
rs1023668443 431 dbSNP
rs1179095253 433 dbSNP
rs1010044127 437 dbSNP
rs543842352 439 dbSNP
rs562324994 445 dbSNP
rs531260381 446 dbSNP
rs1446905251 448 dbSNP
rs1191998593 449 dbSNP
rs546146776 450 dbSNP
rs568004259 451 dbSNP
rs1018399031 470 dbSNP
rs1480937837 471 dbSNP
rs1175280315 477 dbSNP
rs1255357109 483 dbSNP
rs111582524 486 dbSNP
rs564712862 492 dbSNP
rs1309408154 495 dbSNP
rs753840961 500 dbSNP
rs528650432 504 dbSNP
rs929430318 510 dbSNP
rs983646881 512 dbSNP
rs917486474 514 dbSNP
rs1415409887 517 dbSNP
rs1401881518 531 dbSNP
rs1171368123 532 dbSNP
rs1304826404 534 dbSNP
rs1455843171 538 dbSNP
rs112326125 539 dbSNP
rs1437896358 544 dbSNP
rs781662688 552 dbSNP
rs1245202562 553 dbSNP
rs1044394944 555 dbSNP
rs1442812946 558 dbSNP
rs1255172746 565 dbSNP
rs568608119 567 dbSNP
rs936018814 573 dbSNP
rs1286634125 578 dbSNP
rs1238881987 581 dbSNP
rs374254993 586 dbSNP
rs891895067 587 dbSNP
rs760706734 599 dbSNP
rs1316742660 601 dbSNP
rs1010012882 603 dbSNP
rs551021554 604 dbSNP
rs1241333797 606 dbSNP
rs1261349981 611 dbSNP
rs1047184718 612 dbSNP
rs1361809412 617 dbSNP
rs10212055 625 dbSNP
rs1417950911 626 dbSNP
rs891042359 629 dbSNP
rs539734867 637 dbSNP
rs557725742 639 dbSNP
rs866766527 647 dbSNP
rs1489146602 649 dbSNP
rs1263822161 651 dbSNP
rs1199140389 652 dbSNP
rs566660186 657 dbSNP
rs1215735750 662 dbSNP
rs1487039394 663 dbSNP
rs533781321 667 dbSNP
rs140836436 668 dbSNP
rs906627526 673 dbSNP
rs150155278 689 dbSNP
rs1025801108 690 dbSNP
rs1341451332 699 dbSNP
rs543878137 700 dbSNP
rs1165405206 704 dbSNP
rs114188007 705 dbSNP
rs577527411 708 dbSNP
rs138643940 709 dbSNP
rs1324342804 712 dbSNP
rs989767766 713 dbSNP
rs564673938 730 dbSNP
rs142937499 735 dbSNP
rs1365802384 746 dbSNP
rs950205876 750 dbSNP
rs1424019346 757 dbSNP
rs1478689331 757 dbSNP
rs1393387601 759 dbSNP
rs1307913311 761 dbSNP
rs1476828232 763 dbSNP
rs980723414 775 dbSNP
rs1221744136 778 dbSNP
rs1450467600 779 dbSNP
rs927588136 781 dbSNP
rs922767557 784 dbSNP
rs1278011578 786 dbSNP
rs1217163910 790 dbSNP
rs933744976 795 dbSNP
rs935972164 796 dbSNP
rs9620939 798 dbSNP
rs1329357989 799 dbSNP
rs1264087976 804 dbSNP
rs1481796107 806 dbSNP
rs1331158050 820 dbSNP
rs1466371134 833 dbSNP
rs562243069 836 dbSNP
rs946177188 847 dbSNP
rs1463862380 851 dbSNP
rs1427181212 852 dbSNP
rs1050879406 855 dbSNP
rs1437355669 856 dbSNP
rs1191639349 863 dbSNP
rs539749018 864 dbSNP
rs147241655 867 dbSNP
rs1179939667 873 dbSNP
rs1257021111 881 dbSNP
rs541324762 888 dbSNP
rs1314242315 893 dbSNP
rs1162547137 897 dbSNP
rs1219107133 907 dbSNP
rs948617672 909 dbSNP
rs1311616448 915 dbSNP
rs2285645 919 dbSNP
rs562907964 921 dbSNP
rs533125488 922 dbSNP
rs898439965 926 dbSNP
rs139067701 928 dbSNP
rs1399829341 929 dbSNP
rs995561547 946 dbSNP
rs1004038949 948 dbSNP
rs1025347376 960 dbSNP
rs1031082049 961 dbSNP
rs1413881093 963 dbSNP
rs758237247 964 dbSNP
rs1159997553 967 dbSNP
rs1439772769 974 dbSNP
rs1317222884 976 dbSNP
rs951102592 979 dbSNP
rs1383564870 984 dbSNP
rs1013307704 1003 dbSNP
rs1228277295 1005 dbSNP
rs1238373385 1007 dbSNP
rs892492627 1015 dbSNP
rs1311133936 1017 dbSNP
rs569907854 1020 dbSNP
rs1022576084 1021 dbSNP
rs1228614407 1024 dbSNP
rs964306595 1026 dbSNP
rs1257102130 1034 dbSNP
rs1024732519 1037 dbSNP
rs1030248208 1056 dbSNP
rs1303265667 1056 dbSNP
rs528824229 1067 dbSNP
rs1447003077 1068 dbSNP
rs117875018 1071 dbSNP
rs1299887428 1071 dbSNP
rs112648574 1072 dbSNP
rs529934855 1072 dbSNP
rs980310290 1073 dbSNP
rs41172 1076 dbSNP
rs1460443562 1077 dbSNP
rs957669794 1078 dbSNP
rs962377841 1079 dbSNP
rs990556158 1080 dbSNP
rs1265991410 1084 dbSNP
rs1169468890 1086 dbSNP
rs913271356 1089 dbSNP
rs946061297 1090 dbSNP
rs555023611 1095 dbSNP
rs915547744 1114 dbSNP
rs1284022458 1116 dbSNP
rs1464233767 1120 dbSNP
rs113914050 1121 dbSNP
rs1322616615 1126 dbSNP
rs1312275409 1128 dbSNP
rs192999293 1132 dbSNP
rs1447300557 1133 dbSNP
rs1039561853 1140 dbSNP
rs1301674861 1142 dbSNP
rs572127310 1142 dbSNP
rs1280047266 1147 dbSNP
rs1400495897 1148 dbSNP
rs770662461 1153 dbSNP
rs1286668667 1159 dbSNP
rs1045612234 1162 dbSNP
rs1350109056 1167 dbSNP
rs1163556620 1171 dbSNP
rs1364688441 1181 dbSNP
rs555939498 1185 dbSNP
rs995469777 1188 dbSNP
rs776454279 1189 dbSNP
rs184856026 1192 dbSNP
rs886735634 1194 dbSNP
rs1263309459 1196 dbSNP
rs1477807263 1200 dbSNP
rs1013276651 1201 dbSNP
rs768219183 1205 dbSNP
rs1024702745 1210 dbSNP
rs1211782878 1214 dbSNP
rs892531920 1219 dbSNP
rs1010970124 1229 dbSNP
rs969194837 1231 dbSNP
rs188118923 1235 dbSNP
rs1243833517 1236 dbSNP
rs764365266 1238 dbSNP
rs1486140153 1240 dbSNP
rs1293267366 1244 dbSNP
rs957851754 1256 dbSNP
rs1367637011 1258 dbSNP
rs1292615495 1259 dbSNP
rs1459581972 1260 dbSNP
rs990385472 1266 dbSNP
rs899796429 1269 dbSNP
rs1481263335 1272 dbSNP
rs1171905847 1274 dbSNP
rs1178858992 1293 dbSNP
rs1465430443 1298 dbSNP
rs1430240628 1299 dbSNP
rs1201573395 1304 dbSNP
rs751706862 1307 dbSNP
rs1433870157 1309 dbSNP
rs761886361 1316 dbSNP
rs1266715782 1320 dbSNP
rs1189521562 1324 dbSNP
rs997142133 1329 dbSNP
rs1258943452 1345 dbSNP
rs913502289 1346 dbSNP
rs1199039438 1347 dbSNP
rs1317006733 1349 dbSNP
rs767527274 1350 dbSNP
rs1235271871 1353 dbSNP
rs1312669854 1354 dbSNP
rs1300052115 1355 dbSNP
rs1438058997 1357 dbSNP
rs1378741898 1365 dbSNP
rs1331530803 1369 dbSNP
rs955758589 1371 dbSNP
rs750955707 1372 dbSNP
rs1432153092 1374 dbSNP
rs1004366973 1387 dbSNP
rs1467041328 1391 dbSNP
rs1377540537 1393 dbSNP
rs1171922733 1394 dbSNP
rs557743535 1396 dbSNP
rs967319899 1404 dbSNP
rs1178203268 1414 dbSNP
rs986789988 1417 dbSNP
rs192650083 1420 dbSNP
rs1201939905 1426 dbSNP
rs573607137 1428 dbSNP
rs1255338192 1429 dbSNP
rs1231448032 1434 dbSNP
rs969692736 1436 dbSNP
rs184198794 1439 dbSNP
rs1039934743 1442 dbSNP
rs1238927298 1443 dbSNP
rs1333594760 1445 dbSNP
rs1336615578 1451 dbSNP
rs934510318 1459 dbSNP
rs919735876 1462 dbSNP
rs1052975301 1466 dbSNP
rs1285709156 1473 dbSNP
rs1316943498 1483 dbSNP
rs1421612862 1485 dbSNP
rs1215825904 1487 dbSNP
rs1158092619 1510 dbSNP
rs1468841687 1511 dbSNP
rs1283716085 1515 dbSNP
rs1490798703 1524 dbSNP
rs1189438886 1535 dbSNP
rs1370403276 1535 dbSNP
rs780326511 1540 dbSNP
rs1046991038 1545 dbSNP
rs1256736390 1553 dbSNP
rs1208582266 1554 dbSNP
rs1489003275 1564 dbSNP
rs1199865693 1571 dbSNP
rs1286163032 1578 dbSNP
rs887041445 1579 dbSNP
rs949014102 1584 dbSNP
rs1046124932 1585 dbSNP
rs904932028 1588 dbSNP
rs1001997266 1589 dbSNP
rs1032507396 1591 dbSNP
rs754211027 1592 dbSNP
rs946787658 1596 dbSNP
rs1292009222 1597 dbSNP
rs1477805933 1602 dbSNP
rs1043833052 1604 dbSNP
rs1297720112 1605 dbSNP
rs754651079 1606 dbSNP
rs899871118 1606 dbSNP
rs778709479 1612 dbSNP
rs1189657340 1626 dbSNP
rs1416847209 1636 dbSNP
rs1410281778 1638 dbSNP
rs1478792981 1639 dbSNP
rs1263801448 1643 dbSNP
rs1191936590 1647 dbSNP
rs1401296522 1649 dbSNP
rs1011720955 1653 dbSNP
rs1158574370 1654 dbSNP
rs1020477817 1657 dbSNP
rs967634374 1666 dbSNP
rs12537 1671 dbSNP
rs1271716179 1672 dbSNP
rs1051806720 1675 dbSNP
rs1019613058 1678 dbSNP
rs1330190277 1681 dbSNP
rs1332858425 1681 dbSNP
rs1405030378 1683 dbSNP
rs1392533033 1684 dbSNP
rs1162604498 1689 dbSNP
rs1466990122 1691 dbSNP
rs891396708 1702 dbSNP
rs964394949 1707 dbSNP
rs1004843664 1709 dbSNP
rs1015770284 1716 dbSNP
rs771730457 1719 dbSNP
rs116588341 1728 dbSNP
rs995255417 1730 dbSNP
rs144741450 1732 dbSNP
rs562885405 1736 dbSNP
rs1318968687 1743 dbSNP
rs777377978 1747 dbSNP
rs148549442 1753 dbSNP
rs1373436575 1758 dbSNP
rs1238785429 1764 dbSNP
rs908445173 1770 dbSNP
rs1347719735 1773 dbSNP
rs1275569651 1784 dbSNP
rs1324190048 1791 dbSNP
rs865958725 1794 dbSNP
rs949313757 1795 dbSNP
rs969724115 1796 dbSNP
rs1448744345 1802 dbSNP
rs188349460 1805 dbSNP
rs1046092369 1807 dbSNP
rs1408183560 1814 dbSNP
rs955994659 1824 dbSNP
rs904816336 1832 dbSNP
rs1172725038 1833 dbSNP
rs1361480616 1834 dbSNP
rs937679953 1835 dbSNP
rs1392892753 1847 dbSNP
rs1180074000 1849 dbSNP
rs989095963 1857 dbSNP
rs1288921122 1858 dbSNP
rs1202841383 1867 dbSNP
rs1449610435 1873 dbSNP
rs1444696658 1875 dbSNP
rs914448402 1876 dbSNP
rs1053520492 1878 dbSNP
rs947196539 1885 dbSNP
rs979540869 1888 dbSNP
rs1234748627 1890 dbSNP
rs1241195220 1892 dbSNP
rs893572315 1894 dbSNP
rs1297449636 1899 dbSNP
rs1011689724 1904 dbSNP
rs932706949 1905 dbSNP
rs1020445344 1910 dbSNP
rs560088871 1915 dbSNP
rs1373058120 1919 dbSNP
rs1008396391 1925 dbSNP
rs543736427 1928 dbSNP
rs1379053461 1930 dbSNP
rs1175919374 1931 dbSNP
rs891088390 1935 dbSNP
rs940287169 1940 dbSNP
rs1446940592 1949 dbSNP
rs9983 1955 dbSNP
rs1390492592 1958 dbSNP
rs1288306390 1959 dbSNP
rs898700147 1960 dbSNP
rs1403890599 1962 dbSNP
rs1221870624 1965 dbSNP
rs1305054612 1965 dbSNP
rs1330554101 1967 dbSNP
rs995616581 1967 dbSNP
rs4487184 1968 dbSNP
rs1373532249 1970 dbSNP
rs1471209856 1976 dbSNP
rs1354740083 1993 dbSNP
rs776349178 1994 dbSNP
rs1156423397 1996 dbSNP
rs1407464014 1996 dbSNP
rs181797188 2001 dbSNP
rs1027052467 2004 dbSNP
rs1022693072 2006 dbSNP
rs952800743 2007 dbSNP
rs982603060 2013 dbSNP
rs142924812 2021 dbSNP
rs113797670 2023 dbSNP
rs184925401 2027 dbSNP
rs573861686 2028 dbSNP
rs1353995933 2043 dbSNP
rs1273636941 2052 dbSNP
rs6006325 2060 dbSNP
rs1232444462 2064 dbSNP
rs1216098985 2067 dbSNP
rs772460523 2070 dbSNP
rs369945104 2074 dbSNP
rs563351996 2074 dbSNP
rs1458364576 2088 dbSNP
rs1198131923 2089 dbSNP
rs1382315637 2098 dbSNP
rs1236467900 2104 dbSNP
rs926543690 2109 dbSNP
rs1022762723 2121 dbSNP
rs571289723 2129 dbSNP
rs937676326 2131 dbSNP
rs1021539007 2134 dbSNP
rs968563336 2148 dbSNP
rs974594776 2151 dbSNP
rs542867895 2153 dbSNP
rs760366835 2165 dbSNP
rs914991137 2176 dbSNP
rs1428027188 2181 dbSNP
rs1259791817 2184 dbSNP
rs1192970183 2186 dbSNP
rs932762059 2188 dbSNP
rs987249774 2189 dbSNP
rs769409665 2193 dbSNP
rs77750544 2194 dbSNP
rs903328301 2195 dbSNP
rs1008363905 2201 dbSNP
rs1228019198 2207 dbSNP
rs1423949434 2212 dbSNP
rs1306822673 2213 dbSNP
rs1037271612 2216 dbSNP
rs1388003137 2218 dbSNP
rs868053313 2221 dbSNP
rs189055118 2222 dbSNP
rs41278855 2226 dbSNP
rs1044554752 2229 dbSNP
rs1402858783 2231 dbSNP
rs996844908 2232 dbSNP
rs1461965848 2234 dbSNP
rs181872820 2242 dbSNP
rs905991428 2243 dbSNP
rs1452640954 2261 dbSNP
rs1333499779 2268 dbSNP
rs761978252 2290 dbSNP
rs1394720685 2301 dbSNP
rs1338611802 2305 dbSNP
rs1432690626 2316 dbSNP
rs186438685 2324 dbSNP
rs761184952 2325 dbSNP
rs952769501 2331 dbSNP
rs1196141298 2333 dbSNP
rs1480305144 2341 dbSNP
rs1004258703 2346 dbSNP
rs1015692587 2351 dbSNP
rs556047372 2353 dbSNP
rs1347908103 2355 dbSNP
rs982380062 2356 dbSNP
rs1231673578 2358 dbSNP
rs1378628288 2368 dbSNP
rs115890902 2372 dbSNP
rs544517049 2373 dbSNP
rs140176079 2378 dbSNP
rs1021279886 2381 dbSNP
rs989160063 2386 dbSNP
rs578052886 2387 dbSNP
rs1201096501 2388 dbSNP
rs1256130657 2390 dbSNP
rs996062311 2394 dbSNP
rs1028834676 2395 dbSNP
rs1435444624 2414 dbSNP
rs945051959 2423 dbSNP
rs1374889537 2428 dbSNP
rs1171815926 2431 dbSNP
rs1195907084 2432 dbSNP
rs1042093076 2439 dbSNP
rs1182261626 2442 dbSNP
rs545451279 2444 dbSNP
rs868447789 2457 dbSNP
rs1041637646 2462 dbSNP
rs41281621 2464 dbSNP
rs542610766 2466 dbSNP
rs41281623 2467 dbSNP
rs931573053 2468 dbSNP
rs1238799922 2471 dbSNP
rs1334303294 2479 dbSNP
rs1048641782 2486 dbSNP
rs1315479395 2486 dbSNP
rs78394474 2488 dbSNP
rs1355366119 2495 dbSNP
rs181468979 2503 dbSNP
rs12166486 2505 dbSNP
rs938835954 2509 dbSNP
rs571391192 2515 dbSNP
rs761743873 2518 dbSNP
rs1452828375 2521 dbSNP
rs866486648 2523 dbSNP
rs1009963433 2529 dbSNP
rs1189772323 2533 dbSNP
rs184928141 2534 dbSNP
rs1475528298 2539 dbSNP
rs1256714123 2544 dbSNP
rs1003372698 2546 dbSNP
rs1042754624 2551 dbSNP
rs564504044 2556 dbSNP
rs761917845 2563 dbSNP
rs1204148384 2564 dbSNP
rs1276606421 2567 dbSNP
rs565681315 2580 dbSNP
rs11552852 2588 dbSNP
rs989771456 2589 dbSNP
rs1234107592 2591 dbSNP
rs1291909228 2593 dbSNP
rs1401943090 2594 dbSNP
rs1022182044 2595 dbSNP
rs150924047 2598 dbSNP
rs954594714 2598 dbSNP
rs966327379 2604 dbSNP
rs41281625 2605 dbSNP
rs1461710133 2627 dbSNP
rs542463991 2631 dbSNP
rs1417098364 2633 dbSNP
rs554888835 2641 dbSNP
rs911629103 2643 dbSNP
rs944487130 2647 dbSNP
rs11552853 2650 dbSNP
rs1242238196 2662 dbSNP
rs1287290232 2671 dbSNP
rs1488204626 2675 dbSNP
rs1191933749 2677 dbSNP
rs755380449 2682 dbSNP
rs976943799 2683 dbSNP
rs1433375120 2693 dbSNP
rs1214718724 2700 dbSNP
rs76999529 2703 dbSNP
rs1014736745 2708 dbSNP
rs1216869297 2714 dbSNP
rs1375448648 2729 dbSNP
rs1470846795 2730 dbSNP
rs1159184611 2735 dbSNP
rs1213696034 2738 dbSNP
rs1225329363 2748 dbSNP
rs1359811151 2752 dbSNP
rs1326761678 2753 dbSNP
rs1441396787 2757 dbSNP
rs932841295 2768 dbSNP
rs1323610666 2772 dbSNP
rs1049090496 2774 dbSNP
rs888716915 2775 dbSNP
rs779367493 2778 dbSNP
rs1417686349 2791 dbSNP
rs939993146 2792 dbSNP
rs1396527853 2793 dbSNP
rs919928888 2795 dbSNP
rs1037071718 2803 dbSNP
rs906614878 2805 dbSNP
rs1207048138 2810 dbSNP
rs8142666 2812 dbSNP
rs980351236 2813 dbSNP
rs1194166589 2842 dbSNP
rs1350084319 2861 dbSNP
rs927518782 2866 dbSNP
rs1233899627 2868 dbSNP
rs752429478 2872 dbSNP
rs371879943 2876 dbSNP
rs938923343 2880 dbSNP
rs758091723 2888 dbSNP
rs894944716 2893 dbSNP
rs777473644 2904 dbSNP
rs578094808 2905 dbSNP
rs913367481 2907 dbSNP
rs1242405023 2911 dbSNP
rs1022149254 2914 dbSNP
rs1328039492 2925 dbSNP
rs945784127 2929 dbSNP
rs1376786311 2939 dbSNP
rs1392873671 2940 dbSNP
rs1179325113 2941 dbSNP
rs966626644 2942 dbSNP
rs1232835343 2948 dbSNP
rs1180238596 2950 dbSNP
rs1214956822 2955 dbSNP
rs1294440246 2960 dbSNP
rs977720501 2975 dbSNP
rs545176389 2980 dbSNP
rs1042827680 2983 dbSNP
rs570042959 2984 dbSNP
rs904221534 2984 dbSNP
rs1346078917 2989 dbSNP
rs189737438 3004 dbSNP
rs965742927 3007 dbSNP
rs1050386510 3013 dbSNP
rs1373735413 3022 dbSNP
rs1420417453 3045 dbSNP
rs1278701479 3055 dbSNP
rs1178691127 3056 dbSNP
rs1407971996 3059 dbSNP
rs1357273374 3060 dbSNP
rs1313027484 3062 dbSNP
rs1433487011 3064 dbSNP
rs535624094 3067 dbSNP
rs1008786562 3068 dbSNP
rs974863636 3070 dbSNP
rs921714902 3073 dbSNP
rs41173 3074 dbSNP
rs1407769920 3083 dbSNP
rs984310725 3089 dbSNP
rs1476508381 3093 dbSNP
rs1258827107 3094 dbSNP
rs542647478 3095 dbSNP
rs994250444 3096 dbSNP
rs565597421 3110 dbSNP
rs41281627 3116 dbSNP
rs1283366824 3118 dbSNP
rs1037290772 3128 dbSNP
rs1226341839 3129 dbSNP
rs1336861133 3131 dbSNP
rs1293768438 3134 dbSNP
rs1293229242 3138 dbSNP
rs531528596 3140 dbSNP
rs980528949 3148 dbSNP
rs543667216 3151 dbSNP
rs564941008 3153 dbSNP
rs532285206 3159 dbSNP
rs1055596018 3162 dbSNP
rs993057826 3175 dbSNP
rs913432274 3184 dbSNP
rs946188228 3189 dbSNP
rs1474491709 3191 dbSNP
rs895255398 3191 dbSNP
rs547608988 3194 dbSNP
rs6006326 3200 dbSNP
rs931694626 3203 dbSNP
rs1022117962 3204 dbSNP
rs1206651468 3206 dbSNP
rs1322701881 3208 dbSNP
rs1050527496 3209 dbSNP
rs745735239 3210 dbSNP
rs890093764 3211 dbSNP
rs999358071 3215 dbSNP
rs1018823334 3216 dbSNP
rs183232470 3236 dbSNP
rs577553710 3240 dbSNP
rs529796896 3242 dbSNP
rs1443626708 3248 dbSNP
rs1395717342 3250 dbSNP
rs1325595804 3265 dbSNP
rs368723788 3275 dbSNP
rs569602438 3277 dbSNP
rs1185354565 3280 dbSNP
rs1171307371 3289 dbSNP
rs1027422198 3300 dbSNP
rs1256777724 3302 dbSNP
rs1417698566 3306 dbSNP
rs140244836 3309 dbSNP
rs1253415666 3312 dbSNP
rs984288173 3317 dbSNP
rs1212774605 3319 dbSNP
rs910013922 3323 dbSNP
rs961547164 3329 dbSNP
rs537075941 3331 dbSNP
rs1366977212 3339 dbSNP
rs1467406654 3340 dbSNP
rs1021942831 3348 dbSNP
rs1171589592 3352 dbSNP
rs1399658964 3354 dbSNP
rs1034768598 3356 dbSNP
rs1371206703 3360 dbSNP
rs960067465 3361 dbSNP
rs775230015 3368 dbSNP
rs377371967 3376 dbSNP
rs928258088 3392 dbSNP
rs1299222608 3393 dbSNP
rs1461579767 3394 dbSNP
rs1175543198 3403 dbSNP
rs1368824426 3403 dbSNP
rs939330575 3408 dbSNP
rs1435584508 3413 dbSNP
rs1394632185 3420 dbSNP
rs187925531 3420 dbSNP
rs571846085 3421 dbSNP
rs1431212943 3423 dbSNP
rs1252635835 3431 dbSNP
rs1177746673 3436 dbSNP
rs780557501 3443 dbSNP
rs1380501475 3452 dbSNP
rs1480242280 3454 dbSNP
rs978941755 3456 dbSNP
rs149894977 3459 dbSNP
rs931731516 3462 dbSNP
rs1311069566 3467 dbSNP
rs1337871310 3469 dbSNP
rs946841926 3470 dbSNP
rs1320393639 3472 dbSNP
rs1043791108 3473 dbSNP
rs1435409651 3479 dbSNP
rs1256958697 3484 dbSNP
rs902320087 3485 dbSNP
rs911585802 3487 dbSNP
rs191779648 3488 dbSNP
rs1040242917 3490 dbSNP
rs1036712537 3494 dbSNP
rs919194998 3495 dbSNP
rs144950483 3497 dbSNP
rs1180001825 3499 dbSNP
rs1263608270 3503 dbSNP
rs183560124 3512 dbSNP
rs1255095976 3519 dbSNP
rs1198403208 3525 dbSNP
rs1352329153 3526 dbSNP
rs1002066904 3527 dbSNP
rs1423176131 3529 dbSNP
rs1028699892 3540 dbSNP
rs554681763 3546 dbSNP
rs1178288353 3548 dbSNP
rs1359773435 3549 dbSNP
rs1415523921 3551 dbSNP
rs149072497 3553 dbSNP
rs1301546566 3557 dbSNP
rs1332224935 3558 dbSNP
rs1384152679 3564 dbSNP
rs1385861932 3566 dbSNP
rs34329885 3566 dbSNP
rs1289301888 3569 dbSNP
rs1014697098 3573 dbSNP
rs1014236880 3579 dbSNP
rs1400992371 3580 dbSNP
rs543354071 3582 dbSNP
rs1277246527 3583 dbSNP
rs1020270679 3586 dbSNP
rs1448371613 3595 dbSNP
rs565228385 3596 dbSNP
rs1208555404 3598 dbSNP
rs1337936887 3598 dbSNP
rs1220488845 3605 dbSNP
rs577051879 3605 dbSNP
rs1278744598 3622 dbSNP
rs1334708430 3638 dbSNP
rs1282507733 3639 dbSNP
rs1229701110 3644 dbSNP
rs541259700 3646 dbSNP
rs1311049965 3652 dbSNP
rs1317882058 3660 dbSNP
rs1434144837 3664 dbSNP
rs967633945 3668 dbSNP
rs557269398 3678 dbSNP
rs1327609910 3683 dbSNP
rs972921443 3685 dbSNP
rs1389840397 3690 dbSNP
rs928193308 3694 dbSNP
rs755019622 3695 dbSNP
rs1373337765 3698 dbSNP
rs1187504813 3705 dbSNP
rs370253981 3713 dbSNP
rs576124894 3713 dbSNP
rs1255305934 3720 dbSNP
rs1287989049 3727 dbSNP
rs1451607621 3733 dbSNP
rs1288335977 3734 dbSNP
rs1197682196 3746 dbSNP
rs961023084 3753 dbSNP
rs143128004 3756 dbSNP
rs986318244 3758 dbSNP
rs773340475 3759 dbSNP
rs1305359955 3762 dbSNP
rs911628686 3766 dbSNP
rs966163768 3767 dbSNP
rs971717498 3774 dbSNP
rs1411189124 3775 dbSNP
rs1396626156 3786 dbSNP
rs1167356612 3789 dbSNP
rs1427433253 3799 dbSNP
rs1396505768 3807 dbSNP
rs916545845 3817 dbSNP
rs148256253 3822 dbSNP
rs1477893313 3823 dbSNP
rs1425979437 3835 dbSNP
rs1245525482 3837 dbSNP
rs1432600464 3838 dbSNP
rs1043760865 3865 dbSNP
rs1184640105 3873 dbSNP
rs1438851266 3876 dbSNP
rs924045076 3885 dbSNP
rs935145083 3886 dbSNP
rs926493528 3899 dbSNP
rs543861283 3900 dbSNP
rs1420749866 3901 dbSNP
rs937848229 3907 dbSNP
rs548270184 3908 dbSNP
rs1056305021 3910 dbSNP
rs760810785 3917 dbSNP
rs1358976646 3919 dbSNP
rs895918506 3923 dbSNP
rs1014723998 3925 dbSNP
rs901756496 3930 dbSNP
rs766308941 3935 dbSNP
rs777214548 3942 dbSNP
rs903145890 3943 dbSNP
rs1413513824 3946 dbSNP
rs41281629 3955 dbSNP
rs530577270 3956 dbSNP
rs188748182 3957 dbSNP
rs887414467 3964 dbSNP
rs1470801231 3972 dbSNP
rs1275013995 3993 dbSNP
rs192585333 3999 dbSNP
rs953701692 4004 dbSNP
rs75573803 4006 dbSNP
rs1209716455 4007 dbSNP
rs1216964075 4009 dbSNP
rs965830732 4010 dbSNP
rs1225259019 4012 dbSNP
rs971749919 4025 dbSNP
rs918964292 4028 dbSNP
rs1354300736 4037 dbSNP
rs1215757635 4046 dbSNP
rs1356850878 4049 dbSNP
rs1283651421 4052 dbSNP
rs1453060600 4053 dbSNP
rs1014664481 4055 dbSNP
rs1224058188 4071 dbSNP
rs897607037 4073 dbSNP
rs951709828 4076 dbSNP
rs1488232742 4079 dbSNP
rs559505929 4094 dbSNP
rs753087847 4114 dbSNP
rs926544526 4117 dbSNP
rs994330208 4118 dbSNP
rs1191808520 4121 dbSNP
rs1382747643 4125 dbSNP
rs937900764 4126 dbSNP
rs1158517951 4127 dbSNP
rs75076809 4129 dbSNP
rs1407365720 4132 dbSNP
rs117793065 4137 dbSNP
rs117946776 4139 dbSNP
rs1206766754 4144 dbSNP
rs138998974 4145 dbSNP
rs1312814464 4157 dbSNP
rs1227239678 4163 dbSNP
rs564457687 4165 dbSNP
rs1271547913 4169 dbSNP
rs576454040 4171 dbSNP
rs1376931686 4173 dbSNP
rs537492135 4174 dbSNP
rs1350973902 4176 dbSNP
rs979424203 4176 dbSNP
rs1164245246 4177 dbSNP
rs558662228 4179 dbSNP
rs780518967 4180 dbSNP
rs1187361316 4186 dbSNP
rs577236562 4200 dbSNP
rs935449751 4201 dbSNP
rs541301550 4209 dbSNP
rs976578244 4211 dbSNP
rs114262232 4212 dbSNP
rs745852320 4220 dbSNP
rs931822989 4221 dbSNP
rs1321320942 4226 dbSNP
rs958615168 4227 dbSNP
rs756018896 4239 dbSNP
rs887718582 4241 dbSNP
rs1240123202 4243 dbSNP
rs373744639 4259 dbSNP
rs1274444792 4262 dbSNP
rs902008230 4264 dbSNP
rs941664668 4269 dbSNP
rs1295953829 4271 dbSNP
rs1443551789 4272 dbSNP
rs41174 4280 dbSNP
rs77792885 4281 dbSNP
rs1002587842 4283 dbSNP
rs1456804768 4283 dbSNP
rs1348514258 4285 dbSNP
rs1356376381 4290 dbSNP
rs1231665483 4291 dbSNP
rs1429355111 4298 dbSNP
rs1035855843 4311 dbSNP
rs1388544512 4314 dbSNP
rs1186503461 4315 dbSNP
rs1474011115 4316 dbSNP
rs1268019714 4320 dbSNP
rs182709753 4324 dbSNP
rs896622876 4328 dbSNP
rs749072070 4331 dbSNP
rs1412670667 4338 dbSNP
rs371504033 4339 dbSNP
rs552178437 4340 dbSNP
rs1205163820 4341 dbSNP
rs1172301886 4359 dbSNP
rs1400398622 4362 dbSNP
rs768369944 4365 dbSNP
rs1033733304 4377 dbSNP
rs959323624 4379 dbSNP
rs1237014379 4380 dbSNP
rs1023822431 4381 dbSNP
rs968297725 4387 dbSNP
rs979391495 4389 dbSNP
rs1313189548 4392 dbSNP
rs1030923315 4393 dbSNP
rs1385606434 4395 dbSNP
rs1376084767 4400 dbSNP
rs374689268 4401 dbSNP
rs917797265 4411 dbSNP
rs1368999410 4412 dbSNP
rs956715383 4414 dbSNP
rs1466708662 4417 dbSNP
rs1378007298 4421 dbSNP
rs558636023 4422 dbSNP
rs1448537309 4427 dbSNP
rs1431370703 4431 dbSNP
rs1283417781 4439 dbSNP
rs976165336 4443 dbSNP
rs563899569 4450 dbSNP
rs1482426916 4452 dbSNP
rs550139088 4455 dbSNP
rs1231704746 4457 dbSNP
rs773494967 4471 dbSNP
rs931816223 4478 dbSNP
rs1260168895 4487 dbSNP
rs1255778165 4496 dbSNP
rs1231524358 4505 dbSNP
rs1319312325 4508 dbSNP
rs986398583 4510 dbSNP
rs1054470702 4513 dbSNP
rs1314770179 4515 dbSNP
rs1396836478 4520 dbSNP
rs909122753 4522 dbSNP
rs15831 4532 dbSNP
rs20013 4534 dbSNP
rs3067067 4537 dbSNP
rs772399667 4538 dbSNP
rs1464339308 4539 dbSNP
rs1414148065 4540 dbSNP
rs145359642 4540 dbSNP
rs879454988 4540 dbSNP
rs1159864430 4541 dbSNP
rs59697212 4541 dbSNP
rs765052389 4541 dbSNP
rs771384566 4541 dbSNP
rs1041022287 4544 dbSNP
rs796214425 4544 dbSNP
rs61220057 4545 dbSNP
rs15888 4546 dbSNP
rs1026419766 4547 dbSNP
rs887539313 4548 dbSNP
rs530275611 4555 dbSNP
rs897460168 4558 dbSNP
rs1033351790 4564 dbSNP
rs959294799 4570 dbSNP
rs1390595026 4580 dbSNP
rs1423876556 4586 dbSNP
rs1464690199 4593 dbSNP
rs992121997 4597 dbSNP
rs938360111 4602 dbSNP
rs116023578 4606 dbSNP
rs570164631 4623 dbSNP
rs5763712 4624 dbSNP
rs1367571575 4631 dbSNP
rs925073823 4634 dbSNP
rs1012401796 4640 dbSNP
rs1045240223 4643 dbSNP
rs751842724 4648 dbSNP
rs1188248974 4654 dbSNP
rs1463985364 4656 dbSNP
rs1292626906 4661 dbSNP
rs990638109 4663 dbSNP
rs537125198 4664 dbSNP
rs1001040887 4665 dbSNP
rs1366117915 4666 dbSNP
rs1341337566 4667 dbSNP
rs1434075510 4671 dbSNP
rs1363006025 4689 dbSNP
rs1325407201 4703 dbSNP
rs1218137160 4704 dbSNP
rs1268523342 4706 dbSNP
rs943353549 4707 dbSNP
rs1031227740 4721 dbSNP
rs1040655503 4731 dbSNP
rs558928867 4733 dbSNP
rs1431255028 4747 dbSNP
rs771070041 4748 dbSNP
rs968095536 4748 dbSNP
rs929529101 4754 dbSNP
rs1047891063 4755 dbSNP
rs887906207 4756 dbSNP
rs1006007066 4760 dbSNP
rs1200233287 4772 dbSNP
rs1451484540 4773 dbSNP
rs776540906 4774 dbSNP
rs1030403922 4775 dbSNP
rs1484927151 4776 dbSNP
rs1013651677 4778 dbSNP
rs953621331 4779 dbSNP
rs1024618791 4781 dbSNP
rs868802884 4785 dbSNP
rs570820929 4786 dbSNP
rs1276344075 4792 dbSNP
rs1477306945 4794 dbSNP
rs999404848 4806 dbSNP
rs1190509048 4809 dbSNP
rs1330376958 4809 dbSNP
rs534921582 4810 dbSNP
rs1220999525 4811 dbSNP
rs963214266 4812 dbSNP
rs1411110382 4813 dbSNP
rs971944486 4815 dbSNP
rs1478033592 4816 dbSNP
rs563603470 4822 dbSNP
rs1032217502 4826 dbSNP
rs1373546866 4827 dbSNP
rs1427371690 4827 dbSNP
rs938342460 4828 dbSNP
rs1173457840 4832 dbSNP
rs1184502573 4832 dbSNP
rs957851280 4832 dbSNP
rs1483406516 4833 dbSNP
rs1057227509 4835 dbSNP
rs1251118753 4835 dbSNP
rs1491188610 4836 dbSNP
rs1280478974 4837 dbSNP
rs1491286274 4837 dbSNP
rs145174000 4838 dbSNP
rs1491192199 4838 dbSNP
rs5844886 4838 dbSNP
rs777494343 4838 dbSNP
rs1491287125 4839 dbSNP
rs58038262 4839 dbSNP
rs1200547714 4840 dbSNP
rs948513810 4840 dbSNP
rs1181526144 4841 dbSNP
rs1407128208 4841 dbSNP
rs542043560 4842 dbSNP
rs1190273708 4843 dbSNP
rs1316407811 4843 dbSNP
rs964804698 4845 dbSNP
rs1323032737 4846 dbSNP
rs904003633 4846 dbSNP
rs116953771 4847 dbSNP
rs749927557 4847 dbSNP
rs1392243051 4848 dbSNP
rs1367021814 4849 dbSNP
rs976504687 4850 dbSNP
rs1234038600 4851 dbSNP
rs1247144255 4852 dbSNP
rs923237991 4852 dbSNP
rs1489388278 4854 dbSNP
rs1346301370 4857 dbSNP
rs1220175770 4858 dbSNP
rs1356896866 4876 dbSNP
rs1276306061 4878 dbSNP
rs1229654712 4879 dbSNP
rs111455427 4887 dbSNP
rs1221441849 4889 dbSNP
rs556857644 4900 dbSNP
rs566259487 4901 dbSNP
rs1488137534 4902 dbSNP
rs545547073 4907 dbSNP
rs1372688574 4910 dbSNP
rs1308902354 4915 dbSNP
rs1429297522 4919 dbSNP
rs997519160 4929 dbSNP
rs563748351 4930 dbSNP
rs953409214 4931 dbSNP
rs765823663 4945 dbSNP
rs1190177744 4952 dbSNP
rs1197525219 4956 dbSNP
rs1016369318 4957 dbSNP
rs143009071 4962 dbSNP
rs1235870356 4969 dbSNP
rs539839554 4970 dbSNP
rs971914773 4972 dbSNP
rs1222182407 4999 dbSNP
rs919166216 5012 dbSNP
rs960261929 5014 dbSNP
rs1287395479 5016 dbSNP
rs1409442418 5021 dbSNP
rs776062123 5022 dbSNP
rs1296292307 5025 dbSNP
rs1393115799 5026 dbSNP
rs1467365434 5028 dbSNP
rs1359713341 5037 dbSNP
rs867185203 5040 dbSNP
rs1387463834 5041 dbSNP
rs1325336651 5043 dbSNP
rs528717023 5047 dbSNP
rs1413547441 5065 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   |||  ||||||| 
Target 5' ------uuuUUAAAUGCUGCUa 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000333027.3 | 3UTR | UUUUUAAAUGCUGCUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.567 2.4e-3 0.531 4.6e-3 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.43 1.6e-2 -0.443 1.3e-2 25 Click to see details
GSE27834 Pluripotent stem cells -0.469 3.3e-2 -0.444 4.2e-2 16 Click to see details
GSE21032 Prostate cancer 0.154 8.2e-2 0.150 8.8e-2 83 Click to see details
GSE17498 Multiple myeloma 0.219 8.7e-2 0.141 1.9e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.4 8.8e-2 -0.451 6.1e-2 13 Click to see details
GSE19536 Breast cancer 0.129 1.0e-1 0.058 2.8e-1 100 Click to see details
GSE21849 B cell lymphoma -0.238 1.1e-1 -0.339 3.6e-2 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.23 1.3e-1 0.408 2.1e-2 25 Click to see details
GSE19783 ER- ER- breast cancer 0.112 1.6e-1 0.054 3.2e-1 79 Click to see details
GSE28544 Breast cancer -0.204 1.7e-1 -0.615 6.9e-4 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.214 1.8e-1 0.177 2.3e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.108 2.8e-1 0.030 4.4e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.046 3.3e-1 -0.001 5.0e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.081 4.0e-1 -0.028 4.7e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.059 4.0e-1 -0.126 3.0e-1 20 Click to see details
GSE17306 Multiple myeloma 0.015 4.6e-1 -0.028 4.2e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.019 4.6e-1 0.048 4.1e-1 24 Click to see details
GSE38226 Liver fibrosis 0.012 4.8e-1 0.029 4.5e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.003 4.9e-1 0.034 3.9e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.003 4.9e-1 0.034 3.9e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.28 0.06 -0.288 0.05 32 Click to see details
BLCA 0.308 0.11 0.212 0.2 18 Click to see details
LUAD 0.362 0.12 0.273 0.2 12 Click to see details
UCEC -0.251 0.15 -0.182 0.23 19 Click to see details
COAD 0.416 0.15 0.500 0.1 8 Click to see details
PCPG 0.885 0.15 0.500 0.33 3 Click to see details
ESCA -0.291 0.19 -0.455 0.08 11 Click to see details
PAAD 0.577 0.21 0.400 0.3 4 Click to see details
CHOL -0.294 0.22 -0.017 0.48 9 Click to see details
THCA -0.083 0.27 -0.186 0.08 59 Click to see details
HNSC -0.087 0.29 -0.043 0.39 42 Click to see details
STAD -0.092 0.31 -0.092 0.31 32 Click to see details
LUSC 0.078 0.32 0.069 0.34 38 Click to see details
BRCA 0.044 0.35 0.003 0.49 84 Click to see details
KIRC -0.023 0.43 0.003 0.49 68 Click to see details
LIHC -0.02 0.45 -0.029 0.42 49 Click to see details
CESC 0.145 0.45 0.500 0.33 3 Click to see details
PRAD 0.013 0.46 0.022 0.44 50 Click to see details
KICH -0.002 0.5 0.062 0.38 25 Click to see details
KICH -0.002 0.5 0.062 0.38 25 Click to see details
KICH -0.002 0.5 0.062 0.38 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmem