miRTarBase - #MIRT289625 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CBX2   
Synonyms CDCA6, M33, SRXY5
Description chromobox 2
Transcript NM_005189   
Other Transcripts NM_032647   
Expression
Putative miRNA Targets on CBX2
3'UTR of CBX2
(miRNA target sites are highlighted)
>CBX2|NM_005189|3'UTR
   1 AGCCCCGGCGCCACCAGCTGCGCGGTCTTACTCCCCTTCCCTGCCTATGGTGTCGCTTGGCTAAGTGACTCCCAGCCCAA
  81 GCCCCCTCAAGAGTCTGGGTCGGGGGAGGAGGAGTGGGTGGCCTCCTTGATGGGCAGGCTTGGAAGGGACTTCTCCCGCA
 161 CCCCACTCTGTCCCAGGACATAGGGCAGGGGGCCTCACTGCCTTGTTGGTCTCCACCTTGTTCCTACCTCTGCAGGCCTC
 241 TTTGCTCTCCCCTCTTGCCTCAGGAAACCCGGTGGCACCTGTGGCTCCAGGTGACTGTCTTGAACAGAGCGGGCTTCTTC
 321 ATGGCTGCGTTGTTGCTGAGTTTGAACTGCTCCTCCCTGGCCTGCGTGACTGAATCACAGCTTTGGTCCCTGTCTTGCAG
 401 GGGCTGAGGTGTCAGGAGGGGACTTCTGGCCCACCTTGCCTTCAGCCCTGGAGTGGGCAGAGAGTATTGTGGGGAGGCAT
 481 GGCCAGTGGGACTAGTGTTCCCTCCATCTGGCCACAGCTTTTGGGAGATGGGGTGGGCAGGGGTGGTCCTGGCTGGCATT
 561 GCCTGAGCCGGCAGTGATGAAGTGGGGAGCTTGCCCTTGACAGGTGGGGGCTGGCTGGGGCCTTAATGTGAAAAGACAGT
 641 GGCAGGCAGCTGGAGTAGAGCGAGCCCAGCAGCCCTAAAAGGCTGCCTTCATGGCCATCTAGCCCCAGTTCAGGGCAGCA
 721 TCCATAGCCCACAAGCCAGCGTGGGTGGGGCGGGGGTGGTCCCACAGCTGGGTTCCACCTGAAGAGCCTCCGTGCCTCGG
 801 AGCAGGAGAGGCAGGCTATGGCTGCCACCCTCCCTCCTGCCTGTGTCCCAGTGAGAACTGACCTGAGTCCCCTTCCAAAC
 881 CCAGACCCACCTCCTGCCCCAGGCCCACTGAAGCATGTTCCATTTCTAAAAAGCCCAGAGTTCAGTGTGTCCCAAGGAAA
 961 ACCCAAAGTGGAGGTGCTCAGGTCCAGGGGAGTCCAGTGGGCAGGACCCTTGGCAGGCAAGCCCCTCCCTTCACTCCCAG
1041 GACCTACCTTCTGCTAGTAAAGGACTGGCTTCATTCTAATTATGGCCCACAGACTGCCCCGGAGACCTGGAGGACAGCAG
1121 TGCTGGCACTTGGGTGTCCATGGGCCCGTCTGCCGGCTCTGCCTGTGCTGCAAGTGTTGGCCGTGGGTCCAGCCAACAAC
1201 TCCCTACGTCCTGTGTGGGGCCCTGCCCAAGTGGATGAGGCATTCCTTGAGGAGTATCATTTTCCCTGACAATCCCCATC
1281 ACCTTTAGGGGTTCCCTGCTTGGCTCCTTTCCAGCTGAAAAACTAGACCTGTGCCATTGGGGAAGCTGGACAAAGTCTAG
1361 GGGGCCCGCCTGGTAGAGGGTCCCGGGAAGCTGGATCTGTCAGCCTCGGCCCTGAGGCCCCTGTTAACTCAAGACTGTGA
1441 GCTGCCTCTAGGTGGTCACGTCTGGGAGCTAGCTTGTATGGCTTCTGACCAGTATCAGGATTTCTGTTCTGAGAGCAGCG
1521 TGGGCAGCAAGGCAGGGCAGCCCAGAGGTGGCAGCGGCAGGCAATCTGGTCACTAGGTCTTTGTGATGCCAAAAATAAAA
1601 GAGGGTGGGGTGGGTGCTTTCTGTTCCTCTGATTGGATGGAGTCCGCCAGCAGGCATGGGGCTACATTCCAGTGCCTGAC
1681 TATAGGGAGGCACTCCTGATTCCATGGAGCAGCCCGGACTTTGAGAATGGGCTCTGGTTTGCGGGGGGCAGGCGTACCAG
1761 ACTGCAAGACCCCCCAGTACCTCACCGTGCCAAATAGGAAGAGGTGGCCTTGGTGTAGCCAAATGGATCTTTTTAACAGT
1841 GTGCCTTTGGGGAGGGACCCATGTCCATGGCTTCGTTGAGGGCCATCCATATGCCAGCTGGGGGCCAGCCCACAGTGGCC
1921 ATATTGGCTGCAGCAGGAATGGTGCCCACCTCGGCGAATTGAAGGGCTAAGAGTCCCAGATAGCTAGGCCAGAGCTGGAA
2001 GCAGACAGTAAGGGGAAGAGCTGCTCCCACAGGAGAGGGAGAGATTCCAGCTCACTGCGCAGCCTGGGAGGAGGCGTGGA
2081 TCCTGGCACGCTGAGCCTCAGGCACCAGCCTCCCTGTGCTCGACAGCAAAGTCTTGACTCCTTCCTGCTGAGCACTGTGC
2161 TACCTTCACTGCTCCAAAGCCAGACTAACAGCTCTCCAAGCCCTTGGGGTGACTCGGCTTCCAGGAGCTGTTGGAGAAAT
2241 GAGGATGTCTGTCCCTGTCTGCCTGGGCAGGCCAGATTCCTCCCCAGCAGCCGGGTCTCTCCAGACCCTGATTCGGTGCC
2321 TTTCTGTTTACCAGCTACTTCAATCCCAAAGTTTGAATCTGCAGATACCTTACTCCCAGCCACTTTGCCTTCTTACTGTG
2401 TTGTGTGTTTTTCCTGGTGCTTCAAGAGCGTGTGCAGGGCAAGTGCCGTCACTGGGAACTGCACCAGATGCTCAGACTTG
2481 GTTGTCTTATGTTTACCAATAAATAAAAGTAGACTTTTTCTATTTTTATTTGCTGCTATTTGTGTGTGTGTTTGTGTTTG
2561 TGTAGCTAGGTATCTGGCACTTCTGACGATGCATTGTTGCTTTTTTCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |:: |||| ||||||| 
Target 5' tttctATTTTTATTTGCTGCTa 3'
2517 - 2538 161.00 -11.80
2
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            | :|| ||  || ||:|||| 
Target 5' ttCTGACGATGCAT-TGTTGCTt 3'
2581 - 2602 135.00 -9.30
3
miRNA  3' guguuugguaauACACGACGau 5'
                      ||||||||  
Target 5' gccggctctgccTGTGCTGCaa 3'
1152 - 1173 130.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30651941 8 COSMIC
COSN24397394 22 COSMIC
COSN30107649 23 COSMIC
COSN30698861 36 COSMIC
COSN30495543 64 COSMIC
COSN30462362 84 COSMIC
COSN31498826 102 COSMIC
COSN31563709 143 COSMIC
COSN26437569 178 COSMIC
COSN26562214 233 COSMIC
COSN31579188 273 COSMIC
COSN31595438 281 COSMIC
COSN31602545 322 COSMIC
COSN20833401 995 COSMIC
COSN31490076 1144 COSMIC
COSN24294772 1159 COSMIC
COSN9323840 1193 COSMIC
COSN31541968 1209 COSMIC
COSN26637837 1250 COSMIC
COSN31490290 1402 COSMIC
COSN31557159 1461 COSMIC
COSN31572667 1520 COSMIC
COSN26506384 1531 COSMIC
COSN26679090 1551 COSMIC
COSN26571666 1574 COSMIC
COSN30157794 1605 COSMIC
COSN8603916 1609 COSMIC
COSN31576127 1716 COSMIC
COSN30541256 1787 COSMIC
COSN25131752 1856 COSMIC
COSN31556683 1953 COSMIC
COSN31538610 2076 COSMIC
COSN16734487 2103 COSMIC
COSN31576126 2158 COSMIC
COSN31519225 2216 COSMIC
COSN26600369 2380 COSMIC
COSN31513340 2481 COSMIC
COSN31593985 2490 COSMIC
COSN29384154 2616 COSMIC
COSN22516626 2655 COSMIC
COSN1729909 2663 COSMIC
COSN25796872 2704 COSMIC
COSN30334084 2854 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201118492 3 dbSNP
rs782311135 7 dbSNP
rs782765846 7 dbSNP
rs377416278 8 dbSNP
rs782538692 10 dbSNP
rs369876256 11 dbSNP
rs781798509 12 dbSNP
rs782469520 14 dbSNP
rs370493071 22 dbSNP
rs374862488 23 dbSNP
rs368908979 24 dbSNP
rs3751958 25 dbSNP
rs782291489 28 dbSNP
rs1376876006 31 dbSNP
rs376662820 31 dbSNP
rs371303159 32 dbSNP
rs1355762314 38 dbSNP
rs377302533 40 dbSNP
rs1413485425 47 dbSNP
rs1373429001 48 dbSNP
rs1175227281 55 dbSNP
rs782514683 56 dbSNP
rs1044241113 57 dbSNP
rs1471231408 58 dbSNP
rs1233466568 62 dbSNP
rs1187148825 65 dbSNP
rs1440864741 75 dbSNP
rs1282718189 76 dbSNP
rs1212097096 82 dbSNP
rs1353432433 91 dbSNP
rs1284581373 94 dbSNP
rs1225919778 98 dbSNP
rs782639576 102 dbSNP
rs546315325 103 dbSNP
rs1279590250 104 dbSNP
rs1026430815 106 dbSNP
rs886077852 107 dbSNP
rs564697398 108 dbSNP
rs35152764 116 dbSNP
rs1009582348 121 dbSNP
rs1019155535 123 dbSNP
rs964857145 125 dbSNP
rs974915922 139 dbSNP
rs1156846544 140 dbSNP
rs1402336878 152 dbSNP
rs1408840205 154 dbSNP
rs1474249609 159 dbSNP
rs1188909278 161 dbSNP
rs1488176755 162 dbSNP
rs1240655100 166 dbSNP
rs75619526 167 dbSNP
rs1317995555 171 dbSNP
rs781900205 175 dbSNP
rs968131778 178 dbSNP
rs1332022149 180 dbSNP
rs1294805654 181 dbSNP
rs1414954061 184 dbSNP
rs978171514 186 dbSNP
rs1286854093 189 dbSNP
rs1432614991 191 dbSNP
rs1345761159 198 dbSNP
rs1322808380 199 dbSNP
rs1459995929 212 dbSNP
rs1420042746 216 dbSNP
rs1165932211 218 dbSNP
rs782542279 221 dbSNP
rs1417838863 225 dbSNP
rs79823889 229 dbSNP
rs73420293 241 dbSNP
rs1246702893 242 dbSNP
rs1212349221 243 dbSNP
rs1466759117 248 dbSNP
rs1274466019 250 dbSNP
rs1233551252 251 dbSNP
rs1306613475 252 dbSNP
rs1292963601 253 dbSNP
rs917202910 263 dbSNP
rs1216179300 268 dbSNP
rs1362384226 268 dbSNP
rs1274198166 270 dbSNP
rs1438543119 271 dbSNP
rs1396820703 272 dbSNP
rs1326602434 288 dbSNP
rs1465149157 297 dbSNP
rs948614003 298 dbSNP
rs1353017720 301 dbSNP
rs1044277556 305 dbSNP
rs529662537 306 dbSNP
rs898988073 311 dbSNP
rs782229193 312 dbSNP
rs1192309918 314 dbSNP
rs1455928822 317 dbSNP
rs1254154690 318 dbSNP
rs1047450712 320 dbSNP
rs1480025604 322 dbSNP
rs1249317830 328 dbSNP
rs548127836 329 dbSNP
rs1307866425 330 dbSNP
rs1302366087 333 dbSNP
rs1008529784 341 dbSNP
rs1019018389 342 dbSNP
rs1232016952 343 dbSNP
rs782652637 350 dbSNP
rs1304027175 351 dbSNP
rs1446220091 353 dbSNP
rs1300125034 354 dbSNP
rs900786888 355 dbSNP
rs1462625540 356 dbSNP
rs996371088 357 dbSNP
rs1436940603 365 dbSNP
rs184579132 366 dbSNP
rs566335237 367 dbSNP
rs1418013973 385 dbSNP
rs782025332 386 dbSNP
rs1000019274 387 dbSNP
rs1178610931 389 dbSNP
rs1031049267 395 dbSNP
rs117700003 397 dbSNP
rs1349778625 401 dbSNP
rs551837409 402 dbSNP
rs1315201251 403 dbSNP
rs1309181256 404 dbSNP
rs1392017948 405 dbSNP
rs1355111847 406 dbSNP
rs1311289508 409 dbSNP
rs961065739 411 dbSNP
rs782430862 414 dbSNP
rs1376384739 420 dbSNP
rs1158579995 423 dbSNP
rs916568983 425 dbSNP
rs969993598 427 dbSNP
rs1160719054 428 dbSNP
rs570349166 431 dbSNP
rs1185329301 441 dbSNP
rs1256448833 441 dbSNP
rs1486535176 444 dbSNP
rs1257878715 452 dbSNP
rs537617559 454 dbSNP
rs782069443 457 dbSNP
rs1484882341 458 dbSNP
rs1262391887 459 dbSNP
rs782646046 459 dbSNP
rs1334242130 461 dbSNP
rs1291682044 468 dbSNP
rs1235297181 469 dbSNP
rs930455719 472 dbSNP
rs1318018537 485 dbSNP
rs1380862019 493 dbSNP
rs1047943593 494 dbSNP
rs1387823816 496 dbSNP
rs1289961637 501 dbSNP
rs1453919805 502 dbSNP
rs1416443443 508 dbSNP
rs907651656 511 dbSNP
rs1162350087 515 dbSNP
rs556184875 534 dbSNP
rs1475959505 535 dbSNP
rs1040045398 544 dbSNP
rs1192258557 570 dbSNP
rs1263844660 571 dbSNP
rs900148748 575 dbSNP
rs1468095467 578 dbSNP
rs996402197 580 dbSNP
rs1215814902 583 dbSNP
rs1043916406 587 dbSNP
rs574632833 591 dbSNP
rs535374960 592 dbSNP
rs782315192 594 dbSNP
rs999731658 616 dbSNP
rs1269792892 618 dbSNP
rs1225780172 620 dbSNP
rs4619435 623 dbSNP
rs1296931799 628 dbSNP
rs1440727630 639 dbSNP
rs781962225 645 dbSNP
rs1323249683 658 dbSNP
rs548956037 662 dbSNP
rs572449658 663 dbSNP
rs1166949520 666 dbSNP
rs1474312005 680 dbSNP
rs1374519527 681 dbSNP
rs189852164 684 dbSNP
rs1453676611 687 dbSNP
rs1251039236 692 dbSNP
rs1023656684 697 dbSNP
rs1195618603 699 dbSNP
rs1468960231 700 dbSNP
rs1272633666 703 dbSNP
rs782770779 704 dbSNP
rs1341916182 706 dbSNP
rs117006205 712 dbSNP
rs1234229137 714 dbSNP
rs1369489650 717 dbSNP
rs969355905 720 dbSNP
rs1306266174 726 dbSNP
rs980019581 730 dbSNP
rs1331122367 733 dbSNP
rs1327769845 738 dbSNP
rs1407822387 739 dbSNP
rs372005385 739 dbSNP
rs4617897 741 dbSNP
rs1169041321 742 dbSNP
rs952048114 743 dbSNP
rs983343639 746 dbSNP
rs1195409183 748 dbSNP
rs1478402642 751 dbSNP
rs907687954 752 dbSNP
rs1179963856 753 dbSNP
rs944484811 756 dbSNP
rs568859702 757 dbSNP
rs1251486184 764 dbSNP
rs1210703865 766 dbSNP
rs1346154876 767 dbSNP
rs921604625 771 dbSNP
rs543951084 777 dbSNP
rs1235572589 778 dbSNP
rs562253770 779 dbSNP
rs1278399056 780 dbSNP
rs1439371508 792 dbSNP
rs931614089 793 dbSNP
rs1373326599 797 dbSNP
rs1175438872 798 dbSNP
rs1043363612 799 dbSNP
rs1407379474 803 dbSNP
rs180843441 811 dbSNP
rs904142390 819 dbSNP
rs1413052843 822 dbSNP
rs1000165054 823 dbSNP
rs138411441 824 dbSNP
rs1052648872 832 dbSNP
rs1259999979 833 dbSNP
rs896620439 834 dbSNP
rs1212259544 835 dbSNP
rs1013696493 842 dbSNP
rs1282736845 844 dbSNP
rs1221645112 850 dbSNP
rs11653768 851 dbSNP
rs1288600144 869 dbSNP
rs905203620 877 dbSNP
rs764438374 882 dbSNP
rs782786575 886 dbSNP
rs1314435502 887 dbSNP
rs781802987 891 dbSNP
rs1344575974 894 dbSNP
rs1026984806 902 dbSNP
rs1316125082 905 dbSNP
rs1402540842 907 dbSNP
rs1412714574 908 dbSNP
rs1164520862 922 dbSNP
rs1474323307 929 dbSNP
rs1420268659 931 dbSNP
rs1182849924 936 dbSNP
rs782430873 937 dbSNP
rs1475290491 938 dbSNP
rs952020801 939 dbSNP
rs983744029 941 dbSNP
rs556896384 943 dbSNP
rs1465862667 944 dbSNP
rs541360384 945 dbSNP
rs1268158278 952 dbSNP
rs966229590 962 dbSNP
rs147957935 965 dbSNP
rs1228737457 969 dbSNP
rs1360943970 970 dbSNP
rs1268351637 971 dbSNP
rs1432762324 981 dbSNP
rs921717272 987 dbSNP
rs931728588 989 dbSNP
rs1397048404 993 dbSNP
rs782746520 997 dbSNP
rs979088626 1004 dbSNP
rs924926002 1018 dbSNP
rs1417727216 1024 dbSNP
rs935612092 1025 dbSNP
rs1450581620 1027 dbSNP
rs1053094768 1030 dbSNP
rs373148426 1041 dbSNP
rs949499290 1047 dbSNP
rs1045252123 1049 dbSNP
rs527278495 1054 dbSNP
rs1306738714 1070 dbSNP
rs1270564842 1073 dbSNP
rs1230315241 1074 dbSNP
rs1365897752 1077 dbSNP
rs905318118 1083 dbSNP
rs1373209108 1086 dbSNP
rs551872553 1086 dbSNP
rs1027000181 1088 dbSNP
rs570163489 1101 dbSNP
rs1461630442 1103 dbSNP
rs1353141027 1110 dbSNP
rs887083598 1116 dbSNP
rs781876289 1119 dbSNP
rs1004803922 1124 dbSNP
rs1395080011 1135 dbSNP
rs1015221040 1141 dbSNP
rs1452039130 1147 dbSNP
rs1268793931 1148 dbSNP
rs184642851 1149 dbSNP
rs975926379 1152 dbSNP
rs1230790418 1154 dbSNP
rs1028763314 1155 dbSNP
rs551728202 1156 dbSNP
rs1231902850 1162 dbSNP
rs880001164 1163 dbSNP
rs1302005252 1164 dbSNP
rs542219851 1170 dbSNP
rs924992924 1171 dbSNP
rs1300111200 1172 dbSNP
rs934954317 1176 dbSNP
rs988420565 1183 dbSNP
rs918199218 1184 dbSNP
rs571795211 1187 dbSNP
rs1176211059 1189 dbSNP
rs1418000108 1196 dbSNP
rs1405419052 1197 dbSNP
rs1183827093 1198 dbSNP
rs782284914 1203 dbSNP
rs1256489476 1204 dbSNP
rs79871473 1208 dbSNP
rs1484220995 1209 dbSNP
rs143651559 1211 dbSNP
rs535769052 1212 dbSNP
rs1229203786 1216 dbSNP
rs534248856 1219 dbSNP
rs887122908 1221 dbSNP
rs1311494404 1224 dbSNP
rs1398124315 1226 dbSNP
rs1403629370 1229 dbSNP
rs1004655255 1234 dbSNP
rs1288787636 1235 dbSNP
rs1041047993 1241 dbSNP
rs1342863902 1247 dbSNP
rs1160963903 1249 dbSNP
rs782567734 1252 dbSNP
rs901790859 1259 dbSNP
rs1416682491 1273 dbSNP
rs1185577539 1279 dbSNP
rs1425330172 1283 dbSNP
rs1256849173 1289 dbSNP
rs1204418223 1292 dbSNP
rs1484936272 1295 dbSNP
rs1270042238 1297 dbSNP
rs1209416373 1302 dbSNP
rs1334492041 1307 dbSNP
rs1291667307 1308 dbSNP
rs997372508 1314 dbSNP
rs1341388942 1316 dbSNP
rs1028794515 1324 dbSNP
rs1295508325 1324 dbSNP
rs1380981362 1336 dbSNP
rs148096541 1337 dbSNP
rs782714747 1338 dbSNP
rs373247820 1342 dbSNP
rs1459258217 1353 dbSNP
rs1368757760 1357 dbSNP
rs1192413014 1358 dbSNP
rs1426713330 1360 dbSNP
rs1249782857 1362 dbSNP
rs1189369159 1363 dbSNP
rs377146058 1366 dbSNP
rs1468082985 1367 dbSNP
rs554061245 1368 dbSNP
rs988252794 1369 dbSNP
rs1251057127 1377 dbSNP
rs868973875 1378 dbSNP
rs917570432 1381 dbSNP
rs970997908 1385 dbSNP
rs72857316 1386 dbSNP
rs782492279 1402 dbSNP
rs1369535045 1410 dbSNP
rs926780268 1413 dbSNP
rs931434419 1414 dbSNP
rs1048547510 1419 dbSNP
rs908657489 1420 dbSNP
rs1390976630 1421 dbSNP
rs539814145 1422 dbSNP
rs1167150192 1426 dbSNP
rs142486042 1426 dbSNP
rs1392012580 1431 dbSNP
rs538853452 1436 dbSNP
rs1453881167 1437 dbSNP
rs1201304866 1439 dbSNP
rs141882296 1445 dbSNP
rs1344739962 1447 dbSNP
rs1275989627 1450 dbSNP
rs1234115619 1455 dbSNP
rs1346563780 1456 dbSNP
rs190311668 1460 dbSNP
rs868953305 1461 dbSNP
rs1407785857 1463 dbSNP
rs1372108370 1464 dbSNP
rs3751959 1468 dbSNP
rs1433977294 1470 dbSNP
rs1174424818 1473 dbSNP
rs1363496501 1474 dbSNP
rs181998493 1479 dbSNP
rs1484242630 1480 dbSNP
rs551224793 1491 dbSNP
rs1210825934 1492 dbSNP
rs1050268487 1493 dbSNP
rs1485000656 1505 dbSNP
rs1281343037 1507 dbSNP
rs1345039098 1510 dbSNP
rs1278599547 1511 dbSNP
rs888957925 1515 dbSNP
rs369375652 1520 dbSNP
rs782243798 1521 dbSNP
rs1032174487 1527 dbSNP
rs1413904164 1534 dbSNP
rs541747343 1536 dbSNP
rs1357423169 1539 dbSNP
rs1336072528 1547 dbSNP
rs1415121741 1548 dbSNP
rs1384259411 1550 dbSNP
rs879988241 1556 dbSNP
rs559586336 1557 dbSNP
rs879971766 1567 dbSNP
rs1412935211 1570 dbSNP
rs1187762938 1597 dbSNP
rs1239738247 1597 dbSNP
rs1472008081 1597 dbSNP
rs779846095 1597 dbSNP
rs1009305704 1598 dbSNP
rs1442529173 1600 dbSNP
rs1024660649 1605 dbSNP
rs150225614 1606 dbSNP
rs1330817768 1608 dbSNP
rs372497837 1609 dbSNP
rs1268361476 1624 dbSNP
rs1232513278 1625 dbSNP
rs1376621699 1627 dbSNP
rs1285887922 1628 dbSNP
rs186499263 1630 dbSNP
rs1325953691 1635 dbSNP
rs563727984 1640 dbSNP
rs1458885002 1644 dbSNP
rs556519171 1645 dbSNP
rs1164414185 1646 dbSNP
rs115199448 1647 dbSNP
rs1416363198 1648 dbSNP
rs908694996 1649 dbSNP
rs1475404884 1651 dbSNP
rs576503162 1655 dbSNP
rs1186193572 1656 dbSNP
rs1248271380 1658 dbSNP
rs782068192 1663 dbSNP
rs782705029 1665 dbSNP
rs781952722 1666 dbSNP
rs932622827 1671 dbSNP
rs1291698580 1672 dbSNP
rs1049711175 1678 dbSNP
rs375718076 1683 dbSNP
rs1338743755 1684 dbSNP
rs1295297801 1687 dbSNP
rs1437386118 1689 dbSNP
rs1365937338 1695 dbSNP
rs889073538 1703 dbSNP
rs936584033 1705 dbSNP
rs1351815805 1706 dbSNP
rs1165983315 1708 dbSNP
rs1388920456 1713 dbSNP
rs1054058005 1714 dbSNP
rs868976446 1716 dbSNP
rs1248058903 1717 dbSNP
rs1487328803 1720 dbSNP
rs1222106078 1722 dbSNP
rs1248061657 1722 dbSNP
rs545471537 1733 dbSNP
rs892270427 1734 dbSNP
rs1272397351 1743 dbSNP
rs74608211 1743 dbSNP
rs564155430 1744 dbSNP
rs754700023 1749 dbSNP
rs782757960 1749 dbSNP
rs1370085899 1753 dbSNP
rs1294323194 1754 dbSNP
rs781908464 1755 dbSNP
rs1369025253 1763 dbSNP
rs1310419485 1766 dbSNP
rs1430899968 1770 dbSNP
rs1394982300 1778 dbSNP
rs1174792737 1784 dbSNP
rs782542749 1787 dbSNP
rs138645791 1788 dbSNP
rs1191348807 1796 dbSNP
rs1472161571 1799 dbSNP
rs984357967 1806 dbSNP
rs1207010609 1808 dbSNP
rs1483366710 1810 dbSNP
rs1016193258 1816 dbSNP
rs1255340628 1817 dbSNP
rs1208175449 1820 dbSNP
rs1313961876 1830 dbSNP
rs1302247690 1837 dbSNP
rs1349039164 1839 dbSNP
rs1290649347 1841 dbSNP
rs1410788312 1846 dbSNP
rs961530805 1850 dbSNP
rs1464109030 1851 dbSNP
rs1360351706 1858 dbSNP
rs1176363761 1861 dbSNP
rs781016463 1862 dbSNP
rs1409276366 1867 dbSNP
rs1184165112 1869 dbSNP
rs569776049 1875 dbSNP
rs922726149 1876 dbSNP
rs1484294095 1880 dbSNP
rs1256611812 1890 dbSNP
rs781849364 1892 dbSNP
rs932738697 1892 dbSNP
rs1208161184 1893 dbSNP
rs1327391859 1900 dbSNP
rs985450412 1904 dbSNP
rs925964055 1912 dbSNP
rs547692088 1918 dbSNP
rs936599114 1922 dbSNP
rs141753224 1923 dbSNP
rs4889787 1924 dbSNP
rs1380504034 1934 dbSNP
rs1336867377 1938 dbSNP
rs1386079145 1948 dbSNP
rs1160845513 1949 dbSNP
rs558225547 1951 dbSNP
rs1367632473 1953 dbSNP
rs1457573802 1953 dbSNP
rs945262073 1954 dbSNP
rs782248745 1956 dbSNP
rs1256731906 1957 dbSNP
rs114341044 1966 dbSNP
rs1250138737 1968 dbSNP
rs537581783 1970 dbSNP
rs1356120862 1972 dbSNP
rs1264106687 1973 dbSNP
rs373990676 1975 dbSNP
rs1247403358 1977 dbSNP
rs868923080 1981 dbSNP
rs782676398 1985 dbSNP
rs555566159 1989 dbSNP
rs190494725 1999 dbSNP
rs1297497206 2002 dbSNP
rs1433738302 2002 dbSNP
rs1362307798 2007 dbSNP
rs1033356182 2010 dbSNP
rs888094859 2012 dbSNP
rs1389535806 2015 dbSNP
rs1161283187 2023 dbSNP
rs868934782 2024 dbSNP
rs1369045046 2025 dbSNP
rs1167813011 2029 dbSNP
rs114924576 2030 dbSNP
rs961923123 2031 dbSNP
rs4335800 2034 dbSNP
rs529152592 2038 dbSNP
rs976930052 2041 dbSNP
rs782325178 2046 dbSNP
rs1212063544 2047 dbSNP
rs577955753 2059 dbSNP
rs781919558 2060 dbSNP
rs1339483559 2063 dbSNP
rs1299241365 2065 dbSNP
rs1227481058 2067 dbSNP
rs1330221401 2072 dbSNP
rs1321162593 2073 dbSNP
rs925966511 2077 dbSNP
rs1365921059 2079 dbSNP
rs935982472 2084 dbSNP
rs1307363933 2090 dbSNP
rs545291689 2090 dbSNP
rs1372294303 2091 dbSNP
rs542690353 2093 dbSNP
rs1477729967 2101 dbSNP
rs1376140733 2105 dbSNP
rs563764893 2107 dbSNP
rs1201183361 2111 dbSNP
rs782231431 2114 dbSNP
rs913859665 2117 dbSNP
rs782385723 2122 dbSNP
rs1275973725 2123 dbSNP
rs1195934918 2129 dbSNP
rs1343599149 2130 dbSNP
rs1272749593 2134 dbSNP
rs1046289916 2137 dbSNP
rs1234899341 2142 dbSNP
rs1345724523 2149 dbSNP
rs1287531908 2155 dbSNP
rs1407759089 2156 dbSNP
rs927751400 2162 dbSNP
rs1329387994 2168 dbSNP
rs1413978417 2169 dbSNP
rs1400111789 2172 dbSNP
rs1174562223 2175 dbSNP
rs781986370 2184 dbSNP
rs1054841446 2186 dbSNP
rs888119909 2190 dbSNP
rs1005254079 2193 dbSNP
rs1473769604 2196 dbSNP
rs1037105659 2197 dbSNP
rs1253184055 2202 dbSNP
rs782162900 2216 dbSNP
rs575931635 2217 dbSNP
rs543518482 2218 dbSNP
rs782419882 2228 dbSNP
rs1267082764 2229 dbSNP
rs1226356868 2232 dbSNP
rs1352026575 2237 dbSNP
rs1280094225 2247 dbSNP
rs781939849 2262 dbSNP
rs113862809 2264 dbSNP
rs529088649 2267 dbSNP
rs139404707 2273 dbSNP
rs988851220 2280 dbSNP
rs1157143124 2283 dbSNP
rs782755293 2284 dbSNP
rs1459161466 2287 dbSNP
rs1409111922 2290 dbSNP
rs913211363 2292 dbSNP
rs1163016952 2293 dbSNP
rs966628472 2294 dbSNP
rs1239718452 2298 dbSNP
rs981999553 2300 dbSNP
rs1184960295 2309 dbSNP
rs1461328171 2312 dbSNP
rs559578994 2313 dbSNP
rs533313762 2315 dbSNP
rs181613648 2316 dbSNP
rs1247033508 2319 dbSNP
rs1206388622 2328 dbSNP
rs570068563 2344 dbSNP
rs537017695 2345 dbSNP
rs117776109 2346 dbSNP
rs1354247793 2352 dbSNP
rs1285870312 2355 dbSNP
rs1246825212 2356 dbSNP
rs1364465829 2360 dbSNP
rs149546727 2376 dbSNP
rs909673730 2378 dbSNP
rs1345978109 2379 dbSNP
rs1323389767 2380 dbSNP
rs1403938759 2381 dbSNP
rs1416605798 2388 dbSNP
rs781959157 2388 dbSNP
rs1164696567 2390 dbSNP
rs941091234 2391 dbSNP
rs1036730837 2392 dbSNP
rs567171849 2398 dbSNP
rs1388957274 2408 dbSNP
rs1186104777 2411 dbSNP
rs1486667645 2412 dbSNP
rs782242811 2414 dbSNP
rs772726417 2415 dbSNP
rs1051249716 2421 dbSNP
rs889961074 2429 dbSNP
rs1449599541 2430 dbSNP
rs143863724 2431 dbSNP
rs1341344257 2436 dbSNP
rs1295547154 2438 dbSNP
rs1230691940 2441 dbSNP
rs1362987150 2443 dbSNP
rs1033576320 2446 dbSNP
rs957505176 2448 dbSNP
rs73420297 2449 dbSNP
rs782526105 2456 dbSNP
rs148618838 2457 dbSNP
rs1429729340 2462 dbSNP
rs1369218419 2474 dbSNP
rs538978812 2475 dbSNP
rs1166248436 2485 dbSNP
rs1429763425 2489 dbSNP
rs557197185 2490 dbSNP
rs927902065 2491 dbSNP
rs1476936868 2492 dbSNP
rs1270716854 2493 dbSNP
rs782581943 2495 dbSNP
rs1222910048 2498 dbSNP
rs1482726379 2506 dbSNP
rs1272369601 2508 dbSNP
rs1206731344 2512 dbSNP
rs1308080772 2515 dbSNP
rs1278221420 2518 dbSNP
rs1217634279 2523 dbSNP
rs1369968345 2528 dbSNP
rs1284376791 2531 dbSNP
rs959274751 2533 dbSNP
rs537095601 2536 dbSNP
rs1174944709 2541 dbSNP
rs1349247157 2541 dbSNP
rs1354573480 2541 dbSNP
rs199727624 2541 dbSNP
rs535899644 2541 dbSNP
rs1412442108 2543 dbSNP
rs117180275 2547 dbSNP
rs1199953131 2547 dbSNP
rs1249531075 2547 dbSNP
rs764358309 2548 dbSNP
rs1178836720 2549 dbSNP
rs1481011097 2549 dbSNP
rs909695820 2551 dbSNP
rs1326007568 2553 dbSNP
rs543004252 2557 dbSNP
rs1228182995 2567 dbSNP
rs972871869 2569 dbSNP
rs1327437220 2574 dbSNP
rs1309827285 2575 dbSNP
rs782488003 2579 dbSNP
rs561830869 2584 dbSNP
rs1050714507 2588 dbSNP
rs1445154404 2589 dbSNP
rs890058577 2594 dbSNP
rs1176621232 2598 dbSNP
rs942933556 2601 dbSNP
rs114464801 2619 dbSNP
rs893269363 2620 dbSNP
rs1160986430 2637 dbSNP
rs1419637510 2637 dbSNP
rs1255385538 2639 dbSNP
rs1010321873 2655 dbSNP
rs1180254552 2660 dbSNP
rs782240550 2662 dbSNP
rs1020345700 2664 dbSNP
rs1243984432 2665 dbSNP
rs782437962 2666 dbSNP
rs1002915283 2667 dbSNP
rs1262919308 2671 dbSNP
rs541126737 2678 dbSNP
rs1321705038 2679 dbSNP
rs782660722 2689 dbSNP
rs1243143398 2690 dbSNP
rs1384310111 2697 dbSNP
rs1337004919 2699 dbSNP
rs959307540 2704 dbSNP
rs991117587 2705 dbSNP
rs1382281268 2708 dbSNP
rs1290485944 2709 dbSNP
rs1454112370 2715 dbSNP
rs1367835706 2719 dbSNP
rs1162523343 2723 dbSNP
rs1446554990 2725 dbSNP
rs79609724 2726 dbSNP
rs1187979675 2731 dbSNP
rs962822140 2747 dbSNP
rs972518591 2750 dbSNP
rs1463745585 2761 dbSNP
rs1206105575 2766 dbSNP
rs1264106391 2766 dbSNP
rs1488320593 2767 dbSNP
rs1225301498 2772 dbSNP
rs918371355 2773 dbSNP
rs1315185065 2774 dbSNP
rs1227017741 2785 dbSNP
rs933722661 2790 dbSNP
rs1297208060 2791 dbSNP
rs1382578876 2817 dbSNP
rs147801911 2819 dbSNP
rs1301241354 2824 dbSNP
rs910857941 2825 dbSNP
rs551716626 2830 dbSNP
rs1447671541 2838 dbSNP
rs1375005016 2839 dbSNP
rs1194118508 2842 dbSNP
rs1432986664 2843 dbSNP
rs372068998 2846 dbSNP
rs868915682 2862 dbSNP
rs1490674804 2865 dbSNP
rs1274539593 2867 dbSNP
rs1203831460 2875 dbSNP
rs782198682 2881 dbSNP
rs1336807975 2884 dbSNP
rs1252737932 2891 dbSNP
rs1227639101 2893 dbSNP
rs1330127306 2897 dbSNP
rs1281189967 2899 dbSNP
rs1406538405 2899 dbSNP
rs1427453411 2909 dbSNP
rs1465763543 2909 dbSNP
rs575656805 2909 dbSNP
rs577465322 2909 dbSNP
rs893311194 2909 dbSNP
rs563411076 2910 dbSNP
rs1480936484 2919 dbSNP
rs1251739307 2921 dbSNP
rs1435596353 2923 dbSNP
rs1252110447 2926 dbSNP
rs1041907528 2927 dbSNP
rs907312094 2934 dbSNP
rs1260852806 2936 dbSNP
rs1225118901 2938 dbSNP
rs1323940977 2941 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000310942.4 | 3UTR | ACUUUUUCUAUUUUUAUUUGCUGCUAUUUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000310942.4 | 3UTR | UUCUAUUUUUAUUUGCUGCUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000310942.4 | 3UTR | UUACCAAUAAAUAAAAGUAGACUUUUUCUAUUUUUAUUUGCUGCUAUUUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000310942.4 | 3UTR | ACUUUUUCUAUUUUUAUUUGCUGCUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.719 5.5e-5 -0.545 3.6e-3 23 Click to see details
GSE14794 Lymphoblastoid cells 0.196 3.2e-2 0.187 3.9e-2 90 Click to see details
GSE38226 Liver fibrosis 0.367 5.1e-2 0.240 1.5e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.177 8.1e-2 -0.165 9.6e-2 64 Click to see details
GSE21032 Prostate cancer -0.132 1.2e-1 -0.077 2.4e-1 83 Click to see details
GSE26953 Aortic valvular endothelial cells 0.22 1.5e-1 0.175 2.1e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.17 2.1e-1 0.125 2.8e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.214 2.1e-1 -0.194 2.4e-1 16 Click to see details
GSE28544 Breast cancer -0.164 2.2e-1 -0.409 2.4e-2 24 Click to see details
GSE17306 Multiple myeloma -0.103 2.4e-1 -0.120 2.1e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer -0.14 2.8e-1 0.174 2.3e-1 20 Click to see details
GSE19536 Breast cancer -0.058 2.8e-1 -0.109 1.4e-1 100 Click to see details
GSE32688 Pancreatic cancer 0.085 3.2e-1 0.124 2.5e-1 32 Click to see details
GSE19783 ER- ER- breast cancer -0.05 3.3e-1 -0.110 1.7e-1 79 Click to see details
GSE19350 CNS germ cell tumors -0.136 3.4e-1 -0.350 1.3e-1 12 Click to see details
GSE17498 Multiple myeloma 0.068 3.4e-1 -0.023 4.4e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.079 3.5e-1 -0.016 4.7e-1 25 Click to see details
GSE21849 B cell lymphoma -0.052 3.9e-1 0.414 1.3e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.062 4.0e-1 0.188 2.1e-1 20 Click to see details
GSE28260 Renal cortex and medulla 0.005 4.9e-1 -0.148 3.1e-1 13 Click to see details
GSE28260 Renal cortex and medulla 0.005 4.9e-1 -0.148 3.1e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.453 0 0.542 0 42 Click to see details
THCA 0.378 0 0.425 0 59 Click to see details
KIRC -0.326 0 -0.269 0.01 68 Click to see details
PRAD 0.306 0.02 0.226 0.06 50 Click to see details
PAAD -0.886 0.06 -0.800 0.1 4 Click to see details
STAD 0.265 0.07 0.238 0.09 32 Click to see details
COAD 0.508 0.1 0.500 0.1 8 Click to see details
UCEC 0.277 0.13 0.154 0.26 19 Click to see details
KICH 0.238 0.13 0.191 0.18 25 Click to see details
LUAD -0.316 0.16 -0.483 0.06 12 Click to see details
LIHC 0.12 0.21 0.114 0.22 49 Click to see details
ESCA 0.273 0.21 0.291 0.19 11 Click to see details
LUSC -0.117 0.24 -0.094 0.29 38 Click to see details
PCPG 0.649 0.28 0.500 0.33 3 Click to see details
CESC 0.57 0.31 0.500 0.33 3 Click to see details
CHOL 0.153 0.35 0.400 0.14 9 Click to see details
BRCA 0.04 0.36 0.037 0.37 84 Click to see details
BLCA 0.076 0.38 -0.001 0.5 18 Click to see details
KIRP -0.022 0.45 0.039 0.42 32 Click to see details
KIRP -0.022 0.45 0.039 0.42 32 Click to see details
KIRP -0.022 0.45 0.039 0.42 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27