miRTarBase - #MIRT282532 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLCO3A1   
Synonyms OATP-D, OATP-RP3, OATP3A1, OATPD, OATPRP3, SLC21A11
Description solute carrier organic anion transporter family member 3A1
Transcript NM_013272   
Other Transcripts NM_001145044   
Expression
Putative miRNA Targets on SLCO3A1
3'UTR of SLCO3A1
(miRNA target sites are highlighted)
>SLCO3A1|NM_013272|3'UTR
   1 TGACTAAAGGAGGGCTGAACTCTGTATTAGTAATCCAAGGGTCATTTTTTTCTTAAAAAAAGAAAAAAAGGTTCCAAAAA
  81 AAACCAAAACTCAGTACACACACACAGGCACAGATGCACACACACGCAGACAGACACACCGACTTTGTCCTTTTTCTCAG
 161 CATCAGAGCCAGACAGGATTCAGAATAAGGAGAGAATGACATCGTGCGGCAGGGTCCTGGAGGCCACTTGCGCGGCTGGG
 241 CCACAGAGTCTACTTTGAAGGCACCTCATGGTTTTCAGGATGCTGACAGCTGCAAGCAACAGGCACTGCCAAATTCAGGG
 321 AACAGTGGTGGCCAGCTTGGAGGATGGACATTTCTGGATACACATACACATACAAAACAGAAAACATTTTTTAAAAGAAG
 401 TTTCCTAAAATAAAAAAAATTAAAAAAAAAAAACCCACAAGTTGAAAACATTGCCAGATTAAGCACTAGTGACACACCCC
 481 GTGCCACCCTCTTCCTCCAGGTGGGGGTGGGGGCGGGCGCACAAGTCGGAGGGGTGGAAGCACCACTCCTCTCTCTGACT
 561 TTCGCAATATGGGTCACTGTGTAGACGACTCACCCAGTCTGCATGTGGTTCAAGGCCCCAGAGTTCTCTCAGTGATGCTA
 641 ATGGGTGATCCGTGCTGGAGTTTGTAATTGGCACCTCTCACCAGCTCCATTTCCATGTTCAAGACTGAGGGCCTGAGGGG
 721 GAGCCAGGTGGGGGGCCAGCACCTCCCAGTGGCGGGCATCCACCTTCCCCCAGCCCCACAGAGTGACCTCAGGAAGCAGT
 801 AGGCCTCGCCTGGCTATGACTGACCCGGCTCAGAGCTGGTGAGACCCAACGCAGTCCAAGTCATTTGCTTACATTTGCCA
 881 AAAACATTTTGCCATTTTTAAAAGAAAAAAATACAATCCATATGAATTTCAAACTGTTGTATGTATAATCCTCTAATACT
 961 ATTTTTAACTACTTCTAAAATCTGTGTTAACCCTTCAAGTCACTAACACAGTTCTCTAGGCCGGATTTATTATGCTGGTT
1041 GCTTTTACTTTTTTTCTCCTTTTTTAATGCACCAAAAATATGTGATACAAGGGATGCAATTAACCTATTGTAATTTTCAT
1121 CATTTTATCCTCATTCGAATATTCTACAAAAACAAGAATATACAATGTGTTACAAGAAGAAAAAAAAATGCTTCAAAAAG
1201 AGAGTGTATATGCAGCCTGCCTTTAAAAGAATCACATTTGAGACAACAGGGGATAATGTGATGAATTGCAAATTTGCCTT
1281 TTAGCTTCCTTCCCCATGATTCAGTGATCACTGTCACGGGAAACCCTTTTATATTCATGCTTGACATTCCAAGAGGCGTT
1361 CTTTTCAGCCTGTGGAGGAGACACTCTTAGATGTGGGTTTGTGTGTATGGGTGCAACACTTCCGGGGATAGGAAAGAAGA
1441 ACAGTTCCCTAACACAAGCTGTTAAGAAGTCTGTAGCATCTCTGATAACGAATAGACCCACAAGCTCCTGGAAGCTGTCG
1521 TGTGTCCAATGCGTGAAAATGTCTGTGACATTTTCAGTGTTAGTCTTGAACTAAGGCCCTTGTCTGTGTGTTTTGAAGGT
1601 GGGTGAACCTCAGAGAATGAACCTGTTATGATTTGGGGTAAGAATCACGTTGGAAAACCTCTCGCAACCAGCACACTAGG
1681 CCTTCTACGGCCATTTCTGTAAGGGGACAGAGCTTAGGTAAAGGCACACACTCATACACACACAACAAAGGGCCCTGCTA
1761 ACTTACTCCTCATGCTGCTTCAGTGACCTTTGTTCATGTCACATTCCTGGCGCTGGAAAAAAAACTCAAAGGTTGATTGG
1841 TTTGCTTTTTCACCTTGGACACATTTGCATTTTACCCACAAGGCAAACAAAAGAATCAGGAAGTAAAAAATGGTTGGGAG
1921 TGGGACAGGTATGGTACCGAATTTTTAATGAACATTGTAAATGAAGAGGCTTGAATGACAGCCCAAATCTAGAGAAGGCA
2001 CTCAGCAAGACCAACCAAAAGAAAAGCTGTGTCGTGGTATGGGGCCACCGTGATCAGCTACCTGGGGCAGGATGCTTCTG
2081 AGACAGGCCTTTCAACTGCTTAGTGTTAGTATGTCCTTGCTTATGAAAATGGGGACACTCATCAGTACGTTAACTACTAA
2161 AGGGGAGATGGTTCTCCAACCACTTCATAAAATATGTATGTTCTGTTGTTCCTAAGGCTTTGATAATATCCTGTACAGAT
2241 TTTGGTTTAGTTTTGCAAATATATTGCTAATAGGTCACTCTTATAGATTATTGCTTGGCCCTTCAAACTCAGTACACACA
2321 CACTGAGGCCCTTTGACCTAGTGTTTTATGGAACTATTTGCTTTGAGAGAAAAAAAAAAGAAAGTTTTTTAAACTCTTTG
2401 CATTTTGGATTTTTTTTCCTAAGATTTTAGGATGAATGTGAAAAAGATGTTAGAATAACAGGAAGACAACTCCAGGGCTG
2481 AGTTTTATCAGCAATTGGGTATAAATTTAAAGACCGCTGTTGCAGGATGGCTCTGAATTCTGTTGTGTCGTCTTTTAAAA
2561 TTTTAATTATTCTCATATAGTACCGAACAGAAAACTCAGTCTAGTTTTAATTTGCCTTTTGTGCTCTAAAGAAGCATTGT
2641 ACATACAACACTAGATCCAGCCCCTCGATTATCTGTTTGGTTTCAAGTGAATGAAAAGATTTCCTGGTAAGATCATTGGA
2721 TTTACAGAATACAAAAATGTACGGGATGGAATAAACCTAGAAAGTGAATGCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU----A-CACGACGAu 5'
            | |||  |||    |  ||||||| 
Target 5' tgCTAAC--TTACTCCTCATGCTGCTt 3'
1756 - 1780 142.00 -10.40
2
miRNA  3' guGUUUGGUA-AUAC---ACGACGAu 5'
            :||| :|| ||||   ||:||:| 
Target 5' caTAAAATATGTATGTTCTGTTGTTc 3'
2186 - 2211 132.00 -13.00
3
miRNA  3' guGUUUGGU---AAU-ACACGACGAu 5'
            :|::||:   ||| | ||||| | 
Target 5' tcTAGGCCGGATTTATTATGCTGGTt 3'
1015 - 1040 124.00 -10.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN6076649 5 COSMIC
COSN20056384 40 COSMIC
COSN26995584 44 COSMIC
COSN30505682 63 COSMIC
COSN26995585 83 COSMIC
COSN20071833 84 COSMIC
COSN31614313 85 COSMIC
COSN30149189 93 COSMIC
COSN32052571 114 COSMIC
COSN31564651 126 COSMIC
COSN31490445 142 COSMIC
COSN31559085 157 COSMIC
COSN23014887 177 COSMIC
COSN1182059 241 COSMIC
COSN1182060 421 COSMIC
COSN17894258 773 COSMIC
COSN25765000 828 COSMIC
COSN23925460 985 COSMIC
COSN28290895 1127 COSMIC
COSN19261168 1200 COSMIC
COSN16663572 1482 COSMIC
COSN8482158 1680 COSMIC
COSN6413303 1841 COSMIC
COSN21672759 2035 COSMIC
COSN30263583 2150 COSMIC
COSN17181566 2231 COSMIC
COSN27551737 2286 COSMIC
COSN32061541 2381 COSMIC
COSN32061749 2381 COSMIC
COSN25485266 2487 COSMIC
COSN1689057 2583 COSMIC
COSN32063393 2763 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs79646818 1 dbSNP
rs151074435 3 dbSNP
rs759055213 5 dbSNP
rs1356332259 6 dbSNP
rs1176451069 10 dbSNP
rs75906555 11 dbSNP
rs1245676234 13 dbSNP
rs549487649 15 dbSNP
rs762635036 17 dbSNP
rs1326783340 18 dbSNP
rs917942605 19 dbSNP
rs763991839 21 dbSNP
rs1360598503 24 dbSNP
rs766737149 25 dbSNP
rs770056385 27 dbSNP
rs142666269 30 dbSNP
rs767574902 34 dbSNP
rs755149585 40 dbSNP
rs200767748 41 dbSNP
rs758656156 43 dbSNP
rs372886223 44 dbSNP
rs1162746351 45 dbSNP
rs747389389 45 dbSNP
rs757698715 46 dbSNP
rs370297321 47 dbSNP
rs1038247506 55 dbSNP
rs1261081320 55 dbSNP
rs1313534998 55 dbSNP
rs1489422935 57 dbSNP
rs1264135456 60 dbSNP
rs1222304097 63 dbSNP
rs1246079287 63 dbSNP
rs1267774298 63 dbSNP
rs1487704446 63 dbSNP
rs1358642852 67 dbSNP
rs1306441775 70 dbSNP
rs1292757183 71 dbSNP
rs1017869737 73 dbSNP
rs1228930897 76 dbSNP
rs1340784700 76 dbSNP
rs963574176 77 dbSNP
rs995003082 84 dbSNP
rs1027175675 91 dbSNP
rs951182141 94 dbSNP
rs773561722 102 dbSNP
rs993950048 105 dbSNP
rs376598119 106 dbSNP
rs1238568421 111 dbSNP
rs1460661183 114 dbSNP
rs758435647 117 dbSNP
rs982904629 118 dbSNP
rs76600093 125 dbSNP
rs555965205 126 dbSNP
rs572801409 127 dbSNP
rs1472866354 133 dbSNP
rs1166787234 134 dbSNP
rs1018907134 138 dbSNP
rs991399227 150 dbSNP
rs753882995 151 dbSNP
rs541701036 160 dbSNP
rs1256679124 162 dbSNP
rs1416713557 187 dbSNP
rs1200053728 188 dbSNP
rs1031152544 190 dbSNP
rs186650955 190 dbSNP
rs375870166 190 dbSNP
rs956771891 190 dbSNP
rs992172369 191 dbSNP
rs1466864199 193 dbSNP
rs1170870873 195 dbSNP
rs918018060 196 dbSNP
rs576760663 200 dbSNP
rs78107781 204 dbSNP
rs1394332905 205 dbSNP
rs924410293 208 dbSNP
rs868774498 209 dbSNP
rs1401043498 210 dbSNP
rs1176012417 227 dbSNP
rs8174 230 dbSNP
rs191385416 231 dbSNP
rs1418856374 232 dbSNP
rs1236943488 233 dbSNP
rs941312241 234 dbSNP
rs146907648 235 dbSNP
rs1261915334 241 dbSNP
rs1449332370 242 dbSNP
rs1346733968 246 dbSNP
rs1256222301 255 dbSNP
rs1238140866 267 dbSNP
rs918396967 268 dbSNP
rs1269703501 272 dbSNP
rs1007559776 278 dbSNP
rs77259362 279 dbSNP
rs899396938 280 dbSNP
rs561354023 285 dbSNP
rs777722279 293 dbSNP
rs1336212829 309 dbSNP
rs561516602 328 dbSNP
rs1322637485 343 dbSNP
rs1173361486 345 dbSNP
rs182908291 348 dbSNP
rs1280716559 351 dbSNP
rs1039409180 358 dbSNP
rs1161007234 360 dbSNP
rs950908138 362 dbSNP
rs1440902117 363 dbSNP
rs904083045 374 dbSNP
rs1184861362 375 dbSNP
rs1443625539 379 dbSNP
rs1001151080 382 dbSNP
rs1031226069 392 dbSNP
rs1351270375 394 dbSNP
rs1287837428 395 dbSNP
rs1192293373 397 dbSNP
rs547281011 398 dbSNP
rs956845381 398 dbSNP
rs1282354077 400 dbSNP
rs570804754 401 dbSNP
rs1342285074 405 dbSNP
rs1335111250 406 dbSNP
rs1478506837 407 dbSNP
rs1194016481 411 dbSNP
rs1385219276 412 dbSNP
rs1420687063 412 dbSNP
rs370951025 412 dbSNP
rs1161913930 415 dbSNP
rs1428124914 415 dbSNP
rs1480341463 417 dbSNP
rs533340194 418 dbSNP
rs1171212794 419 dbSNP
rs1192047991 419 dbSNP
rs1368494757 419 dbSNP
rs375783975 420 dbSNP
rs72182901 420 dbSNP
rs755383307 420 dbSNP
rs1024979533 421 dbSNP
rs1358601721 421 dbSNP
rs1491407256 421 dbSNP
rs201988923 421 dbSNP
rs559296602 421 dbSNP
rs34029747 422 dbSNP
rs5814522 422 dbSNP
rs969540323 422 dbSNP
rs397854372 423 dbSNP
rs868061866 424 dbSNP
rs550042355 426 dbSNP
rs963722263 427 dbSNP
rs973965447 428 dbSNP
rs1476554305 429 dbSNP
rs918511884 429 dbSNP
rs929762690 430 dbSNP
rs1479991451 431 dbSNP
rs1395715114 432 dbSNP
rs112922474 434 dbSNP
rs1401920809 435 dbSNP
rs535926921 436 dbSNP
rs1345098769 438 dbSNP
rs1219432674 441 dbSNP
rs1221865137 452 dbSNP
rs1273488918 454 dbSNP
rs1439019133 465 dbSNP
rs139300523 467 dbSNP
rs942486851 470 dbSNP
rs1463621588 473 dbSNP
rs1035394834 474 dbSNP
rs566239867 479 dbSNP
rs991094862 481 dbSNP
rs535379096 482 dbSNP
rs1267493017 491 dbSNP
rs1422594030 496 dbSNP
rs1479269903 497 dbSNP
rs1192771675 500 dbSNP
rs1232248153 500 dbSNP
rs1200465661 507 dbSNP
rs1379746683 508 dbSNP
rs1052596731 509 dbSNP
rs1456524731 509 dbSNP
rs1199322385 511 dbSNP
rs968617543 515 dbSNP
rs796574896 516 dbSNP
rs979050391 518 dbSNP
rs1368680182 519 dbSNP
rs558421788 520 dbSNP
rs1445163223 523 dbSNP
rs143236956 528 dbSNP
rs934488805 529 dbSNP
rs1446647900 533 dbSNP
rs1357126410 552 dbSNP
rs1177712737 563 dbSNP
rs1414827911 564 dbSNP
rs1013705375 565 dbSNP
rs1156797485 567 dbSNP
rs1441517922 568 dbSNP
rs553329917 570 dbSNP
rs572747771 579 dbSNP
rs1331532848 580 dbSNP
rs969865137 582 dbSNP
rs1482961646 583 dbSNP
rs987609635 587 dbSNP
rs1235963090 596 dbSNP
rs911966556 598 dbSNP
rs780960943 599 dbSNP
rs943375261 604 dbSNP
rs144768802 607 dbSNP
rs899137082 609 dbSNP
rs1238403519 612 dbSNP
rs548405631 612 dbSNP
rs1016781573 615 dbSNP
rs866986854 617 dbSNP
rs763985477 621 dbSNP
rs1240735678 622 dbSNP
rs1376257602 624 dbSNP
rs1290403444 633 dbSNP
rs1304258518 652 dbSNP
rs1489606173 653 dbSNP
rs1296154189 657 dbSNP
rs1421279540 658 dbSNP
rs555851256 659 dbSNP
rs963374103 670 dbSNP
rs1211327808 675 dbSNP
rs1411673161 678 dbSNP
rs1183842038 682 dbSNP
rs1486150164 693 dbSNP
rs1048444936 704 dbSNP
rs1452589721 707 dbSNP
rs1262707257 711 dbSNP
rs1181511491 716 dbSNP
rs539737679 717 dbSNP
rs886643692 718 dbSNP
rs1004107541 720 dbSNP
rs1035425093 723 dbSNP
rs377277071 725 dbSNP
rs1314307150 732 dbSNP
rs1228358757 735 dbSNP
rs1339510660 736 dbSNP
rs895586071 737 dbSNP
rs1159714872 739 dbSNP
rs1401635579 751 dbSNP
rs951314103 754 dbSNP
rs745519990 755 dbSNP
rs1351525820 760 dbSNP
rs1165259194 768 dbSNP
rs1370441825 773 dbSNP
rs912423931 773 dbSNP
rs1475574664 776 dbSNP
rs1456421120 779 dbSNP
rs1191692869 781 dbSNP
rs571472617 788 dbSNP
rs942539152 789 dbSNP
rs1329084443 800 dbSNP
rs975166326 801 dbSNP
rs558391132 808 dbSNP
rs978743135 809 dbSNP
rs892702015 810 dbSNP
rs541476211 825 dbSNP
rs148122860 827 dbSNP
rs753819114 828 dbSNP
rs868410637 829 dbSNP
rs1265715348 832 dbSNP
rs987285038 840 dbSNP
rs905336639 847 dbSNP
rs1002790203 850 dbSNP
rs1399587249 851 dbSNP
rs1193681522 852 dbSNP
rs1467422393 860 dbSNP
rs911704757 861 dbSNP
rs1373826026 863 dbSNP
rs756758471 873 dbSNP
rs764662686 874 dbSNP
rs571906647 881 dbSNP
rs146461949 882 dbSNP
rs376438878 882 dbSNP
rs576566350 905 dbSNP
rs1179885971 909 dbSNP
rs1194740298 909 dbSNP
rs1243034921 913 dbSNP
rs1456957010 915 dbSNP
rs899283987 923 dbSNP
rs993492917 924 dbSNP
rs3743370 931 dbSNP
rs1189731880 940 dbSNP
rs951261627 942 dbSNP
rs920632452 944 dbSNP
rs564391671 947 dbSNP
rs1304107795 954 dbSNP
rs779562000 954 dbSNP
rs986684394 959 dbSNP
rs533046394 968 dbSNP
rs1329437817 970 dbSNP
rs1461675614 971 dbSNP
rs1397549893 980 dbSNP
rs1172149413 981 dbSNP
rs759141637 983 dbSNP
rs1464866012 985 dbSNP
rs1379698237 986 dbSNP
rs1174845660 989 dbSNP
rs1048004369 993 dbSNP
rs1236854727 995 dbSNP
rs1168721031 997 dbSNP
rs1437892933 1002 dbSNP
rs886672268 1002 dbSNP
rs1255053476 1010 dbSNP
rs963871729 1015 dbSNP
rs1484124316 1016 dbSNP
rs1465943427 1023 dbSNP
rs867526531 1024 dbSNP
rs1239118816 1027 dbSNP
rs1351502010 1037 dbSNP
rs550172637 1055 dbSNP
rs1376859264 1056 dbSNP
rs1241286683 1059 dbSNP
rs1056568964 1063 dbSNP
rs1312851096 1068 dbSNP
rs925048293 1074 dbSNP
rs191065197 1076 dbSNP
rs529418506 1082 dbSNP
rs1379063690 1084 dbSNP
rs1012621401 1086 dbSNP
rs1160915674 1089 dbSNP
rs1022668589 1092 dbSNP
rs1367328150 1093 dbSNP
rs1184751426 1094 dbSNP
rs1262854326 1096 dbSNP
rs949074090 1097 dbSNP
rs549486530 1100 dbSNP
rs1202629610 1101 dbSNP
rs1046607276 1108 dbSNP
rs905453527 1118 dbSNP
rs566321584 1119 dbSNP
rs1427981491 1122 dbSNP
rs1205608897 1127 dbSNP
rs1191859204 1128 dbSNP
rs1426014628 1130 dbSNP
rs1478054700 1131 dbSNP
rs747369065 1133 dbSNP
rs1000258416 1137 dbSNP
rs1357177046 1138 dbSNP
rs755445406 1159 dbSNP
rs1467529014 1166 dbSNP
rs1303302679 1170 dbSNP
rs1038315785 1172 dbSNP
rs1383696699 1174 dbSNP
rs1397548844 1177 dbSNP
rs1401846069 1179 dbSNP
rs1218249628 1180 dbSNP
rs562177189 1180 dbSNP
rs993609333 1180 dbSNP
rs1279748268 1181 dbSNP
rs1026412101 1189 dbSNP
rs781761576 1191 dbSNP
rs116531318 1192 dbSNP
rs1301021256 1199 dbSNP
rs1265004423 1202 dbSNP
rs3743369 1205 dbSNP
rs956169639 1206 dbSNP
rs1008791198 1207 dbSNP
rs1018798339 1210 dbSNP
rs1336967798 1216 dbSNP
rs1488027332 1220 dbSNP
rs1009315889 1227 dbSNP
rs16946476 1231 dbSNP
rs1488759510 1237 dbSNP
rs537316551 1245 dbSNP
rs1338681252 1248 dbSNP
rs974857951 1249 dbSNP
rs1431924203 1253 dbSNP
rs777851356 1261 dbSNP
rs1198891598 1278 dbSNP
rs376108897 1279 dbSNP
rs1331089290 1285 dbSNP
rs556126610 1294 dbSNP
rs1462562351 1295 dbSNP
rs1422819710 1299 dbSNP
rs1394519530 1305 dbSNP
rs1169552056 1308 dbSNP
rs182156612 1314 dbSNP
rs535219997 1318 dbSNP
rs964339092 1318 dbSNP
rs1186962693 1319 dbSNP
rs1176750555 1322 dbSNP
rs1200830971 1325 dbSNP
rs920661627 1328 dbSNP
rs952102285 1330 dbSNP
rs1253755584 1338 dbSNP
rs1198053883 1342 dbSNP
rs1316363952 1358 dbSNP
rs75919469 1359 dbSNP
rs907838918 1363 dbSNP
rs939611948 1370 dbSNP
rs569935551 1381 dbSNP
rs987827715 1385 dbSNP
rs1372339901 1391 dbSNP
rs916787650 1394 dbSNP
rs1330148139 1398 dbSNP
rs541237069 1404 dbSNP
rs1355976634 1412 dbSNP
rs1291416024 1417 dbSNP
rs564100224 1424 dbSNP
rs904255958 1425 dbSNP
rs1175258252 1428 dbSNP
rs1302646907 1434 dbSNP
rs938288286 1442 dbSNP
rs1037858124 1444 dbSNP
rs1353651537 1445 dbSNP
rs1238562061 1447 dbSNP
rs577873643 1456 dbSNP
rs187493986 1457 dbSNP
rs1047804750 1459 dbSNP
rs1277012983 1464 dbSNP
rs890551513 1464 dbSNP
rs1008891257 1465 dbSNP
rs1309158364 1467 dbSNP
rs112147159 1472 dbSNP
rs35925747 1472 dbSNP
rs374571116 1472 dbSNP
rs1245166361 1473 dbSNP
rs376829698 1474 dbSNP
rs1039482998 1476 dbSNP
rs1191577598 1483 dbSNP
rs899736926 1486 dbSNP
rs1374795025 1488 dbSNP
rs997139710 1490 dbSNP
rs891427835 1491 dbSNP
rs1160324260 1492 dbSNP
rs1435089578 1499 dbSNP
rs1380439870 1505 dbSNP
rs1156690228 1506 dbSNP
rs1423449757 1513 dbSNP
rs879827764 1519 dbSNP
rs771141284 1521 dbSNP
rs1351236944 1523 dbSNP
rs1032239168 1528 dbSNP
rs1213543750 1532 dbSNP
rs957828881 1533 dbSNP
rs376179575 1534 dbSNP
rs1376542254 1541 dbSNP
rs9302356 1545 dbSNP
rs760438822 1546 dbSNP
rs768494502 1548 dbSNP
rs1227785809 1552 dbSNP
rs776418138 1555 dbSNP
rs771133943 1558 dbSNP
rs983519201 1569 dbSNP
rs1294684153 1571 dbSNP
rs907868011 1582 dbSNP
rs761685722 1587 dbSNP
rs960691160 1589 dbSNP
rs1222497633 1590 dbSNP
rs1257202601 1592 dbSNP
rs549525019 1594 dbSNP
rs1456266811 1596 dbSNP
rs1180505019 1600 dbSNP
rs1238680569 1601 dbSNP
rs1455324909 1602 dbSNP
rs992405145 1604 dbSNP
rs1472206899 1605 dbSNP
rs926308345 1605 dbSNP
rs3169130 1606 dbSNP
rs1404829982 1611 dbSNP
rs948249433 1613 dbSNP
rs1190247861 1616 dbSNP
rs1475757427 1619 dbSNP
rs78641225 1630 dbSNP
rs1487174959 1631 dbSNP
rs1405602024 1634 dbSNP
rs1261811530 1635 dbSNP
rs1220202746 1643 dbSNP
rs925446259 1649 dbSNP
rs935758432 1650 dbSNP
rs1276118581 1656 dbSNP
rs1383704732 1657 dbSNP
rs141881215 1658 dbSNP
rs571702532 1664 dbSNP
rs944810309 1665 dbSNP
rs1008553990 1666 dbSNP
rs1167402686 1678 dbSNP
rs1462210880 1682 dbSNP
rs531244481 1682 dbSNP
rs1039132872 1684 dbSNP
rs550989629 1690 dbSNP
rs7497640 1699 dbSNP
rs1191079053 1700 dbSNP
rs996065653 1700 dbSNP
rs1027908769 1702 dbSNP
rs1254384668 1704 dbSNP
rs192765272 1719 dbSNP
rs751229480 1725 dbSNP
rs1282503036 1726 dbSNP
rs1249250551 1728 dbSNP
rs1005415398 1736 dbSNP
rs1381353826 1738 dbSNP
rs1015003082 1742 dbSNP
rs960724949 1747 dbSNP
rs992102120 1750 dbSNP
rs1373069660 1755 dbSNP
rs1328083103 1758 dbSNP
rs543067893 1760 dbSNP
rs1229159593 1764 dbSNP
rs1277800896 1772 dbSNP
rs755388458 1777 dbSNP
rs1399851252 1782 dbSNP
rs1296599235 1783 dbSNP
rs1200280965 1801 dbSNP
rs1258414593 1810 dbSNP
rs1463877559 1810 dbSNP
rs531418661 1812 dbSNP
rs979676814 1813 dbSNP
rs1193786563 1817 dbSNP
rs1397427437 1817 dbSNP
rs1456890412 1817 dbSNP
rs1441802905 1818 dbSNP
rs1207854412 1824 dbSNP
rs1247989484 1827 dbSNP
rs1238717911 1829 dbSNP
rs906271461 1831 dbSNP
rs139742875 1833 dbSNP
rs3030616 1833 dbSNP
rs35320239 1833 dbSNP
rs925447638 1833 dbSNP
rs1033451379 1834 dbSNP
rs935512266 1834 dbSNP
rs959257069 1836 dbSNP
rs1192575886 1837 dbSNP
rs5814523 1840 dbSNP
rs199764055 1841 dbSNP
rs1420987680 1850 dbSNP
rs781633546 1852 dbSNP
rs1302698834 1854 dbSNP
rs1433236569 1857 dbSNP
rs368682595 1858 dbSNP
rs1027900921 1863 dbSNP
rs1361508318 1867 dbSNP
rs150627226 1868 dbSNP
rs756638986 1869 dbSNP
rs1255045726 1870 dbSNP
rs1208480933 1877 dbSNP
rs912020376 1880 dbSNP
rs1280993180 1881 dbSNP
rs139259402 1890 dbSNP
rs1348422428 1891 dbSNP
rs1332753868 1894 dbSNP
rs944912064 1894 dbSNP
rs944412683 1899 dbSNP
rs2108601 1904 dbSNP
rs557944457 1910 dbSNP
rs1336638501 1911 dbSNP
rs879393013 1913 dbSNP
rs1413330763 1914 dbSNP
rs1338742639 1918 dbSNP
rs931893494 1924 dbSNP
rs140019303 1932 dbSNP
rs1220652328 1935 dbSNP
rs7496880 1939 dbSNP
rs1343961743 1940 dbSNP
rs887640382 1950 dbSNP
rs893707650 1951 dbSNP
rs1004707385 1955 dbSNP
rs1042297147 1958 dbSNP
rs1185291573 1970 dbSNP
rs1476075798 1971 dbSNP
rs1243356952 1974 dbSNP
rs1258022918 1977 dbSNP
rs1294186902 1993 dbSNP
rs557269296 1999 dbSNP
rs1192627785 2002 dbSNP
rs1015446988 2004 dbSNP
rs906334448 2010 dbSNP
rs1286244654 2012 dbSNP
rs1442539528 2016 dbSNP
rs1215237825 2017 dbSNP
rs574115403 2018 dbSNP
rs1033810265 2019 dbSNP
rs1013595577 2021 dbSNP
rs1231633423 2027 dbSNP
rs543057956 2034 dbSNP
rs75350022 2035 dbSNP
rs528587781 2038 dbSNP
rs1374044699 2039 dbSNP
rs894929061 2040 dbSNP
rs1477888324 2041 dbSNP
rs1171408094 2045 dbSNP
rs770963075 2046 dbSNP
rs1032580726 2048 dbSNP
rs1435822467 2048 dbSNP
rs868085243 2050 dbSNP
rs796171761 2051 dbSNP
rs1027345127 2060 dbSNP
rs1418115987 2061 dbSNP
rs988343880 2066 dbSNP
rs1169766626 2067 dbSNP
rs1474272115 2070 dbSNP
rs950931862 2079 dbSNP
rs545131147 2081 dbSNP
rs1330340103 2082 dbSNP
rs1434020253 2087 dbSNP
rs1276601568 2094 dbSNP
rs944446858 2097 dbSNP
rs565514903 2103 dbSNP
rs150132574 2104 dbSNP
rs574939350 2104 dbSNP
rs921636496 2104 dbSNP
rs1228851244 2105 dbSNP
rs1283291072 2105 dbSNP
rs1323386767 2106 dbSNP
rs1355204855 2106 dbSNP
rs1442446641 2113 dbSNP
rs1394777650 2124 dbSNP
rs1216939375 2130 dbSNP
rs1327690713 2131 dbSNP
rs931657524 2133 dbSNP
rs184571998 2134 dbSNP
rs1451452934 2138 dbSNP
rs1197218445 2139 dbSNP
rs1477682602 2141 dbSNP
rs1393193210 2142 dbSNP
rs779179997 2149 dbSNP
rs1455108353 2155 dbSNP
rs1158519367 2160 dbSNP
rs746025890 2161 dbSNP
rs1060205 2164 dbSNP
rs1388831415 2177 dbSNP
rs1060206 2186 dbSNP
rs990097855 2188 dbSNP
rs913208927 2190 dbSNP
rs946067758 2192 dbSNP
rs1371044553 2193 dbSNP
rs1036166788 2195 dbSNP
rs1439634721 2198 dbSNP
rs530303759 2199 dbSNP
rs896291777 2201 dbSNP
rs1355893758 2206 dbSNP
rs1329375017 2212 dbSNP
rs1403755247 2213 dbSNP
rs1325320866 2218 dbSNP
rs1371403773 2222 dbSNP
rs776143048 2227 dbSNP
rs188302937 2230 dbSNP
rs1306951823 2234 dbSNP
rs1176656625 2238 dbSNP
rs1378562564 2247 dbSNP
rs1468858400 2259 dbSNP
rs1240225781 2262 dbSNP
rs565501131 2264 dbSNP
rs534758112 2265 dbSNP
rs1353826276 2272 dbSNP
rs1211223234 2275 dbSNP
rs1045127061 2276 dbSNP
rs557567823 2279 dbSNP
rs939173566 2281 dbSNP
rs1213586494 2284 dbSNP
rs1292493935 2285 dbSNP
rs1221574970 2291 dbSNP
rs905237423 2293 dbSNP
rs1279715143 2301 dbSNP
rs894867908 2313 dbSNP
rs1353274248 2314 dbSNP
rs1314461541 2316 dbSNP
rs1435305896 2318 dbSNP
rs1344529698 2319 dbSNP
rs1000853666 2329 dbSNP
rs376857866 2330 dbSNP
rs956989099 2331 dbSNP
rs1410441957 2332 dbSNP
rs1010197076 2342 dbSNP
rs1019795905 2345 dbSNP
rs1190477925 2352 dbSNP
rs1483905292 2354 dbSNP
rs1004559322 2357 dbSNP
rs868080281 2357 dbSNP
rs1242036384 2358 dbSNP
rs1236875679 2367 dbSNP
rs192120747 2368 dbSNP
rs1332173224 2370 dbSNP
rs1415154366 2370 dbSNP
rs966361000 2370 dbSNP
rs975863108 2370 dbSNP
rs921665954 2375 dbSNP
rs1182632396 2376 dbSNP
rs1361200533 2377 dbSNP
rs996732960 2377 dbSNP
rs202085965 2378 dbSNP
rs146557489 2379 dbSNP
rs374832614 2379 dbSNP
rs748844784 2380 dbSNP
rs1167627795 2381 dbSNP
rs3743366 2381 dbSNP
rs990168539 2384 dbSNP
rs1419433084 2385 dbSNP
rs913320366 2385 dbSNP
rs143544411 2386 dbSNP
rs1402390555 2394 dbSNP
rs1212512530 2395 dbSNP
rs1466902311 2397 dbSNP
rs1274598282 2402 dbSNP
rs981497762 2403 dbSNP
rs927867417 2405 dbSNP
rs1293378706 2408 dbSNP
rs1311427047 2410 dbSNP
rs574004198 2411 dbSNP
rs940626362 2418 dbSNP
rs184717069 2421 dbSNP
rs1036200998 2422 dbSNP
rs917790419 2424 dbSNP
rs1246595304 2425 dbSNP
rs1321379946 2426 dbSNP
rs1440249669 2432 dbSNP
rs796816242 2441 dbSNP
rs949216091 2443 dbSNP
rs916388333 2444 dbSNP
rs367910481 2445 dbSNP
rs1198393409 2446 dbSNP
rs1256492343 2448 dbSNP
rs1391307013 2448 dbSNP
rs78249375 2455 dbSNP
rs886223750 2456 dbSNP
rs1255622828 2457 dbSNP
rs1254526279 2466 dbSNP
rs372454258 2471 dbSNP
rs1210010906 2474 dbSNP
rs1249447007 2475 dbSNP
rs1422103365 2475 dbSNP
rs1001326771 2478 dbSNP
rs1206355119 2483 dbSNP
rs573145383 2496 dbSNP
rs1053797112 2499 dbSNP
rs189384695 2500 dbSNP
rs1009862175 2513 dbSNP
rs1040065866 2514 dbSNP
rs377051656 2516 dbSNP
rs1368828024 2517 dbSNP
rs965564233 2518 dbSNP
rs996415041 2519 dbSNP
rs1477585741 2520 dbSNP
rs565219308 2527 dbSNP
rs1168278312 2534 dbSNP
rs773073012 2546 dbSNP
rs1029679945 2550 dbSNP
rs182026643 2551 dbSNP
rs1463796579 2559 dbSNP
rs1462452293 2560 dbSNP
rs1371717994 2561 dbSNP
rs1302169797 2570 dbSNP
rs1011707584 2571 dbSNP
rs984914042 2573 dbSNP
rs544426511 2575 dbSNP
rs962014590 2582 dbSNP
rs1198916764 2583 dbSNP
rs967473770 2585 dbSNP
rs1339457356 2586 dbSNP
rs1483224670 2597 dbSNP
rs971990665 2598 dbSNP
rs561100586 2600 dbSNP
rs949279363 2602 dbSNP
rs1349923589 2603 dbSNP
rs1044887513 2615 dbSNP
rs1234034622 2618 dbSNP
rs1335408254 2622 dbSNP
rs10573199 2629 dbSNP
rs796851539 2629 dbSNP
rs926413992 2629 dbSNP
rs1309613474 2632 dbSNP
rs958971639 2639 dbSNP
rs1255919737 2641 dbSNP
rs549148540 2644 dbSNP
rs1312628430 2645 dbSNP
rs990714008 2662 dbSNP
rs936770290 2665 dbSNP
rs116123067 2668 dbSNP
rs146273865 2674 dbSNP
rs370036019 2679 dbSNP
rs1361715733 2689 dbSNP
rs559349903 2696 dbSNP
rs1160796737 2706 dbSNP
rs1472810368 2709 dbSNP
rs892501151 2716 dbSNP
rs555973343 2719 dbSNP
rs1041342632 2728 dbSNP
rs1201109669 2734 dbSNP
rs1349995290 2737 dbSNP
rs530838169 2743 dbSNP
rs574232028 2744 dbSNP
rs1330052695 2746 dbSNP
rs1265124462 2767 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | :| | |  ||||||| 
Target 5' acuuACUCCUCA--UGCUGCUu 3'
1 - 20
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000318445.6 | 3UTR | ACUUACUCCUCAUGCUGCUUCAGUGACCUUUGUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.719 5.5e-5 0.534 4.3e-3 23 Click to see details
GSE19783 ER- ER- breast cancer -0.207 3.4e-2 -0.271 7.9e-3 79 Click to see details
GSE19536 Breast cancer -0.183 3.4e-2 -0.208 1.9e-2 100 Click to see details
GSE38226 Liver fibrosis -0.382 4.4e-2 -0.531 6.6e-3 21 Click to see details
GSE32688 Pancreatic cancer 0.301 4.7e-2 0.243 9.0e-2 32 Click to see details
GSE17498 Multiple myeloma -0.226 8.0e-2 -0.108 2.5e-1 40 Click to see details
GSE21849 B cell lymphoma -0.255 9.1e-2 -0.288 6.5e-2 29 Click to see details
GSE17306 Multiple myeloma 0.185 1.0e-1 0.196 8.9e-2 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.242 1.2e-1 0.262 1.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.204 1.7e-1 -0.186 1.9e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.297 1.7e-1 -0.280 1.9e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.202 2.0e-1 0.173 2.3e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.244 2.1e-1 -0.264 1.9e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.14 2.5e-1 -0.097 3.2e-1 25 Click to see details
GSE28544 Breast cancer 0.14 2.6e-1 0.525 4.2e-3 24 Click to see details
GSE21032 Prostate cancer 0.035 3.8e-1 0.033 3.8e-1 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.066 3.9e-1 -0.020 4.7e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.029 3.9e-1 -0.033 3.8e-1 90 Click to see details
GSE21687 Ependynoma primary tumors -0.018 4.4e-1 -0.081 2.6e-1 64 Click to see details
GSE27834 Pluripotent stem cells -0.002 5.0e-1 -0.056 4.2e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.002 5.0e-1 -0.056 4.2e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD 0.788 0.01 0.881 0 8 Click to see details
LUAD 0.535 0.04 0.615 0.02 12 Click to see details
STAD -0.319 0.04 -0.239 0.09 32 Click to see details
BLCA 0.319 0.1 0.366 0.07 18 Click to see details
KIRC -0.141 0.13 -0.093 0.23 68 Click to see details
UCEC -0.222 0.18 -0.289 0.12 19 Click to see details
PCPG -0.833 0.19 -1.000 0.5 3 Click to see details
LUSC 0.147 0.19 0.148 0.19 38 Click to see details
THCA 0.097 0.23 -0.003 0.49 59 Click to see details
PRAD -0.072 0.31 -0.061 0.34 50 Click to see details
PAAD -0.36 0.32 -0.800 0.1 4 Click to see details
CESC -0.476 0.34 -0.500 0.33 3 Click to see details
KIRP 0.074 0.34 0.097 0.3 32 Click to see details
KICH -0.082 0.35 -0.110 0.3 25 Click to see details
LIHC -0.05 0.37 -0.080 0.29 49 Click to see details
CHOL -0.102 0.4 -0.117 0.38 9 Click to see details
HNSC -0.033 0.42 -0.098 0.27 42 Click to see details
ESCA 0.068 0.42 0.355 0.14 11 Click to see details
BRCA 0.002 0.49 -0.009 0.47 84 Click to see details
BRCA 0.002 0.49 -0.009 0.47 84 Click to see details
BRCA 0.002 0.49 -0.009 0.47 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*