miRTarBase - #MIRT256305 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDC42SE2   
Synonyms SPEC2
Description CDC42 small effector 2
Transcript NM_001038702   
Other Transcripts NM_020240   
Expression
Putative miRNA Targets on CDC42SE2
3'UTR of CDC42SE2
(miRNA target sites are highlighted)
>CDC42SE2|NM_001038702|3'UTR
   1 CCCTGGTCCTTTCTCCAAAGTGTGATGGCACCTTGTCCACCCTGTCGTGATTATTCCAGTGAGATGTTACTGTTCTGCTC
  81 TGAAGAAGATACTGTCAGACGAATCCTGCATTTCCTTCAGCTGGCATGCATGCCTTTGGACTCATGGACAGAGTTCTTTG
 161 GATTGTCACTGAATTTTCAATGTTTAATCAGTATGGATCTGATCTTCGCATGATCTTTTTTGTGAATGCTAACACCATTT
 241 TGCAGTTTTTTTTTTCTATTTTAAACATTTTTCTTTTCACTGCCGACCCCCTGCCTTACGATTTTATTGGAAAGCAAGGA
 321 CCTGCTATTATTTGTTAATTTGCCATCATTTATGTATATTTTGGAAGGTATGAGACCCACAAGCACAATGATCATTTTTA
 401 TTTGTTTGTTTGTTTGAAACTTCAGCAGAATAGATATCTGCATGCTTTATGAAGTTGTTGCTTCGGTAAGAGCCCATGGG
 481 ATGCCAGAAATTAACATTTCTTTGCTGCCATGGGCTGATGATGCTGCTATTAGATAAAGTTTAGCTGTGGCACCAAGTCA
 561 CATCATTTTCATAGAAAAAGATTACTTGTAGCTTATTTTAGAAGTATGACCTTTTGGTCTGTTTGATTGATTGATTAGAA
 641 TTGCAATAAAAGAAAAGCTTGCATTCATAAGGCATTCATTCTGTTGTAAATGTTCAATATATTTATTTTGAGAGCAAGGA
 721 CCTGTGGTTGTAAACAGGTGTGGTTACAGGTGTGGTTATGTATCTGAGTGTTGCGGTCATACTCTCCTCCAGTCCAATCC
 801 TGAGCATCTTCATCTTATTAATTAGCTGTTCGTTTCTTTGTGCACTCATTCTTTTATTTTTACTTCTTTTTAATGTTATG
 881 GTATCCAGTTGTTTCCAGTAGCAGTTTCTTGAACTTCTGGCCTGTACTACTAACTGCAGACCTCCAGAGTCACTGGCCTT
 961 TCTGTGCTCTACATATTATTTTAGGGGCCACATCAGTTGCCAAGAGCAACATACATACCGACCTGGCTGAATTATTGCCA
1041 GTGAAAACAACCTGTACGAAGCCTTTGCTCAGGTTCTAAAATATGTTTGTCCTTGCACGAATTTTGTATATTTCAAATAT
1121 TTCTGTAAAGGTTTCTTCTTTTCTGTTAGAGTGTGGTGTTAAGCCAGAGTCAGTGGTTTGTGTTCTCATTAAAATGTTTG
1201 TTTAAATCCTATGTCCAATTCAAGCCTATCTAACTACATTTGGTAGGATTAACATTTCATATAACAAATGGGGCTTAATT
1281 AAAAACTTTAACTTGGAATAAAGGAACAGGGATCACTTTATCTTCTGCCTTCATTTACCTTAGTCCAAGATTCTTGCAAA
1361 ACAGGCAACTGAACAAACATTAGGTTTATGTAGGTAAAATGTGAAAGCATTTCTCCTCCACTTTTTAAAATTTAATTTAC
1441 CCAGTACAGCGGGGCACCAGATTACTTGATCTTTGTATTTTGCAGTTTTGAGCCTTTGTGTCAATCCCAAGCACAGAGAG
1521 GATCTGCCAAGGAAAAACATTTGCATCTTCGGAGTAGACATTTTGCAGTTTGTTTAATAACAACTTCTAAAGTAAGTTGA
1601 ATTCATCCATTGTCACTGATTCACCAAGTGGATGTTGCATTGTGGAATTTGCCTGAGTACTGTTGTCATTCTGCTCAGCC
1681 AGGCACGGTCAGTTTCTTGGCCAGGGACATTGCTATGTGCTGTGTGCAAGCTCTTTAGAAGAGAGATTGGATTTTCTTGG
1761 CATTATCAGCACTCATGCTATTTAGTCTACTTCTATTTTGACTGACTCTTTAAATTAGTACAATTTTTCTACTTGTCATA
1841 TAACTCCTGGAACAATAGTACGGGAAGCCGTGATCCTTTTCCCTGACTCATGATTTTAGTCTTTTTCCAAATCGCTGTTT
1921 TTTTTTTTTTTTTTTTTTTTTTTGCTGCTCCAACGACCAGCATGTGTTGGAGCAGATCTCCATGGTAAGCCAAAAGTGGA
2001 CTTGTCAGCCTATAACTACTCTGCAGCTGCCACTAACTCTACAGGCACAGTAACTACACTTTATACAGGAGCACATGCCA
2081 AAGTGCCTGGGAGGTGCCAATAAAATCAAGAAATAAGAAAACTACAAAAAAAGATACGGTATTAACCTTGGACATAATTT
2161 TTTTTAGGGAGGCAGCTTTCCCACTTTTATAAAGGGGGTTGTAAATCTCAAGAGGTCATTTGTTCCCCATAGCAGCATAT
2241 CTCATTTTTAAATTGAAGCGAATTAAATAGGATTTTACTACTCAACATTCATTATACTGTTAATCTTTGCTGAAATATAT
2321 GCTAACAAATGTTAAGCAAGGGAAACTGAAGACTTAGTCATGTGGATTGTTAGCAGTGATCTGCATTCTGTAAAAGAGGT
2401 ACTTTCCCATGATGTAGGCATGAAGTGGTGCCAGTAAGCGTAGAGCGGAAATGTTGACTTTAGTTAACATTGGGTTTAGC
2481 ATTTCCAGTGCAGCATTATCAGTGGGCCTTTAAAAATACTTCGTAAGTACATTAGCTTTCACTTTGTTGTTAAATTATAG
2561 CAGACTCATTATAGAGAACAAGTTTGCCTTGATTTTGTTTAAAATGACTTCTGCTAAGCACCCAGAAGATAAAATTGACA
2641 TATTTTTATAATATAAGCATACTTTTTTTGTACATTGTGTTCATTCTTGAATAAAATGAGTTCTGTGTTGGCTTGTAGAT
2721 ACTAAAAAGAAAGTATTGATTTTGATTCAATAAATGTTTTCTTTCAATCCTGGTTGGCCTTTCCTTTAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUA----A-UAC-ACGACGAu 5'
               :||||    | ||| ||||||| 
Target 5' ttgctGCCATGGGCTGATGATGCTGCTa 3'
502 - 529 151.00 -16.70
2
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || | ||||||| 
Target 5' tttttttttTTTTTTGCTGCTc 3'
1929 - 1950 149.00 -8.70
3
miRNA  3' guGUUUGGUAAUAC----ACGACGAu 5'
            || :|: |||||    ||:|||| 
Target 5' tgCATGCT-TTATGAAGTTGTTGCTt 3'
439 - 463 141.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30479089 10 COSMIC
COSN30514526 16 COSMIC
COSN30515743 16 COSMIC
COSN31527289 23 COSMIC
COSN30101338 29 COSMIC
COSN30485639 63 COSMIC
COSN30485638 64 COSMIC
COSN30520358 78 COSMIC
COSN22816186 88 COSMIC
COSN30542088 99 COSMIC
COSN20075445 235 COSMIC
COSN16114648 782 COSMIC
COSN28469330 791 COSMIC
COSN9925708 1000 COSMIC
COSN17752366 1021 COSMIC
COSN20180677 1045 COSMIC
COSN1307210 1065 COSMIC
COSN29005875 1065 COSMIC
COSN31536677 1128 COSMIC
COSN26644580 1157 COSMIC
COSN20857041 1273 COSMIC
COSN29612273 1631 COSMIC
COSN29907922 2006 COSMIC
COSN7874733 2031 COSMIC
COSN18758517 2737 COSMIC
COSN15593293 2738 COSMIC
COSN19397696 2816 COSMIC
COSN32056234 3250 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765494600 4 dbSNP
rs577819243 6 dbSNP
rs752495463 9 dbSNP
rs1289207331 14 dbSNP
rs1451026757 16 dbSNP
rs758158100 27 dbSNP
rs1432392884 28 dbSNP
rs1305006254 32 dbSNP
rs777860315 35 dbSNP
rs746900049 36 dbSNP
rs1299869311 37 dbSNP
rs772425477 38 dbSNP
rs977888827 40 dbSNP
rs1382538606 42 dbSNP
rs1216981154 49 dbSNP
rs756845386 50 dbSNP
rs1463715110 51 dbSNP
rs556071927 58 dbSNP
rs1244327181 62 dbSNP
rs1183622834 76 dbSNP
rs1031147194 83 dbSNP
rs537340391 85 dbSNP
rs756913311 87 dbSNP
rs778869043 87 dbSNP
rs890600262 87 dbSNP
rs1319005733 89 dbSNP
rs1170934145 91 dbSNP
rs1424545370 96 dbSNP
rs955235717 99 dbSNP
rs1410525418 108 dbSNP
rs1009160750 119 dbSNP
rs986586561 120 dbSNP
rs1017830526 132 dbSNP
rs1379957192 137 dbSNP
rs1288998272 144 dbSNP
rs1397857569 144 dbSNP
rs1432431549 151 dbSNP
rs964956594 152 dbSNP
rs532170894 153 dbSNP
rs1326191900 163 dbSNP
rs772051109 168 dbSNP
rs1386333292 169 dbSNP
rs911176701 173 dbSNP
rs1427320604 179 dbSNP
rs942622102 181 dbSNP
rs1418866339 182 dbSNP
rs1187230349 186 dbSNP
rs750594449 192 dbSNP
rs1267069010 193 dbSNP
rs1221388847 206 dbSNP
rs974363036 213 dbSNP
rs1490452888 216 dbSNP
rs1293753762 220 dbSNP
rs1225131266 222 dbSNP
rs1306893150 223 dbSNP
rs919951197 247 dbSNP
rs929949745 249 dbSNP
rs1343200905 250 dbSNP
rs1047172802 251 dbSNP
rs907279483 252 dbSNP
rs1366570228 255 dbSNP
rs1295705779 258 dbSNP
rs766203568 263 dbSNP
rs1354504886 266 dbSNP
rs1339458837 270 dbSNP
rs1028057469 282 dbSNP
rs938871405 285 dbSNP
rs1215677630 287 dbSNP
rs753789951 303 dbSNP
rs552387516 304 dbSNP
rs894615826 310 dbSNP
rs576054302 313 dbSNP
rs150510631 317 dbSNP
rs1480245620 319 dbSNP
rs139484089 326 dbSNP
rs1253986607 329 dbSNP
rs903539950 336 dbSNP
rs999582515 337 dbSNP
rs1320793044 339 dbSNP
rs908399574 346 dbSNP
rs373314803 347 dbSNP
rs1303814683 350 dbSNP
rs1390055480 351 dbSNP
rs1396335584 351 dbSNP
rs1299250803 359 dbSNP
rs557194316 361 dbSNP
rs1403981841 364 dbSNP
rs1197011371 365 dbSNP
rs1246217911 377 dbSNP
rs1475745347 378 dbSNP
rs955121016 378 dbSNP
rs567627100 386 dbSNP
rs1251068650 388 dbSNP
rs915860396 392 dbSNP
rs181715615 394 dbSNP
rs557234651 396 dbSNP
rs1203791245 398 dbSNP
rs1346627536 399 dbSNP
rs186180453 403 dbSNP
rs1165425258 407 dbSNP
rs1396400389 408 dbSNP
rs1237253294 409 dbSNP
rs1335546011 409 dbSNP
rs1310521109 410 dbSNP
rs1042751583 411 dbSNP
rs925585144 424 dbSNP
rs1336116947 426 dbSNP
rs1384772974 426 dbSNP
rs963817275 427 dbSNP
rs1404542678 429 dbSNP
rs1157049893 439 dbSNP
rs1326512355 443 dbSNP
rs1364141111 446 dbSNP
rs1432238296 446 dbSNP
rs1275734982 448 dbSNP
rs974035540 450 dbSNP
rs1183611246 451 dbSNP
rs1259140084 461 dbSNP
rs11959672 471 dbSNP
rs573865775 475 dbSNP
rs545264181 476 dbSNP
rs554029172 478 dbSNP
rs139167612 489 dbSNP
rs1009110438 490 dbSNP
rs928581515 494 dbSNP
rs1342336796 497 dbSNP
rs1447681312 498 dbSNP
rs1381834666 499 dbSNP
rs1385988207 501 dbSNP
rs938757884 506 dbSNP
rs1299758302 509 dbSNP
rs530371627 525 dbSNP
rs1422531920 529 dbSNP
rs1384467222 535 dbSNP
rs752247507 538 dbSNP
rs575752081 539 dbSNP
rs1191895455 541 dbSNP
rs1477491899 541 dbSNP
rs1447172421 543 dbSNP
rs1264907041 544 dbSNP
rs368869537 546 dbSNP
rs191016031 547 dbSNP
rs1291590463 550 dbSNP
rs1229371835 553 dbSNP
rs1456134519 557 dbSNP
rs903424494 560 dbSNP
rs999237648 563 dbSNP
rs1226815235 567 dbSNP
rs1341302972 572 dbSNP
rs1280346380 574 dbSNP
rs995479947 575 dbSNP
rs1052052609 576 dbSNP
rs1324018427 578 dbSNP
rs777230048 583 dbSNP
rs1037491688 588 dbSNP
rs1166753110 590 dbSNP
rs1475463161 591 dbSNP
rs1425243741 595 dbSNP
rs1196830273 597 dbSNP
rs1402055003 597 dbSNP
rs1268587205 598 dbSNP
rs1007944648 602 dbSNP
rs1453784892 606 dbSNP
rs1359336924 619 dbSNP
rs1195240061 626 dbSNP
rs1035030880 627 dbSNP
rs544267525 632 dbSNP
rs112836932 636 dbSNP
rs1342670166 639 dbSNP
rs1275175104 640 dbSNP
rs995739880 640 dbSNP
rs1333848250 644 dbSNP
rs1328103990 646 dbSNP
rs1026944561 649 dbSNP
rs1283954793 653 dbSNP
rs915724624 660 dbSNP
rs1468929844 668 dbSNP
rs1429586529 671 dbSNP
rs10478983 673 dbSNP
rs1479213905 681 dbSNP
rs182663998 690 dbSNP
rs756392440 705 dbSNP
rs1458646926 707 dbSNP
rs1284041688 708 dbSNP
rs1260037259 710 dbSNP
rs1201882135 717 dbSNP
rs925647758 717 dbSNP
rs1279614626 719 dbSNP
rs1278798712 720 dbSNP
rs1447397150 720 dbSNP
rs146246139 720 dbSNP
rs928634835 721 dbSNP
rs11953301 740 dbSNP
rs911678636 740 dbSNP
rs1487968979 743 dbSNP
rs560894079 746 dbSNP
rs780488621 749 dbSNP
rs1398653451 750 dbSNP
rs915982511 753 dbSNP
rs781720592 754 dbSNP
rs1158466216 756 dbSNP
rs73253034 756 dbSNP
rs1240591959 758 dbSNP
rs900645708 759 dbSNP
rs564737959 761 dbSNP
rs1238189678 770 dbSNP
rs1049746720 774 dbSNP
rs569003050 777 dbSNP
rs1004872057 782 dbSNP
rs886445908 782 dbSNP
rs924762218 783 dbSNP
rs1470992419 792 dbSNP
rs1156397200 794 dbSNP
rs1359357585 795 dbSNP
rs1245244663 797 dbSNP
rs1434760637 798 dbSNP
rs1314049103 799 dbSNP
rs1405049355 816 dbSNP
rs1394765467 820 dbSNP
rs1333993171 822 dbSNP
rs1379251162 824 dbSNP
rs769120511 826 dbSNP
rs1428184368 830 dbSNP
rs1051934997 834 dbSNP
rs890810527 838 dbSNP
rs1297915599 841 dbSNP
rs1420705295 847 dbSNP
rs1336710070 849 dbSNP
rs1162217061 850 dbSNP
rs779464010 854 dbSNP
rs1423801202 855 dbSNP
rs116072990 856 dbSNP
rs1183711291 857 dbSNP
rs896597182 859 dbSNP
rs1262759537 866 dbSNP
rs1216988098 874 dbSNP
rs1039463343 875 dbSNP
rs551036301 881 dbSNP
rs1289403496 884 dbSNP
rs1221627862 888 dbSNP
rs1012260854 892 dbSNP
rs1314202431 897 dbSNP
rs899579091 898 dbSNP
rs1307266515 903 dbSNP
rs995228668 910 dbSNP
rs1353113220 911 dbSNP
rs116355218 915 dbSNP
rs1401533555 918 dbSNP
rs1362830526 921 dbSNP
rs951218422 926 dbSNP
rs373438200 931 dbSNP
rs970260590 945 dbSNP
rs1350999815 949 dbSNP
rs553446640 960 dbSNP
rs978703941 963 dbSNP
rs1035590316 970 dbSNP
rs1033381525 972 dbSNP
rs1199793032 982 dbSNP
rs960059619 984 dbSNP
rs1194642698 989 dbSNP
rs1266474144 990 dbSNP
rs1478954595 990 dbSNP
rs879171434 995 dbSNP
rs1488736451 996 dbSNP
rs1267157025 997 dbSNP
rs1439274010 1004 dbSNP
rs1201739015 1007 dbSNP
rs988505151 1009 dbSNP
rs911542860 1017 dbSNP
rs566883573 1018 dbSNP
rs1343297566 1019 dbSNP
rs1281728338 1020 dbSNP
rs944458296 1040 dbSNP
rs186031595 1043 dbSNP
rs1295799421 1047 dbSNP
rs969209030 1050 dbSNP
rs112848390 1055 dbSNP
rs1460970825 1055 dbSNP
rs796552707 1055 dbSNP
rs978833255 1056 dbSNP
rs1427494841 1057 dbSNP
rs1197825462 1064 dbSNP
rs1433557509 1065 dbSNP
rs1238217689 1066 dbSNP
rs930769691 1066 dbSNP
rs1324198413 1068 dbSNP
rs924786884 1068 dbSNP
rs769408094 1072 dbSNP
rs1200017140 1074 dbSNP
rs886718088 1077 dbSNP
rs1375422157 1079 dbSNP
rs934821235 1087 dbSNP
rs1233606491 1092 dbSNP
rs773242845 1094 dbSNP
rs1303931610 1096 dbSNP
rs747289513 1098 dbSNP
rs896460277 1099 dbSNP
rs1332073107 1109 dbSNP
rs943746975 1110 dbSNP
rs1039348175 1116 dbSNP
rs1397658030 1119 dbSNP
rs1449408496 1127 dbSNP
rs1172206571 1128 dbSNP
rs1466794673 1133 dbSNP
rs770586794 1134 dbSNP
rs1438963647 1135 dbSNP
rs144104106 1135 dbSNP
rs1380866858 1137 dbSNP
rs1179900085 1138 dbSNP
rs1459588651 1141 dbSNP
rs1000471142 1142 dbSNP
rs1441911781 1154 dbSNP
rs567473459 1154 dbSNP
rs1303572558 1155 dbSNP
rs1310458976 1157 dbSNP
rs373022226 1160 dbSNP
rs191230184 1164 dbSNP
rs1484054131 1166 dbSNP
rs146473349 1170 dbSNP
rs1232449762 1178 dbSNP
rs1251780717 1184 dbSNP
rs1310631866 1187 dbSNP
rs1032833339 1192 dbSNP
rs530721411 1196 dbSNP
rs1319765934 1198 dbSNP
rs1333646110 1200 dbSNP
rs1196582995 1203 dbSNP
rs1418880774 1205 dbSNP
rs546641271 1205 dbSNP
rs1187680762 1210 dbSNP
rs550237983 1210 dbSNP
rs550311277 1210 dbSNP
rs775355336 1210 dbSNP
rs1468692065 1243 dbSNP
rs1048122350 1244 dbSNP
rs1214813784 1245 dbSNP
rs1264667127 1256 dbSNP
rs1287258044 1260 dbSNP
rs1219402942 1266 dbSNP
rs886966972 1267 dbSNP
rs759448386 1274 dbSNP
rs765249522 1275 dbSNP
rs1004037948 1276 dbSNP
rs201241569 1277 dbSNP
rs764962011 1277 dbSNP
rs1342428187 1278 dbSNP
rs1276538176 1282 dbSNP
rs1035639225 1286 dbSNP
rs1303702064 1296 dbSNP
rs1399692017 1300 dbSNP
rs1360905136 1306 dbSNP
rs921719084 1310 dbSNP
rs930395249 1313 dbSNP
rs1389955663 1315 dbSNP
rs368452482 1317 dbSNP
rs897537514 1319 dbSNP
rs775579332 1331 dbSNP
rs1023394134 1333 dbSNP
rs968718836 1337 dbSNP
rs1400009930 1338 dbSNP
rs762300211 1339 dbSNP
rs948094348 1340 dbSNP
rs1045065205 1342 dbSNP
rs1295439971 1344 dbSNP
rs1358546804 1345 dbSNP
rs1365625576 1351 dbSNP
rs1256293087 1354 dbSNP
rs1218217472 1357 dbSNP
rs1386236545 1371 dbSNP
rs903965241 1375 dbSNP
rs183042086 1381 dbSNP
rs956236603 1382 dbSNP
rs1388502663 1385 dbSNP
rs1216722524 1386 dbSNP
rs1169386405 1387 dbSNP
rs1257246423 1391 dbSNP
rs1465781220 1393 dbSNP
rs1425353087 1398 dbSNP
rs1477246903 1399 dbSNP
rs1335168494 1400 dbSNP
rs1054714709 1402 dbSNP
rs1453877598 1403 dbSNP
rs1236387644 1407 dbSNP
rs539948566 1413 dbSNP
rs1263272077 1421 dbSNP
rs1487885128 1427 dbSNP
rs1010167702 1429 dbSNP
rs1018835860 1429 dbSNP
rs140214993 1432 dbSNP
rs536524925 1432 dbSNP
rs538999567 1432 dbSNP
rs1264667468 1433 dbSNP
rs996281749 1436 dbSNP
rs867830436 1437 dbSNP
rs912021866 1448 dbSNP
rs1401943493 1449 dbSNP
rs951902691 1450 dbSNP
rs1479122267 1456 dbSNP
rs1413604165 1457 dbSNP
rs1424862191 1458 dbSNP
rs984526939 1458 dbSNP
rs765395436 1459 dbSNP
rs1379012551 1463 dbSNP
rs1178020838 1466 dbSNP
rs908056851 1467 dbSNP
rs763688707 1491 dbSNP
rs188426720 1493 dbSNP
rs1424723352 1500 dbSNP
rs1442104106 1507 dbSNP
rs943632524 1507 dbSNP
rs570333489 1509 dbSNP
rs1240869908 1512 dbSNP
rs925285097 1526 dbSNP
rs1281962299 1528 dbSNP
rs936765679 1534 dbSNP
rs1359401953 1535 dbSNP
rs1052497327 1537 dbSNP
rs1436972108 1538 dbSNP
rs1289593322 1541 dbSNP
rs766927094 1542 dbSNP
rs1158555276 1543 dbSNP
rs1440905608 1548 dbSNP
rs974995096 1554 dbSNP
rs1410215682 1558 dbSNP
rs1180227244 1561 dbSNP
rs1472564976 1569 dbSNP
rs1362520426 1570 dbSNP
rs1398081883 1572 dbSNP
rs1487184108 1577 dbSNP
rs1285114324 1581 dbSNP
rs751122823 1584 dbSNP
rs192139261 1585 dbSNP
rs1229768724 1589 dbSNP
rs1048649157 1593 dbSNP
rs886856866 1596 dbSNP
rs756910309 1597 dbSNP
rs939871915 1602 dbSNP
rs149112205 1607 dbSNP
rs895615277 1617 dbSNP
rs1338878675 1618 dbSNP
rs1216060547 1619 dbSNP
rs1287558496 1620 dbSNP
rs1486984510 1621 dbSNP
rs543194620 1622 dbSNP
rs767197832 1622 dbSNP
rs1263041740 1624 dbSNP
rs1162701131 1625 dbSNP
rs1029088019 1626 dbSNP
rs996083038 1626 dbSNP
rs1012851535 1630 dbSNP
rs532852220 1631 dbSNP
rs951710941 1631 dbSNP
rs1262153243 1642 dbSNP
rs1288649858 1642 dbSNP
rs1412076579 1646 dbSNP
rs1489196397 1652 dbSNP
rs1044295660 1656 dbSNP
rs1423521977 1658 dbSNP
rs778362843 1661 dbSNP
rs961761141 1662 dbSNP
rs1277911085 1664 dbSNP
rs904545611 1665 dbSNP
rs1292287479 1667 dbSNP
rs1000187579 1673 dbSNP
rs1436470430 1676 dbSNP
rs34794633 1676 dbSNP
rs1417893682 1682 dbSNP
rs376469755 1683 dbSNP
rs918067268 1683 dbSNP
rs1032211905 1684 dbSNP
rs1376044140 1688 dbSNP
rs1357108853 1689 dbSNP
rs754198072 1691 dbSNP
rs1008903388 1692 dbSNP
rs1300931902 1696 dbSNP
rs562672574 1698 dbSNP
rs1190526399 1715 dbSNP
rs1488791888 1723 dbSNP
rs925285504 1724 dbSNP
rs1196236514 1732 dbSNP
rs1378153343 1736 dbSNP
rs1019084909 1738 dbSNP
rs541037390 1738 dbSNP
rs531510262 1740 dbSNP
rs1310948353 1744 dbSNP
rs1309620543 1756 dbSNP
rs975425509 1757 dbSNP
rs1299705752 1759 dbSNP
rs1219113964 1766 dbSNP
rs201181367 1766 dbSNP
rs1327938810 1768 dbSNP
rs546659340 1783 dbSNP
rs1280383084 1784 dbSNP
rs952521427 1784 dbSNP
rs1375686616 1786 dbSNP
rs983798618 1793 dbSNP
rs1212848774 1794 dbSNP
rs566471744 1798 dbSNP
rs1396830148 1806 dbSNP
rs1176164653 1818 dbSNP
rs183131220 1818 dbSNP
rs550032233 1825 dbSNP
rs944093503 1825 dbSNP
rs1179527472 1829 dbSNP
rs1254581193 1830 dbSNP
rs1040248049 1832 dbSNP
rs745688436 1852 dbSNP
rs530178830 1867 dbSNP
rs1438037720 1868 dbSNP
rs767391665 1875 dbSNP
rs1238680801 1881 dbSNP
rs939757458 1882 dbSNP
rs1310123530 1886 dbSNP
rs1393324426 1889 dbSNP
rs1400368539 1889 dbSNP
rs1301988360 1891 dbSNP
rs780104310 1893 dbSNP
rs1377119192 1896 dbSNP
rs1156759233 1900 dbSNP
rs1158164635 1902 dbSNP
rs931898215 1906 dbSNP
rs187759485 1908 dbSNP
rs887687784 1909 dbSNP
rs1005918681 1916 dbSNP
rs1200742079 1918 dbSNP
rs77206401 1918 dbSNP
rs1358395700 1920 dbSNP
rs1215042002 1924 dbSNP
rs1353655029 1935 dbSNP
rs192591290 1940 dbSNP
rs1241298754 1941 dbSNP
rs1338858756 1942 dbSNP
rs1312277172 1943 dbSNP
rs547836056 1953 dbSNP
rs1374250673 1957 dbSNP
rs1025112260 1959 dbSNP
rs948516407 1961 dbSNP
rs118046582 1964 dbSNP
rs184262236 1968 dbSNP
rs1221436105 1969 dbSNP
rs1159728786 1973 dbSNP
rs1277069943 1975 dbSNP
rs1367442293 1978 dbSNP
rs1187782232 1990 dbSNP
rs538423327 1995 dbSNP
rs1053133452 2002 dbSNP
rs554896729 2004 dbSNP
rs988171401 2004 dbSNP
rs891769503 2011 dbSNP
rs1263054944 2025 dbSNP
rs142243976 2028 dbSNP
rs1008955770 2030 dbSNP
rs775296304 2035 dbSNP
rs1018968681 2038 dbSNP
rs1354322272 2040 dbSNP
rs964878643 2048 dbSNP
rs1234097223 2049 dbSNP
rs1337265828 2053 dbSNP
rs569526186 2057 dbSNP
rs1240378870 2060 dbSNP
rs1399168933 2069 dbSNP
rs574695033 2079 dbSNP
rs1178242800 2084 dbSNP
rs370858151 2087 dbSNP
rs944114898 2090 dbSNP
rs1163362636 2091 dbSNP
rs1462645006 2093 dbSNP
rs189210857 2093 dbSNP
rs1168901792 2096 dbSNP
rs1424437291 2099 dbSNP
rs1374055643 2101 dbSNP
rs1466049471 2102 dbSNP
rs17167539 2105 dbSNP
rs931871941 2116 dbSNP
rs36095006 2118 dbSNP
rs746891452 2118 dbSNP
rs1050677004 2122 dbSNP
rs747110338 2126 dbSNP
rs1397836041 2127 dbSNP
rs776715711 2128 dbSNP
rs1256393982 2129 dbSNP
rs908218218 2130 dbSNP
rs1339802434 2136 dbSNP
rs1271753462 2140 dbSNP
rs1230922401 2148 dbSNP
rs1330467613 2149 dbSNP
rs1323728541 2150 dbSNP
rs887729096 2151 dbSNP
rs538561175 2155 dbSNP
rs151220144 2161 dbSNP
rs897467900 2163 dbSNP
rs1410232823 2164 dbSNP
rs1013296866 2167 dbSNP
rs1273711961 2168 dbSNP
rs1345482366 2175 dbSNP
rs1377561434 2181 dbSNP
rs771157817 2186 dbSNP
rs1455632854 2188 dbSNP
rs777046725 2194 dbSNP
rs1219780554 2199 dbSNP
rs916989114 2203 dbSNP
rs948593808 2211 dbSNP
rs1198210051 2213 dbSNP
rs1260459047 2216 dbSNP
rs1044238923 2219 dbSNP
rs904940253 2226 dbSNP
rs34223004 2227 dbSNP
rs1344138131 2236 dbSNP
rs1304066840 2238 dbSNP
rs1316387476 2238 dbSNP
rs1198287248 2241 dbSNP
rs1290799828 2252 dbSNP
rs571402495 2259 dbSNP
rs935946787 2260 dbSNP
rs545508128 2261 dbSNP
rs1355943572 2263 dbSNP
rs891822848 2274 dbSNP
rs944698347 2278 dbSNP
rs1478138678 2279 dbSNP
rs10041053 2281 dbSNP
rs1421209697 2285 dbSNP
rs140464706 2292 dbSNP
rs1224464815 2294 dbSNP
rs1020972557 2318 dbSNP
rs1392497725 2320 dbSNP
rs996622870 2321 dbSNP
rs1178121056 2330 dbSNP
rs150397736 2331 dbSNP
rs1027828523 2332 dbSNP
rs976744960 2341 dbSNP
rs1185775550 2344 dbSNP
rs1403216370 2346 dbSNP
rs1280847833 2347 dbSNP
rs138412867 2348 dbSNP
rs1284627624 2351 dbSNP
rs1360589708 2353 dbSNP
rs142396887 2357 dbSNP
rs1015165709 2360 dbSNP
rs146782255 2361 dbSNP
rs1355191351 2371 dbSNP
rs540678248 2376 dbSNP
rs1313900188 2377 dbSNP
rs373146395 2377 dbSNP
rs992485701 2378 dbSNP
rs1024099823 2381 dbSNP
rs1410334188 2383 dbSNP
rs1161660982 2384 dbSNP
rs918926688 2388 dbSNP
rs1257917560 2391 dbSNP
rs1189826195 2393 dbSNP
rs1487235815 2397 dbSNP
rs1226805541 2399 dbSNP
rs1216482105 2402 dbSNP
rs1318173233 2402 dbSNP
rs969841268 2420 dbSNP
rs1287179422 2425 dbSNP
rs949096354 2426 dbSNP
rs1488617496 2431 dbSNP
rs139198093 2432 dbSNP
rs761288243 2442 dbSNP
rs192801270 2443 dbSNP
rs1487911019 2452 dbSNP
rs935813685 2459 dbSNP
rs1432175331 2462 dbSNP
rs988715962 2463 dbSNP
rs1369976935 2470 dbSNP
rs913141859 2473 dbSNP
rs944745970 2483 dbSNP
rs1021255302 2490 dbSNP
rs17167550 2496 dbSNP
rs1418587164 2502 dbSNP
rs900471016 2504 dbSNP
rs998214523 2508 dbSNP
rs111490735 2509 dbSNP
rs1049590918 2515 dbSNP
rs887977046 2518 dbSNP
rs1274655357 2519 dbSNP
rs909055214 2520 dbSNP
rs1316426512 2521 dbSNP
rs1295367660 2525 dbSNP
rs538107224 2527 dbSNP
rs1364728432 2529 dbSNP
rs1015219719 2531 dbSNP
rs188662762 2532 dbSNP
rs1440272036 2537 dbSNP
rs1395400578 2538 dbSNP
rs1464297954 2539 dbSNP
rs971869720 2540 dbSNP
rs1242883354 2549 dbSNP
rs896738562 2551 dbSNP
rs534158645 2560 dbSNP
rs1242470852 2574 dbSNP
rs1254392695 2588 dbSNP
rs1196334269 2589 dbSNP
rs1480126936 2593 dbSNP
rs949293419 2594 dbSNP
rs1205677450 2595 dbSNP
rs1309712049 2598 dbSNP
rs1046090315 2599 dbSNP
rs1283937694 2608 dbSNP
rs145919630 2615 dbSNP
rs926260811 2615 dbSNP
rs1338203528 2616 dbSNP
rs1013811196 2630 dbSNP
rs1023990354 2631 dbSNP
rs970103543 2633 dbSNP
rs1200953123 2638 dbSNP
rs1298463790 2642 dbSNP
rs1463326014 2650 dbSNP
rs773253078 2651 dbSNP
rs979898310 2651 dbSNP
rs1357270127 2652 dbSNP
rs149403329 2656 dbSNP
rs1053905922 2657 dbSNP
rs1258028774 2660 dbSNP
rs754116129 2660 dbSNP
rs1440415060 2661 dbSNP
rs4146144 2664 dbSNP
rs1176270243 2666 dbSNP
rs1033161388 2669 dbSNP
rs143836802 2671 dbSNP
rs1238458614 2672 dbSNP
rs534155312 2678 dbSNP
rs377271406 2679 dbSNP
rs1278687080 2680 dbSNP
rs1210743764 2685 dbSNP
rs34673749 2686 dbSNP
rs1349262070 2688 dbSNP
rs1282491034 2692 dbSNP
rs1156374926 2695 dbSNP
rs1236974166 2697 dbSNP
rs148160714 2698 dbSNP
rs893555627 2699 dbSNP
rs944636283 2700 dbSNP
rs975945856 2704 dbSNP
rs1312088227 2705 dbSNP
rs150836250 2706 dbSNP
rs1377217826 2708 dbSNP
rs901454515 2709 dbSNP
rs921975770 2709 dbSNP
rs1292170554 2710 dbSNP
rs1173600990 2711 dbSNP
rs998410610 2720 dbSNP
rs931958883 2723 dbSNP
rs1187695981 2724 dbSNP
rs1260219733 2725 dbSNP
rs1486244499 2725 dbSNP
rs1028343375 2726 dbSNP
rs1005642190 2727 dbSNP
rs1017467728 2727 dbSNP
rs1052684466 2727 dbSNP
rs1165275890 2727 dbSNP
rs1233680525 2727 dbSNP
rs1296255928 2727 dbSNP
rs1357208178 2727 dbSNP
rs1381630747 2727 dbSNP
rs1384998386 2727 dbSNP
rs1454204881 2727 dbSNP
rs1456008652 2727 dbSNP
rs71000990 2727 dbSNP
rs71581321 2727 dbSNP
rs954143234 2727 dbSNP
rs909281820 2728 dbSNP
rs940879476 2729 dbSNP
rs1336464613 2730 dbSNP
rs1377982899 2731 dbSNP
rs1036535649 2732 dbSNP
rs1157945835 2732 dbSNP
rs1449277301 2733 dbSNP
rs961437337 2733 dbSNP
rs1467261760 2734 dbSNP
rs536417124 2734 dbSNP
rs1013863478 2735 dbSNP
rs1234195094 2735 dbSNP
rs1045705054 2736 dbSNP
rs1406599184 2736 dbSNP
rs1326968687 2737 dbSNP
rs60194535 2737 dbSNP
rs1291601 2738 dbSNP
rs1438297272 2738 dbSNP
rs867178891 2739 dbSNP
rs905555777 2740 dbSNP
rs1233886639 2741 dbSNP
rs1257648897 2742 dbSNP
rs1001598875 2743 dbSNP
rs570498237 2744 dbSNP
rs1032799228 2745 dbSNP
rs957349437 2746 dbSNP
rs1470009478 2747 dbSNP
rs982411148 2748 dbSNP
rs926319301 2749 dbSNP
rs1252985345 2753 dbSNP
rs1336735473 2753 dbSNP
rs539408462 2753 dbSNP
rs1252910961 2754 dbSNP
rs1419812561 2755 dbSNP
rs1176334034 2757 dbSNP
rs1237033596 2758 dbSNP
rs1442591510 2762 dbSNP
rs141161999 2764 dbSNP
rs1327196627 2770 dbSNP
rs1200223565 2771 dbSNP
rs1409749243 2774 dbSNP
rs1020090533 2776 dbSNP
rs185919275 2779 dbSNP
rs1433448390 2789 dbSNP
rs1176246022 2804 dbSNP
rs1401467609 2808 dbSNP
rs1467394944 2819 dbSNP
rs1329482413 2820 dbSNP
rs1231388818 2822 dbSNP
rs965829766 2822 dbSNP
rs1438162206 2823 dbSNP
rs915018520 2824 dbSNP
rs542119838 2831 dbSNP
rs3488 2832 dbSNP
rs953440424 2833 dbSNP
rs901318617 2834 dbSNP
rs1278580906 2835 dbSNP
rs1186840716 2836 dbSNP
rs189211167 2841 dbSNP
rs547872861 2841 dbSNP
rs934262825 2846 dbSNP
rs1278621920 2851 dbSNP
rs753102529 2855 dbSNP
rs1375373832 2866 dbSNP
rs1196399007 2873 dbSNP
rs1416225128 2876 dbSNP
rs758903692 2877 dbSNP
rs940768317 2882 dbSNP
rs1250360859 2887 dbSNP
rs1488592584 2890 dbSNP
rs1211157656 2891 dbSNP
rs1036423664 2895 dbSNP
rs781601007 2899 dbSNP
rs572254183 2902 dbSNP
rs1479777709 2904 dbSNP
rs1050397518 2920 dbSNP
rs1199256721 2920 dbSNP
rs1444760992 2921 dbSNP
rs1282997283 2925 dbSNP
rs1352410059 2927 dbSNP
rs182123555 2927 dbSNP
rs778189091 2930 dbSNP
rs1424793622 2932 dbSNP
rs1478984807 2934 dbSNP
rs1168825450 2935 dbSNP
rs1354205733 2941 dbSNP
rs1458601142 2942 dbSNP
rs949517346 2947 dbSNP
rs1045353546 2948 dbSNP
rs1388597266 2959 dbSNP
rs905438966 2963 dbSNP
rs1298688075 2964 dbSNP
rs1474751277 2965 dbSNP
rs1183498182 2967 dbSNP
rs1342163301 2967 dbSNP
rs763436860 2967 dbSNP
rs1216619237 2973 dbSNP
rs1001082514 2984 dbSNP
rs994182004 2993 dbSNP
rs1215885489 3012 dbSNP
rs1054534930 3019 dbSNP
rs1270866585 3020 dbSNP
rs892778550 3035 dbSNP
rs1026120878 3040 dbSNP
rs970503211 3042 dbSNP
rs1360507555 3043 dbSNP
rs981962253 3044 dbSNP
rs1431568807 3045 dbSNP
rs1390997821 3053 dbSNP
rs1034054021 3057 dbSNP
rs755719581 3065 dbSNP
rs1222444386 3069 dbSNP
rs1166685134 3070 dbSNP
rs1426608532 3073 dbSNP
rs779187799 3075 dbSNP
rs1009962048 3081 dbSNP
rs1214376203 3083 dbSNP
rs1418698151 3089 dbSNP
rs1187092542 3092 dbSNP
rs989580985 3093 dbSNP
rs1192572692 3095 dbSNP
rs757420806 3098 dbSNP
rs781509814 3100 dbSNP
rs185911641 3105 dbSNP
rs1272908431 3109 dbSNP
rs1185212459 3113 dbSNP
rs1419233766 3115 dbSNP
rs1367409491 3117 dbSNP
rs1301386630 3119 dbSNP
rs1440387399 3120 dbSNP
rs1372019979 3123 dbSNP
rs1295575484 3133 dbSNP
rs945126356 3146 dbSNP
rs1353753474 3153 dbSNP
rs1171017600 3157 dbSNP
rs1431584693 3161 dbSNP
rs1392668623 3163 dbSNP
rs1028950431 3164 dbSNP
rs953421491 3165 dbSNP
rs1013734515 3174 dbSNP
rs1269017022 3176 dbSNP
rs1272672322 3181 dbSNP
rs1479850772 3183 dbSNP
rs934186717 3184 dbSNP
rs79636202 3187 dbSNP
rs1344970577 3191 dbSNP
rs1424039927 3200 dbSNP
rs909223067 3206 dbSNP
rs1233667866 3207 dbSNP
rs1049921329 3209 dbSNP
rs890056501 3216 dbSNP
rs1298556684 3223 dbSNP
rs28580458 3225 dbSNP
rs548532441 3226 dbSNP
rs994212667 3228 dbSNP
rs1434787050 3229 dbSNP
rs1024380621 3235 dbSNP
rs779870111 3250 dbSNP
rs917997973 3251 dbSNP
rs949570052 3252 dbSNP
rs1003811726 3256 dbSNP
rs139207207 3257 dbSNP
rs1256005779 3258 dbSNP
rs376009858 3268 dbSNP
rs1483599039 3269 dbSNP
rs1257862568 3271 dbSNP
rs1237092691 3273 dbSNP
rs1316568559 3274 dbSNP
rs1288672989 3293 dbSNP
rs749087557 3297 dbSNP
rs959566622 3301 dbSNP
rs1353394769 3302 dbSNP
rs936929920 3303 dbSNP
rs1415366446 3304 dbSNP
rs1240304548 3307 dbSNP
rs1287535138 3310 dbSNP
rs531747342 3311 dbSNP
rs989389607 3312 dbSNP
rs768626157 3316 dbSNP
rs1473762195 3317 dbSNP
rs1416193363 3332 dbSNP
rs892829656 3332 dbSNP
rs1241895255 3333 dbSNP
rs1187804835 3338 dbSNP
rs1424924323 3340 dbSNP
rs142406054 3341 dbSNP
rs1041483665 3355 dbSNP
rs1203470492 3359 dbSNP
rs901599639 3360 dbSNP
rs1021972334 3365 dbSNP
rs1183836678 3366 dbSNP
rs774221731 3367 dbSNP
rs1332374033 3377 dbSNP
rs1292483405 3380 dbSNP
rs1245370360 3384 dbSNP
rs997236526 3385 dbSNP
rs1029251735 3386 dbSNP
rs879057592 3389 dbSNP
rs1381160327 3395 dbSNP
rs1385106984 3398 dbSNP
rs888930662 3408 dbSNP
rs73253039 3416 dbSNP
rs1016175240 3428 dbSNP
rs962070789 3430 dbSNP
rs145968534 3433 dbSNP
rs1164674890 3444 dbSNP
rs1382238713 3444 dbSNP
rs1458806443 3449 dbSNP
rs757386085 3462 dbSNP
rs1370696363 3464 dbSNP
rs1191739506 3469 dbSNP
rs1158204983 3472 dbSNP
rs190741738 3473 dbSNP
rs771583736 3487 dbSNP
rs571036163 3489 dbSNP
rs1272253062 3496 dbSNP
rs970808030 3499 dbSNP
rs772801188 3501 dbSNP
rs1210222234 3503 dbSNP
rs1358288824 3505 dbSNP
rs1249534492 3510 dbSNP
rs1226651287 3515 dbSNP
rs1200782426 3521 dbSNP
rs539116744 3523 dbSNP
rs1299198356 3525 dbSNP
rs768094292 3538 dbSNP
rs1369794669 3539 dbSNP
rs1438187179 3539 dbSNP
rs1300842016 3540 dbSNP
rs1323878538 3542 dbSNP
rs955131356 3545 dbSNP
rs980847662 3553 dbSNP
rs986059416 3558 dbSNP
rs1381640869 3560 dbSNP
rs1447045522 3564 dbSNP
rs911363959 3565 dbSNP
rs748966637 3570 dbSNP
rs1170583308 3575 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUA----A-UAC-ACGACGAu 5'
               :||||    | ||| ||||||| 
Target 5' uugcuGCCAUGGGCUGAUGAUGCUGCUa 3'
6 - 33
2
miRNA  3' guguuugguAAUACACGacgau 5'
                   || | |||     
Target 5' --------uUUCUUUGCugcca 3'
1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000360515.3 | 3UTR | UUUCUUUGCUGCCAUGGGCUGAUGAUGCUGCUAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.78 2.5e-5 0.872 2.7e-7 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.626 7.0e-4 0.393 3.2e-2 23 Click to see details
GSE21032 Prostate cancer 0.318 1.7e-3 0.257 9.5e-3 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.461 1.0e-2 0.454 1.1e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.428 1.8e-2 0.458 1.2e-2 24 Click to see details
GSE19536 Breast cancer -0.147 7.2e-2 -0.084 2.0e-1 100 Click to see details
GSE19783 ER- ER- breast cancer -0.154 8.8e-2 -0.111 1.7e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.278 8.9e-2 -0.205 1.6e-1 25 Click to see details
GSE38226 Liver fibrosis 0.252 1.4e-1 0.203 1.9e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.196 1.4e-1 0.147 2.1e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.322 1.4e-1 -0.220 2.4e-1 13 Click to see details
GSE21687 Ependynoma primary tumors 0.134 1.5e-1 0.214 4.5e-2 64 Click to see details
GSE28544 Breast cancer -0.205 1.7e-1 -0.570 1.8e-3 24 Click to see details
GSE27834 Pluripotent stem cells 0.253 1.7e-1 0.338 1.0e-1 16 Click to see details
GSE17306 Multiple myeloma -0.136 1.8e-1 -0.144 1.6e-1 49 Click to see details
GSE21849 B cell lymphoma 0.165 2.0e-1 0.163 2.0e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.135 2.9e-1 0.265 1.3e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.04 3.5e-1 -0.102 1.7e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.12 3.6e-1 -0.070 4.1e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.12 3.6e-1 -0.070 4.1e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.588 0.01 0.564 0.01 18 Click to see details
STAD 0.413 0.01 0.453 0 32 Click to see details
PAAD 0.935 0.03 0.400 0.3 4 Click to see details
KIRC 0.173 0.08 0.152 0.11 68 Click to see details
HNSC -0.2 0.1 -0.181 0.13 42 Click to see details
CHOL -0.425 0.13 -0.333 0.19 9 Click to see details
PCPG -0.916 0.13 -1.000 0.5 3 Click to see details
LUAD -0.331 0.15 -0.510 0.05 12 Click to see details
KICH 0.218 0.15 0.356 0.04 25 Click to see details
COAD -0.369 0.18 -0.762 0.01 8 Click to see details
BRCA -0.093 0.2 -0.087 0.22 84 Click to see details
PRAD 0.112 0.22 0.157 0.14 50 Click to see details
KIRP 0.136 0.23 0.102 0.29 32 Click to see details
CESC -0.731 0.24 -0.500 0.33 3 Click to see details
UCEC -0.09 0.36 0.005 0.49 19 Click to see details
LIHC -0.05 0.37 -0.034 0.41 49 Click to see details
LUSC 0.012 0.47 0.113 0.25 38 Click to see details
THCA -0.009 0.47 -0.054 0.34 59 Click to see details
ESCA 0.016 0.48 0.155 0.32 11 Click to see details
ESCA 0.016 0.48 0.155 0.32 11 Click to see details
ESCA 0.016 0.48 0.155 0.32 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1