miRTarBase - #MIRT229860 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol YIPF6   
Synonyms FinGER6
Description Yip1 domain family member 6
Transcript NM_173834   
Putative miRNA Targets on YIPF6
3'UTR of YIPF6
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::|:: || |  ||||||| 
2915 - 2936 152.00 -9.30
             |:||::   |||  |||||:| 
2988 - 3012 139.00 -6.80
            || |:|: ||    || ||||||  
2742 - 2768 134.00 -13.30
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777935133 13 dbSNP
rs1052739603 24 dbSNP
rs1268554039 27 dbSNP
rs1338919032 29 dbSNP
rs757749532 32 dbSNP
rs781712766 34 dbSNP
rs748765236 41 dbSNP
rs777149166 43 dbSNP
rs1254167664 48 dbSNP
rs1453893654 50 dbSNP
rs1320755089 53 dbSNP
rs1332682550 74 dbSNP
rs1285424547 82 dbSNP
rs779541054 86 dbSNP
rs1215362521 89 dbSNP
rs1361064606 97 dbSNP
rs759729187 105 dbSNP
rs892872880 127 dbSNP
rs1371661701 128 dbSNP
rs1011775476 146 dbSNP
rs1357955496 146 dbSNP
rs753590574 154 dbSNP
rs754430248 161 dbSNP
rs900000774 164 dbSNP
rs1355763890 166 dbSNP
rs778494388 167 dbSNP
rs997068383 172 dbSNP
rs1029933962 178 dbSNP
rs1207198282 195 dbSNP
rs955335610 200 dbSNP
rs550261639 206 dbSNP
rs1455810608 207 dbSNP
rs1254179309 230 dbSNP
rs1016041713 235 dbSNP
rs765402682 240 dbSNP
rs372331901 250 dbSNP
rs1234642787 252 dbSNP
rs974604870 260 dbSNP
rs1471602103 268 dbSNP
rs915708556 269 dbSNP
rs969876137 272 dbSNP
rs1181380221 273 dbSNP
rs1236230506 282 dbSNP
rs981299652 283 dbSNP
rs1053988299 303 dbSNP
rs192682099 310 dbSNP
rs1374928000 321 dbSNP
rs747964733 329 dbSNP
rs1012089086 336 dbSNP
rs1440766516 339 dbSNP
rs1352411338 365 dbSNP
rs928534746 366 dbSNP
rs1425534584 376 dbSNP
rs1437041396 380 dbSNP
rs1396056212 385 dbSNP
rs1173605793 391 dbSNP
rs1431979255 392 dbSNP
rs764307619 394 dbSNP
rs751337783 404 dbSNP
rs1480312758 407 dbSNP
rs1003529696 413 dbSNP
rs1015001629 426 dbSNP
rs1485907196 434 dbSNP
rs1401110315 449 dbSNP
rs1052779487 452 dbSNP
rs914261504 454 dbSNP
rs947117260 455 dbSNP
rs1307546766 456 dbSNP
rs111400326 459 dbSNP
rs1368153031 467 dbSNP
rs142157939 471 dbSNP
rs1294807299 475 dbSNP
rs1414995507 478 dbSNP
rs899971621 483 dbSNP
rs1312678203 493 dbSNP
rs1464808374 496 dbSNP
rs997037152 502 dbSNP
rs1347470650 506 dbSNP
rs1351602099 509 dbSNP
rs1028206266 511 dbSNP
rs1409826570 512 dbSNP
rs1130875 517 dbSNP
rs1051290612 518 dbSNP
rs879034021 524 dbSNP
rs1475673807 527 dbSNP
rs1259360382 528 dbSNP
rs1257020877 529 dbSNP
rs953540934 533 dbSNP
rs1004505112 534 dbSNP
rs1201244391 535 dbSNP
rs767401752 548 dbSNP
rs750346843 554 dbSNP
rs1314667753 580 dbSNP
rs1294630432 582 dbSNP
rs1233311623 589 dbSNP
rs1282665166 592 dbSNP
rs1290985158 593 dbSNP
rs1185687652 601 dbSNP
rs1364503357 601 dbSNP
rs58273451 601 dbSNP
rs867616318 601 dbSNP
rs878909094 601 dbSNP
rs879085319 601 dbSNP
rs1482116589 602 dbSNP
rs1262143049 608 dbSNP
rs986360355 608 dbSNP
rs1185900707 609 dbSNP
rs1463506546 615 dbSNP
rs1252477596 620 dbSNP
rs866409286 621 dbSNP
rs911089572 622 dbSNP
rs1376848260 625 dbSNP
rs1478183269 626 dbSNP
rs1270943923 632 dbSNP
rs912173612 633 dbSNP
rs935826867 637 dbSNP
rs1015595268 654 dbSNP
rs963037548 656 dbSNP
rs1309670945 677 dbSNP
rs1296775400 679 dbSNP
rs1173986019 681 dbSNP
rs965032006 687 dbSNP
rs1363666689 696 dbSNP
rs1428582510 704 dbSNP
rs1328439918 706 dbSNP
rs184658779 708 dbSNP
rs1393815208 715 dbSNP
rs1381774159 717 dbSNP
rs1463694376 721 dbSNP
rs189159380 723 dbSNP
rs1169500155 727 dbSNP
rs1447364076 728 dbSNP
rs45508695 736 dbSNP
rs746788521 749 dbSNP
rs1330898116 765 dbSNP
rs928503568 769 dbSNP
rs923632719 773 dbSNP
rs1196987090 814 dbSNP
rs955954377 818 dbSNP
rs989136626 820 dbSNP
rs754630241 823 dbSNP
rs1339690317 825 dbSNP
rs1250360582 834 dbSNP
rs935039127 834 dbSNP
rs770754273 849 dbSNP
rs776716301 865 dbSNP
rs1340479289 867 dbSNP
rs1234336066 874 dbSNP
rs1235638430 890 dbSNP
rs914208732 906 dbSNP
rs989256710 934 dbSNP
rs1305936560 937 dbSNP
rs1340242664 956 dbSNP
rs915034741 965 dbSNP
rs1297817300 968 dbSNP
rs947914224 973 dbSNP
rs1227824497 982 dbSNP
rs1275400280 996 dbSNP
rs947055513 1019 dbSNP
rs1044947712 1026 dbSNP
rs1453752439 1036 dbSNP
rs1038758709 1053 dbSNP
rs1183378242 1059 dbSNP
rs921662547 1060 dbSNP
rs759861058 1063 dbSNP
rs1202574775 1064 dbSNP
rs906494240 1065 dbSNP
rs1282875546 1070 dbSNP
rs933085829 1082 dbSNP
rs1344951968 1094 dbSNP
rs1273518965 1108 dbSNP
rs1241358446 1130 dbSNP
rs939353145 1131 dbSNP
rs1451974366 1145 dbSNP
rs193156964 1148 dbSNP
rs866506091 1151 dbSNP
rs1377459532 1154 dbSNP
rs891341929 1163 dbSNP
rs897834757 1167 dbSNP
rs1245844382 1175 dbSNP
rs1160224749 1179 dbSNP
rs995303343 1184 dbSNP
rs1448481116 1189 dbSNP
rs1168721791 1194 dbSNP
rs1004431165 1206 dbSNP
rs185059142 1207 dbSNP
rs771305226 1210 dbSNP
rs1189098979 1211 dbSNP
rs1442202566 1213 dbSNP
rs1027759705 1214 dbSNP
rs775670278 1223 dbSNP
rs763504282 1225 dbSNP
rs1267617725 1228 dbSNP
rs1226594558 1240 dbSNP
rs189900858 1246 dbSNP
rs367859540 1247 dbSNP
rs764675035 1255 dbSNP
rs905946888 1258 dbSNP
rs1002951963 1292 dbSNP
rs1320268322 1295 dbSNP
rs1035448450 1299 dbSNP
rs955880289 1300 dbSNP
rs1384113779 1313 dbSNP
rs977708649 1316 dbSNP
rs1328316269 1320 dbSNP
rs988715385 1323 dbSNP
rs1418208102 1324 dbSNP
rs775037309 1327 dbSNP
rs1363331953 1338 dbSNP
rs1434636905 1343 dbSNP
rs568857123 1355 dbSNP
rs956416587 1357 dbSNP
rs1247884277 1370 dbSNP
rs1298494206 1371 dbSNP
rs989616796 1390 dbSNP
rs1309345728 1416 dbSNP
rs1242617977 1431 dbSNP
rs1271749005 1442 dbSNP
rs974801240 1442 dbSNP
rs921632201 1447 dbSNP
rs181219668 1450 dbSNP
rs1215390783 1458 dbSNP
rs987224581 1483 dbSNP
rs980611649 1516 dbSNP
rs1464214173 1518 dbSNP
rs927804777 1526 dbSNP
rs1394545048 1532 dbSNP
rs939238574 1534 dbSNP
rs1403273512 1553 dbSNP
rs1188789937 1555 dbSNP
rs1263316965 1557 dbSNP
rs1475905945 1560 dbSNP
rs1390178465 1576 dbSNP
rs1187215985 1581 dbSNP
rs1036297106 1586 dbSNP
rs897797739 1587 dbSNP
rs1186164422 1589 dbSNP
rs930687939 1593 dbSNP
rs1214948659 1605 dbSNP
rs912702777 1606 dbSNP
rs767980503 1613 dbSNP
rs1236363942 1617 dbSNP
rs1371586363 1634 dbSNP
rs1292453994 1637 dbSNP
rs1368445228 1646 dbSNP
rs1462394049 1647 dbSNP
rs1329120606 1652 dbSNP
rs753370333 1662 dbSNP
rs1389923632 1665 dbSNP
rs1049600978 1695 dbSNP
rs898728703 1699 dbSNP
rs931613289 1701 dbSNP
rs889242334 1702 dbSNP
rs1007649504 1715 dbSNP
rs1477043933 1715 dbSNP
rs754660171 1719 dbSNP
rs1205459428 1748 dbSNP
rs1482628284 1752 dbSNP
rs1272247020 1754 dbSNP
rs1212690502 1774 dbSNP
rs902023806 1775 dbSNP
rs1300418012 1786 dbSNP
rs1217033272 1798 dbSNP
rs1374866266 1800 dbSNP
rs1279826605 1818 dbSNP
rs1408807486 1839 dbSNP
rs1364301712 1847 dbSNP
rs753527502 1848 dbSNP
rs1312071057 1851 dbSNP
rs1341035905 1858 dbSNP
rs905874967 1863 dbSNP
rs1235056475 1872 dbSNP
rs868801253 1873 dbSNP
rs1002878241 1885 dbSNP
rs1360256858 1894 dbSNP
rs1031946199 1914 dbSNP
rs1412887524 1917 dbSNP
rs1410212217 1930 dbSNP
rs1035748936 1938 dbSNP
rs891608882 1941 dbSNP
rs1177810248 1943 dbSNP
rs1472399021 1974 dbSNP
rs956560367 1994 dbSNP
rs1189798986 1995 dbSNP
rs1485871972 1998 dbSNP
rs1255403678 2000 dbSNP
rs989195792 2001 dbSNP
rs1010468410 2003 dbSNP
rs1021488440 2007 dbSNP
rs1227193635 2010 dbSNP
rs764616904 2011 dbSNP
rs138903451 2013 dbSNP
rs1028627134 2023 dbSNP
rs1380321279 2028 dbSNP
rs752230756 2066 dbSNP
rs1475851533 2069 dbSNP
rs987191905 2090 dbSNP
rs1347411959 2102 dbSNP
rs1190710889 2130 dbSNP
rs907605028 2132 dbSNP
rs940479072 2139 dbSNP
rs183897055 2140 dbSNP
rs757955934 2149 dbSNP
rs1255180579 2159 dbSNP
rs188279318 2165 dbSNP
rs1486821632 2185 dbSNP
rs1242574848 2196 dbSNP
rs960592188 2196 dbSNP
rs1326458547 2198 dbSNP
rs777660161 2199 dbSNP
rs931517214 2200 dbSNP
rs1464708603 2209 dbSNP
rs1044635870 2210 dbSNP
rs1312487820 2216 dbSNP
rs1376132279 2240 dbSNP
rs1364701051 2241 dbSNP
rs905842887 2248 dbSNP
rs1434537394 2253 dbSNP
rs1386521309 2259 dbSNP
rs1416636630 2261 dbSNP
rs1328223887 2262 dbSNP
rs761550035 2277 dbSNP
rs747017278 2278 dbSNP
rs1162450193 2279 dbSNP
rs1430013052 2282 dbSNP
rs767342394 2282 dbSNP
rs796672671 2282 dbSNP
rs938702357 2287 dbSNP
rs1254368186 2294 dbSNP
rs1306138820 2294 dbSNP
rs1349743264 2296 dbSNP
rs919212008 2298 dbSNP
rs1487961418 2301 dbSNP
rs141405769 2302 dbSNP
rs1308840346 2304 dbSNP
rs891862716 2322 dbSNP
rs1010354868 2344 dbSNP
rs1309616663 2346 dbSNP
rs930633904 2359 dbSNP
rs1310139176 2362 dbSNP
rs1043280362 2363 dbSNP
rs760623191 2365 dbSNP
rs996063764 2368 dbSNP
rs1387371034 2383 dbSNP
rs1291996968 2387 dbSNP
rs182054519 2387 dbSNP
rs954339693 2391 dbSNP
rs1370916472 2397 dbSNP
rs753378176 2398 dbSNP
rs1202364051 2402 dbSNP
rs1396748917 2402 dbSNP
rs1198956948 2406 dbSNP
rs943403282 2412 dbSNP
rs754435559 2415 dbSNP
rs1014630680 2420 dbSNP
rs1197155165 2421 dbSNP
rs778481390 2429 dbSNP
rs1250282068 2435 dbSNP
rs1484265749 2435 dbSNP
rs1204829308 2436 dbSNP
rs962095682 2452 dbSNP
rs1483004682 2459 dbSNP
rs1040499637 2479 dbSNP
rs901992693 2483 dbSNP
rs1178184277 2487 dbSNP
rs973177808 2488 dbSNP
rs1393388833 2490 dbSNP
rs1351285428 2499 dbSNP
rs1307194871 2501 dbSNP
rs1410616682 2509 dbSNP
rs920054447 2514 dbSNP
rs1431719971 2516 dbSNP
rs1175643926 2518 dbSNP
rs1173072759 2521 dbSNP
rs1465148668 2527 dbSNP
rs952922924 2554 dbSNP
rs999061519 2556 dbSNP
rs1053772402 2563 dbSNP
rs1250543345 2563 dbSNP
rs1472728569 2563 dbSNP
rs1482276907 2565 dbSNP
rs1281421924 2566 dbSNP
rs1201506974 2572 dbSNP
rs1344451375 2580 dbSNP
rs1254357416 2584 dbSNP
rs1293263350 2585 dbSNP
rs980297893 2588 dbSNP
rs927531669 2589 dbSNP
rs371795135 2590 dbSNP
rs1436681954 2612 dbSNP
rs938967075 2622 dbSNP
rs1287957830 2636 dbSNP
rs1407825741 2660 dbSNP
rs1012245564 2663 dbSNP
rs1021883060 2677 dbSNP
rs1395419188 2683 dbSNP
rs1399921774 2693 dbSNP
rs1159814185 2709 dbSNP
rs1369917519 2724 dbSNP
rs1442831547 2725 dbSNP
rs1299723697 2730 dbSNP
rs1410854931 2732 dbSNP
rs1365237132 2739 dbSNP
rs1471844230 2740 dbSNP
rs1239548871 2750 dbSNP
rs1385942960 2750 dbSNP
rs752389552 2766 dbSNP
rs1301577511 2771 dbSNP
rs1350822181 2776 dbSNP
rs1442361237 2784 dbSNP
rs1254608559 2785 dbSNP
rs1057052757 2787 dbSNP
rs913272333 2799 dbSNP
rs946086045 2800 dbSNP
rs186468971 2808 dbSNP
rs1043157056 2809 dbSNP
rs1001887944 2812 dbSNP
rs143245798 2819 dbSNP
rs191808615 2827 dbSNP
rs1338636687 2844 dbSNP
rs1050277699 2847 dbSNP
rs113717633 2852 dbSNP
rs960812023 2853 dbSNP
rs890368533 2858 dbSNP
rs1205819170 2861 dbSNP
rs1008855094 2863 dbSNP
rs1462721369 2878 dbSNP
rs1014962671 2894 dbSNP
rs182075301 2906 dbSNP
rs971959730 2907 dbSNP
rs781054887 2917 dbSNP
rs1164202182 2928 dbSNP
rs1472671653 2929 dbSNP
rs780655081 2935 dbSNP
rs1191028439 2956 dbSNP
rs1465429970 2961 dbSNP
rs749425618 2968 dbSNP
rs1247523099 2974 dbSNP
rs1487713563 2985 dbSNP
rs1453557363 2986 dbSNP
rs41306121 3006 dbSNP
rs1253920300 3009 dbSNP
rs1027423241 3010 dbSNP
rs1353976562 3017 dbSNP
rs1299799347 3027 dbSNP
rs969133536 3040 dbSNP
rs1389613723 3043 dbSNP
rs1364323922 3046 dbSNP
rs1294783406 3063 dbSNP
rs774507232 3073 dbSNP
rs1437904378 3076 dbSNP
rs141469881 3077 dbSNP
rs772132090 3078 dbSNP
rs1023075615 3087 dbSNP
rs1405186970 3087 dbSNP
rs1348007354 3089 dbSNP
rs1457239547 3092 dbSNP
rs186608079 3099 dbSNP
rs1390040287 3108 dbSNP
rs1186764453 3119 dbSNP
rs960277836 3138 dbSNP
rs6525242 3147 dbSNP
rs1221082768 3167 dbSNP
rs1449695586 3173 dbSNP
rs1372779007 3189 dbSNP
rs191568740 3192 dbSNP
rs749345867 3203 dbSNP
rs1272381801 3226 dbSNP
rs1220510694 3227 dbSNP
rs1367668352 3233 dbSNP
rs1296310084 3234 dbSNP
rs1433884660 3246 dbSNP
rs1351895394 3256 dbSNP
rs1310250763 3258 dbSNP
rs1430730429 3259 dbSNP
rs1043513704 3272 dbSNP
rs945913683 3284 dbSNP
rs910531193 3288 dbSNP
rs768923493 3298 dbSNP
rs1425922766 3302 dbSNP
rs932085880 3305 dbSNP
rs1050245551 3311 dbSNP
rs1190647017 3337 dbSNP
rs1215747951 3345 dbSNP
rs1477176442 3349 dbSNP
rs1182716416 3360 dbSNP
rs890294801 3370 dbSNP
rs1040468879 3387 dbSNP
rs1212106999 3388 dbSNP
rs944569768 3399 dbSNP
rs1320421120 3400 dbSNP
rs923413662 3406 dbSNP
rs753755559 3408 dbSNP
rs774982316 3428 dbSNP
rs1330780122 3431 dbSNP
rs1036293962 3434 dbSNP
rs934821939 3438 dbSNP
rs3087685 3454 dbSNP
rs1297001564 3462 dbSNP
rs1470038947 3466 dbSNP
rs1450855585 3479 dbSNP
rs994494735 3485 dbSNP
rs1360203082 3499 dbSNP
rs1053252989 3505 dbSNP
rs1468293226 3507 dbSNP
rs1414536320 3542 dbSNP
rs1027763695 3544 dbSNP
rs893302407 3556 dbSNP
rs1249384221 3568 dbSNP
rs1183328298 3578 dbSNP
rs1186919845 3581 dbSNP
rs1011803103 3586 dbSNP
rs182509345 3596 dbSNP
rs1207497191 3605 dbSNP
rs1475799076 3612 dbSNP
rs1001950155 3625 dbSNP
rs371414356 3626 dbSNP
rs758074148 3627 dbSNP
rs993461388 3642 dbSNP
rs1020556031 3647 dbSNP
rs904851261 3650 dbSNP
rs1230332609 3671 dbSNP
rs968060519 3677 dbSNP
rs773654371 3679 dbSNP
rs1302761706 3685 dbSNP
rs777526873 3703 dbSNP
rs1165471354 3704 dbSNP
rs750836787 3706 dbSNP
rs1321255971 3729 dbSNP
rs1034726313 3731 dbSNP
rs960446404 3731 dbSNP
rs1362216939 3741 dbSNP
rs759066291 3751 dbSNP
rs1424174491 3755 dbSNP
rs1413055596 3781 dbSNP
rs993659107 3785 dbSNP
rs925983177 3791 dbSNP
rs1450837482 3792 dbSNP
rs1248145355 3818 dbSNP
rs1207502952 3821 dbSNP
rs756520434 3839 dbSNP
rs986220212 3862 dbSNP
rs1432342296 3865 dbSNP
rs1445410273 3871 dbSNP
rs146161831 3872 dbSNP
rs1312681907 3873 dbSNP
rs1244456122 3877 dbSNP
rs1377714057 3890 dbSNP
rs1233195531 3892 dbSNP
rs1298439835 3902 dbSNP
rs1294377173 3908 dbSNP
rs749804871 3913 dbSNP
rs1383158465 3926 dbSNP
rs1295492846 3928 dbSNP
rs1045438552 3935 dbSNP
rs944540126 3936 dbSNP
rs1349059575 3944 dbSNP
rs768679892 3958 dbSNP
rs1451282381 3960 dbSNP
rs1207169824 3973 dbSNP
rs779066479 3977 dbSNP
rs897728357 3979 dbSNP
rs1426204678 3983 dbSNP
rs1447778167 3989 dbSNP
rs1131506 4025 dbSNP
rs1218091994 4029 dbSNP
rs1235805799 4030 dbSNP
rs1472462398 4036 dbSNP
rs1487929312 4049 dbSNP
rs1291532272 4054 dbSNP
rs1220645734 4057 dbSNP
rs930591049 4062 dbSNP
rs1344939893 4067 dbSNP
rs951988417 4071 dbSNP
rs984687813 4072 dbSNP
rs1303731617 4080 dbSNP
rs1387596411 4082 dbSNP
rs748113917 4085 dbSNP
rs906844432 4092 dbSNP
rs1419857047 4105 dbSNP
rs1471506393 4114 dbSNP
rs1048719743 4116 dbSNP
rs1017560328 4133 dbSNP
rs904872301 4134 dbSNP
rs1408314249 4137 dbSNP
rs772374148 4141 dbSNP
rs1331694188 4146 dbSNP
rs976119920 4152 dbSNP
rs1131507 4182 dbSNP
rs1034747392 4204 dbSNP
rs1432248084 4210 dbSNP
rs1266242293 4217 dbSNP
rs773375046 4228 dbSNP
rs1197794609 4232 dbSNP
rs186791465 4236 dbSNP
rs1414791803 4237 dbSNP
rs770684487 4242 dbSNP
rs923268118 4248 dbSNP
rs1195702214 4251 dbSNP
rs1337973067 4262 dbSNP
rs1257857464 4269 dbSNP
rs1233990188 4284 dbSNP
rs934729381 4293 dbSNP
rs1281611335 4304 dbSNP
rs1411481262 4308 dbSNP
rs752390277 4322 dbSNP
rs1307132520 4335 dbSNP
rs1389624638 4349 dbSNP
rs1357857472 4367 dbSNP
rs78492888 4382 dbSNP
rs1465102409 4390 dbSNP
rs1279307815 4394 dbSNP
rs967651136 4399 dbSNP
rs182043429 4405 dbSNP
rs765017488 4408 dbSNP
rs947582184 4412 dbSNP
rs1413200936 4433 dbSNP
rs1032977316 4437 dbSNP
rs1181475553 4444 dbSNP
rs1436597430 4449 dbSNP
rs1465929514 4450 dbSNP
rs535932399 4453 dbSNP
rs1159284021 4454 dbSNP
rs1258796344 4459 dbSNP
rs1201176227 4460 dbSNP
rs1460920495 4461 dbSNP
rs1261541876 4473 dbSNP
rs953369831 4484 dbSNP
rs1044616080 4496 dbSNP
rs1330029495 4500 dbSNP
rs986190529 4504 dbSNP
rs1276700676 4505 dbSNP
rs1236528343 4525 dbSNP
rs1342264585 4533 dbSNP
rs757900914 4543 dbSNP
rs1394993299 4564 dbSNP
rs775095567 4566 dbSNP
rs1056097388 4568 dbSNP
rs763654138 4573 dbSNP
rs1457463984 4579 dbSNP
rs762316683 4601 dbSNP
rs1158361690 4607 dbSNP
rs1468922419 4617 dbSNP
rs189140891 4622 dbSNP
rs1259561349 4628 dbSNP
rs751223617 4656 dbSNP
rs756610203 4659 dbSNP
rs1482021132 4663 dbSNP
rs751440896 4681 dbSNP
rs1181264787 4691 dbSNP
rs1444517263 4691 dbSNP
rs1241378476 4693 dbSNP
rs919124121 4695 dbSNP
rs766840693 4700 dbSNP
rs1210603033 4701 dbSNP
rs1465517204 4707 dbSNP
rs1364143736 4714 dbSNP
rs1471004445 4722 dbSNP
rs1283821049 4741 dbSNP
rs193032795 4743 dbSNP
rs1203220891 4755 dbSNP
rs1358172986 4777 dbSNP
rs1284752182 4779 dbSNP
rs1245192989 4780 dbSNP
rs1423979509 4794 dbSNP
rs1299194738 4797 dbSNP
rs930539283 4798 dbSNP
rs896151047 4805 dbSNP
rs1364100934 4807 dbSNP
rs1049458130 4814 dbSNP
rs993235727 4844 dbSNP
rs1393363616 4850 dbSNP
rs1164145692 4852 dbSNP
rs1434821694 4869 dbSNP
rs926264741 4871 dbSNP
rs757223556 4877 dbSNP
rs1383854756 4882 dbSNP
rs1377842014 4903 dbSNP
rs1241791397 4904 dbSNP
rs1191261451 4937 dbSNP
rs1453504166 4940 dbSNP
rs1408534337 4964 dbSNP
rs1056083740 4976 dbSNP
rs1221386999 4980 dbSNP
rs10531 4982 dbSNP
rs1357198578 4983 dbSNP
rs755516817 4997 dbSNP
rs779252578 5002 dbSNP
rs1041847775 5005 dbSNP
rs1444737631 5014 dbSNP
rs903356056 5018 dbSNP
rs1000421511 5020 dbSNP
rs1033279673 5032 dbSNP
rs1006091713 5044 dbSNP
rs748282355 5045 dbSNP
rs953632984 5045 dbSNP
rs3513 5046 dbSNP
rs1347369358 5059 dbSNP
rs1235185839 5068 dbSNP
rs1282556524 5071 dbSNP
rs1340035993 5072 dbSNP
rs1430528680 5072 dbSNP
rs780800724 5073 dbSNP
rs1195167772 5075 dbSNP
rs1251064615 5078 dbSNP
rs1439375026 5079 dbSNP
rs1196420248 5081 dbSNP
rs1252041755 5083 dbSNP
rs976005243 5084 dbSNP
rs1454421811 5085 dbSNP
rs1195030562 5086 dbSNP
rs1479136872 5087 dbSNP
rs1387772368 5090 dbSNP
rs1018989316 5094 dbSNP
rs1198511627 5095 dbSNP
rs1336441299 5102 dbSNP
rs1489796010 5104 dbSNP
rs114368036 5109 dbSNP
rs1205749928 5118 dbSNP
rs1306795829 5120 dbSNP
rs778011435 5121 dbSNP
rs972561470 5121 dbSNP
rs185420346 5126 dbSNP
rs1282226014 5135 dbSNP
rs951985237 5137 dbSNP
rs1343990743 5143 dbSNP
rs771081316 5148 dbSNP
rs1191210854 5167 dbSNP
rs1370586248 5188 dbSNP
rs1443594015 5196 dbSNP
rs1441895973 5200 dbSNP
rs914671777 5200 dbSNP
rs1305822060 5212 dbSNP
rs780152198 5214 dbSNP
rs1430320529 5215 dbSNP
rs745653676 5220 dbSNP
rs1479358636 5221 dbSNP
rs776413917 5223 dbSNP
rs1363117460 5234 dbSNP
rs1480268586 5236 dbSNP
rs745608546 5246 dbSNP
rs769792476 5252 dbSNP
rs1442474842 5263 dbSNP
rs1262162277 5269 dbSNP
rs1221335807 5273 dbSNP
rs1330712522 5280 dbSNP
rs1290614831 5282 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 286451.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            ::|:: || |  ||||||| 
5 - 26
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000462683.1 | 3UTR | CCAUCAUGAGUAAUCACUUGCUGCUCCUACUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.621 7.8e-4 0.610 1.0e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.657 8.2e-4 0.659 7.9e-4 20 Click to see details
GSE21032 Prostate cancer 0.331 1.1e-3 0.287 4.3e-3 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.531 3.2e-3 0.501 5.4e-3 25 Click to see details
GSE28260 Renal cortex and medulla -0.671 6.0e-3 -0.758 1.3e-3 13 Click to see details
GSE19783 ER- ER- breast cancer 0.257 1.1e-2 0.227 2.2e-2 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.494 1.3e-2 -0.552 5.8e-3 20 Click to see details
GSE19536 Breast cancer 0.191 2.8e-2 0.138 8.5e-2 100 Click to see details
GSE17498 Multiple myeloma 0.232 7.5e-2 0.094 2.8e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.145 8.6e-2 -0.172 5.3e-2 90 Click to see details
GSE21849 B cell lymphoma -0.24 1.0e-1 0.173 1.8e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.301 1.3e-1 -0.241 1.8e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.086 3.4e-1 -0.013 4.8e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.114 3.6e-1 -0.063 4.2e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.027 4.2e-1 0.016 4.5e-1 64 Click to see details
GSE28544 Breast cancer -0.038 4.3e-1 -0.422 2.0e-2 24 Click to see details
GSE17306 Multiple myeloma -0.019 4.5e-1 -0.082 2.9e-1 49 Click to see details
GSE32688 Pancreatic cancer -0.016 4.7e-1 0.054 3.8e-1 32 Click to see details
GSE38226 Liver fibrosis -0.018 4.7e-1 0.012 4.8e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.007 4.9e-1 -0.042 4.2e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.007 4.9e-1 -0.042 4.2e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.218 0.02 0.156 0.08 84 Click to see details
CHOL -0.642 0.03 -0.400 0.14 9 Click to see details
THCA -0.219 0.05 -0.220 0.05 59 Click to see details
LIHC -0.206 0.08 -0.202 0.08 49 Click to see details
CESC 0.919 0.13 1.000 0.5 3 Click to see details
PAAD -0.71 0.15 -1.000 0.5 4 Click to see details
PCPG -0.872 0.16 -1.000 0.5 3 Click to see details
HNSC -0.151 0.17 -0.122 0.22 42 Click to see details
COAD -0.308 0.23 -0.595 0.06 8 Click to see details
ESCA -0.219 0.26 -0.309 0.18 11 Click to see details
KICH 0.132 0.26 0.187 0.19 25 Click to see details
LUSC 0.1 0.28 0.028 0.43 38 Click to see details
LUAD -0.191 0.28 -0.147 0.32 12 Click to see details
KIRP -0.092 0.31 -0.063 0.37 32 Click to see details
KIRC -0.057 0.32 -0.058 0.32 68 Click to see details
BLCA -0.109 0.33 -0.108 0.33 18 Click to see details
STAD -0.061 0.37 -0.032 0.43 32 Click to see details
UCEC -0.077 0.38 -0.270 0.13 19 Click to see details
PRAD 0.023 0.44 -0.007 0.48 50 Click to see details
PRAD 0.023 0.44 -0.007 0.48 50 Click to see details
PRAD 0.023 0.44 -0.007 0.48 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
MIRT735131 GSDMB gasdermin B 2 0
MIRT736201 DRD1 dopamine receptor D1 3 0
Error report submission
Your e-Mail*