miRTarBase - #MIRT217743 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBPL1   
Synonyms MGC:8389, MGC:9620, STUD, TLF, TLP, TRF2
Description TATA-box binding protein like 1
Transcript NM_004865   
Expression
Putative miRNA Targets on TBPL1
3'UTR of TBPL1
(miRNA target sites are highlighted)
>TBPL1|NM_004865|3'UTR
   1 TTCACCACTTAATTGGTTAGAATCTCTAACTGAGCACCTTTTAAACCTGCTGCACATTGGACTCAAAAGGAAAACTGGAC
  81 CAACAATAATTGAGGAAATAGACTCTTTTATTCATTCACGGCTACAGTGTAAGCTCCAGTCCCTTTGGATTTTATTCCAA
 161 ACCTTGCTGTAATATAAAAGGAAGTTTACAAGACATGATATTGCTGCTTTTACAAAAGGACATTCTATTTATTTTCGCAG
 241 TAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAGATTGTTTTATTGTCGTCATTGTTATTTTTT
 321 TCCATTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGT
 401 AAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGATCTCTCTTCAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA--AUACACGACGAu 5'
            |||: |||  ||| ||||||| 
Target 5' taCAAGACATGATAT-TGCTGCTt 3'
187 - 209 165.00 -15.30
2
miRNA  3' guguuUGGUAA---UACACGACGau 5'
               ||| ||   |  ||||||  
Target 5' tgagcACCTTTTAAACCTGCTGCac 3'
31 - 55 129.00 -9.90
3
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            :| |:: ||:| |||||   
Target 5' ttTACATTTTTGTATGCTGaat 3'
359 - 380 120.00 -8.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30113668 25 COSMIC
COSN31593046 86 COSMIC
COSN28848632 109 COSMIC
COSN31574063 226 COSMIC
COSN26574765 305 COSMIC
COSN31585450 370 COSMIC
COSN6588907 411 COSMIC
COSN22823339 542 COSMIC
COSN6304487 572 COSMIC
COSN7690184 607 COSMIC
COSN20103368 609 COSMIC
COSN20103376 609 COSMIC
COSN7784373 609 COSMIC
COSN1325286 611 COSMIC
COSN31545706 613 COSMIC
COSN31555744 615 COSMIC
COSN24866418 627 COSMIC
COSN6304488 1047 COSMIC
COSN32057757 1187 COSMIC
COSN2142521 1207 COSMIC
COSN32057758 1391 COSMIC
COSN16442007 1717 COSMIC
COSN5621709 1980 COSMIC
COSN6304489 2113 COSMIC
COSN31485066 3088 COSMIC
COSN31539997 3099 COSMIC
COSN28725267 3384 COSMIC
COSN19225645 3393 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1303608503 1 dbSNP
rs1381852963 4 dbSNP
rs1231814630 5 dbSNP
rs1308634588 8 dbSNP
rs11553666 10 dbSNP
rs1330420706 23 dbSNP
rs772443925 27 dbSNP
rs1285759843 29 dbSNP
rs1444728181 34 dbSNP
rs1214672026 36 dbSNP
rs117173630 39 dbSNP
rs1486563134 41 dbSNP
rs369123038 50 dbSNP
rs776809704 51 dbSNP
rs1048110632 53 dbSNP
rs1358396845 56 dbSNP
rs1227393362 57 dbSNP
rs1265916552 60 dbSNP
rs1325044176 65 dbSNP
rs907966720 67 dbSNP
rs36028195 71 dbSNP
rs1203798294 82 dbSNP
rs940727592 84 dbSNP
rs1038125521 88 dbSNP
rs899146641 89 dbSNP
rs937621019 90 dbSNP
rs185210903 92 dbSNP
rs190139630 94 dbSNP
rs1179784397 102 dbSNP
rs1418922300 103 dbSNP
rs1472644775 104 dbSNP
rs1014706155 105 dbSNP
rs1157194061 106 dbSNP
rs1218480734 113 dbSNP
rs559579597 120 dbSNP
rs1014380528 121 dbSNP
rs1020373436 130 dbSNP
rs905972586 141 dbSNP
rs1001608971 142 dbSNP
rs1358449074 144 dbSNP
rs1227985518 174 dbSNP
rs1378086397 180 dbSNP
rs1270547561 181 dbSNP
rs557207285 189 dbSNP
rs530175217 194 dbSNP
rs1464488061 195 dbSNP
rs1338307609 198 dbSNP
rs1297544242 199 dbSNP
rs1299886557 201 dbSNP
rs1424696279 208 dbSNP
rs749475735 212 dbSNP
rs574014383 223 dbSNP
rs957546620 237 dbSNP
rs988953176 238 dbSNP
rs1347038602 241 dbSNP
rs1404403358 249 dbSNP
rs1020961296 250 dbSNP
rs548176054 256 dbSNP
rs955641126 258 dbSNP
rs1223537400 273 dbSNP
rs1477076976 281 dbSNP
rs761167340 282 dbSNP
rs911539154 284 dbSNP
rs943150025 285 dbSNP
rs1310887371 291 dbSNP
rs113474757 293 dbSNP
rs1263775365 295 dbSNP
rs1221007358 305 dbSNP
rs1252461659 306 dbSNP
rs559358935 309 dbSNP
rs996530332 317 dbSNP
rs920320524 319 dbSNP
rs528103465 323 dbSNP
rs1180515814 328 dbSNP
rs545042270 332 dbSNP
rs181336196 334 dbSNP
rs563346195 335 dbSNP
rs1277428227 336 dbSNP
rs1480894738 345 dbSNP
rs954570920 354 dbSNP
rs531117617 374 dbSNP
rs550920356 399 dbSNP
rs1369015808 400 dbSNP
rs1291286252 409 dbSNP
rs1435208667 410 dbSNP
rs987316390 411 dbSNP
rs1198703196 414 dbSNP
rs907686908 443 dbSNP
rs1464356157 449 dbSNP
rs1423150299 451 dbSNP
rs1423385229 451 dbSNP
rs1047549252 455 dbSNP
rs768888641 457 dbSNP
rs567869194 464 dbSNP
rs1481023312 465 dbSNP
rs1197005239 466 dbSNP
rs973500618 466 dbSNP
rs949980298 474 dbSNP
rs186164516 475 dbSNP
rs920628732 476 dbSNP
rs1257192632 506 dbSNP
rs1223965732 510 dbSNP
rs1313872290 512 dbSNP
rs1355082192 513 dbSNP
rs1056163499 516 dbSNP
rs1218103981 516 dbSNP
rs937358725 516 dbSNP
rs9493789 517 dbSNP
rs1305976361 518 dbSNP
rs905877700 519 dbSNP
rs546896494 521 dbSNP
rs1376396624 524 dbSNP
rs189876493 524 dbSNP
rs893185158 525 dbSNP
rs1010852968 532 dbSNP
rs999710258 535 dbSNP
rs530676513 540 dbSNP
rs1296876194 542 dbSNP
rs35776966 548 dbSNP
rs995858532 567 dbSNP
rs1203384559 572 dbSNP
rs987057179 573 dbSNP
rs1028635497 577 dbSNP
rs1484137596 578 dbSNP
rs1254131403 582 dbSNP
rs954628320 584 dbSNP
rs1156921212 585 dbSNP
rs1310821555 585 dbSNP
rs1316928923 585 dbSNP
rs1363078908 585 dbSNP
rs142078499 585 dbSNP
rs1454764126 585 dbSNP
rs35068923 585 dbSNP
rs397887689 585 dbSNP
rs759518058 585 dbSNP
rs763394213 585 dbSNP
rs1490635174 586 dbSNP
rs1221096500 587 dbSNP
rs1245248675 588 dbSNP
rs1185696369 589 dbSNP
rs1425285382 590 dbSNP
rs1486871574 592 dbSNP
rs1008802570 593 dbSNP
rs569289487 596 dbSNP
rs1181145357 601 dbSNP
rs1486152408 603 dbSNP
rs1296932906 605 dbSNP
rs1312448310 605 dbSNP
rs1339004965 605 dbSNP
rs1390656161 606 dbSNP
rs1419129168 606 dbSNP
rs866434854 606 dbSNP
rs1165164380 607 dbSNP
rs1366302365 607 dbSNP
rs146405495 607 dbSNP
rs762474594 607 dbSNP
rs775416381 607 dbSNP
rs1448802043 608 dbSNP
rs1376589189 609 dbSNP
rs1491277424 609 dbSNP
rs1491295775 609 dbSNP
rs200249148 609 dbSNP
rs57298113 609 dbSNP
rs59102121 609 dbSNP
rs752313604 611 dbSNP
rs879217774 613 dbSNP
rs1425122035 615 dbSNP
rs1322439629 617 dbSNP
rs1014795332 621 dbSNP
rs755185494 621 dbSNP
rs1347793334 625 dbSNP
rs1432233836 635 dbSNP
rs974345810 636 dbSNP
rs1365020235 638 dbSNP
rs537231025 639 dbSNP
rs1317851806 640 dbSNP
rs1421046118 645 dbSNP
rs951828351 648 dbSNP
rs983714664 662 dbSNP
rs1228149437 671 dbSNP
rs556851385 678 dbSNP
rs1177647205 683 dbSNP
rs1287942737 683 dbSNP
rs1473295183 690 dbSNP
rs573898724 693 dbSNP
rs1239579095 695 dbSNP
rs973936677 697 dbSNP
rs1442336660 701 dbSNP
rs1236634993 712 dbSNP
rs542902725 713 dbSNP
rs1216511561 714 dbSNP
rs920695381 717 dbSNP
rs1247492759 723 dbSNP
rs553308028 727 dbSNP
rs949896026 728 dbSNP
rs570597690 740 dbSNP
rs1186577328 752 dbSNP
rs1285731920 753 dbSNP
rs1445626541 766 dbSNP
rs572866631 769 dbSNP
rs1244940120 782 dbSNP
rs927158399 791 dbSNP
rs544713083 811 dbSNP
rs917222589 813 dbSNP
rs1054449929 816 dbSNP
rs1405585974 817 dbSNP
rs1415583609 818 dbSNP
rs893248247 825 dbSNP
rs1010300957 854 dbSNP
rs528250384 863 dbSNP
rs766603580 887 dbSNP
rs1264475668 890 dbSNP
rs1196497693 894 dbSNP
rs564969418 904 dbSNP
rs1262576210 905 dbSNP
rs891306817 912 dbSNP
rs1323721522 924 dbSNP
rs1402090011 926 dbSNP
rs924815636 928 dbSNP
rs755990775 930 dbSNP
rs1387263063 933 dbSNP
rs1401768136 963 dbSNP
rs113912863 972 dbSNP
rs1432324036 982 dbSNP
rs1338418619 988 dbSNP
rs530494423 994 dbSNP
rs1339229064 995 dbSNP
rs1384222071 1002 dbSNP
rs1447696526 1007 dbSNP
rs1282800239 1015 dbSNP
rs1018483699 1019 dbSNP
rs1351226247 1023 dbSNP
rs1054991608 1024 dbSNP
rs777400113 1031 dbSNP
rs996306307 1052 dbSNP
rs995838550 1056 dbSNP
rs1477126125 1059 dbSNP
rs1423623270 1073 dbSNP
rs1027304561 1077 dbSNP
rs1327129126 1081 dbSNP
rs369054300 1087 dbSNP
rs1191826068 1090 dbSNP
rs1489530635 1091 dbSNP
rs1245164578 1100 dbSNP
rs951917662 1102 dbSNP
rs983235691 1109 dbSNP
rs907594876 1110 dbSNP
rs971259778 1123 dbSNP
rs752117727 1129 dbSNP
rs118004011 1135 dbSNP
rs61141720 1136 dbSNP
rs753521275 1139 dbSNP
rs1294818778 1143 dbSNP
rs150183582 1144 dbSNP
rs914564819 1154 dbSNP
rs897699226 1158 dbSNP
rs946007830 1172 dbSNP
rs1410817466 1177 dbSNP
rs9483639 1187 dbSNP
rs1400663061 1195 dbSNP
rs1333776347 1196 dbSNP
rs1464440280 1204 dbSNP
rs891164810 1205 dbSNP
rs1400173427 1221 dbSNP
rs1177994764 1224 dbSNP
rs1431955103 1232 dbSNP
rs1027870959 1235 dbSNP
rs1403461255 1245 dbSNP
rs1414401529 1247 dbSNP
rs1440534728 1250 dbSNP
rs566866737 1265 dbSNP
rs958834524 1273 dbSNP
rs991513774 1274 dbSNP
rs1024287280 1279 dbSNP
rs1250641392 1291 dbSNP
rs1210746715 1301 dbSNP
rs971362405 1314 dbSNP
rs185187748 1317 dbSNP
rs1298553226 1327 dbSNP
rs1008358779 1328 dbSNP
rs1377159354 1331 dbSNP
rs1039846164 1333 dbSNP
rs115813933 1336 dbSNP
rs771476337 1352 dbSNP
rs936216812 1353 dbSNP
rs77147194 1354 dbSNP
rs571408825 1364 dbSNP
rs1004918801 1365 dbSNP
rs145764078 1369 dbSNP
rs535589731 1372 dbSNP
rs1382361878 1380 dbSNP
rs1177025738 1390 dbSNP
rs76305699 1391 dbSNP
rs981310407 1392 dbSNP
rs1199795920 1396 dbSNP
rs1050165350 1405 dbSNP
rs1182302927 1407 dbSNP
rs1034164709 1410 dbSNP
rs890166971 1411 dbSNP
rs958638869 1414 dbSNP
rs990078600 1422 dbSNP
rs914449719 1442 dbSNP
rs1035997943 1448 dbSNP
rs1237509199 1457 dbSNP
rs897757775 1464 dbSNP
rs946071684 1467 dbSNP
rs190835768 1468 dbSNP
rs995136781 1472 dbSNP
rs1398203989 1479 dbSNP
rs1377581247 1481 dbSNP
rs1400637014 1483 dbSNP
rs1471411464 1483 dbSNP
rs1200874927 1487 dbSNP
rs977791447 1490 dbSNP
rs1027510058 1492 dbSNP
rs370572200 1498 dbSNP
rs1399300827 1500 dbSNP
rs1425380296 1516 dbSNP
rs567422535 1533 dbSNP
rs1253950882 1537 dbSNP
rs148944942 1541 dbSNP
rs1264697335 1548 dbSNP
rs1213892381 1549 dbSNP
rs1307825258 1550 dbSNP
rs1265699985 1553 dbSNP
rs1247387281 1556 dbSNP
rs113891596 1557 dbSNP
rs138475812 1561 dbSNP
rs1219787351 1565 dbSNP
rs183426339 1578 dbSNP
rs1296407060 1579 dbSNP
rs762145391 1580 dbSNP
rs1048645084 1584 dbSNP
rs1295540429 1587 dbSNP
rs145360888 1592 dbSNP
rs1415416078 1594 dbSNP
rs770081183 1595 dbSNP
rs1478097188 1596 dbSNP
rs932811504 1599 dbSNP
rs1228789958 1612 dbSNP
rs1445948431 1614 dbSNP
rs887325693 1626 dbSNP
rs1273652394 1628 dbSNP
rs1267549789 1630 dbSNP
rs558967374 1634 dbSNP
rs986929371 1640 dbSNP
rs1272942036 1641 dbSNP
rs1224235353 1646 dbSNP
rs1267672156 1665 dbSNP
rs1320598732 1666 dbSNP
rs41286224 1677 dbSNP
rs201916900 1686 dbSNP
rs867352449 1686 dbSNP
rs944412518 1686 dbSNP
rs906973383 1687 dbSNP
rs1385317691 1693 dbSNP
rs199770877 1693 dbSNP
rs1465980283 1694 dbSNP
rs73774177 1694 dbSNP
rs930604578 1694 dbSNP
rs229917 1695 dbSNP
rs186958546 1696 dbSNP
rs1474760477 1697 dbSNP
rs538470446 1702 dbSNP
rs1377702757 1703 dbSNP
rs1012704626 1704 dbSNP
rs1388696436 1705 dbSNP
rs1427005179 1715 dbSNP
rs990350122 1726 dbSNP
rs560693719 1730 dbSNP
rs1390331954 1736 dbSNP
rs1459396173 1737 dbSNP
rs371455084 1766 dbSNP
rs907309396 1767 dbSNP
rs998877997 1768 dbSNP
rs1257816887 1771 dbSNP
rs781105514 1774 dbSNP
rs1320381431 1782 dbSNP
rs1367185875 1784 dbSNP
rs977472924 1785 dbSNP
rs1310299733 1787 dbSNP
rs1447184537 1793 dbSNP
rs1229042322 1801 dbSNP
rs1326694078 1812 dbSNP
rs1296859356 1827 dbSNP
rs1402898139 1830 dbSNP
rs1173798876 1843 dbSNP
rs1339776549 1845 dbSNP
rs1394061943 1848 dbSNP
rs1247949240 1862 dbSNP
rs912551258 1863 dbSNP
rs766350030 1868 dbSNP
rs1011871746 1877 dbSNP
rs975488152 1882 dbSNP
rs954244877 1886 dbSNP
rs1263214933 1888 dbSNP
rs752724947 1890 dbSNP
rs912714148 1891 dbSNP
rs931491466 1893 dbSNP
rs1049034653 1896 dbSNP
rs1246772571 1903 dbSNP
rs372137828 1905 dbSNP
rs940246084 1909 dbSNP
rs972208959 1910 dbSNP
rs918962135 1918 dbSNP
rs1036055291 1922 dbSNP
rs1340960162 1933 dbSNP
rs760489757 1934 dbSNP
rs1412329664 1942 dbSNP
rs930300155 1943 dbSNP
rs1368054472 1944 dbSNP
rs1048683906 1945 dbSNP
rs763899614 1949 dbSNP
rs1158316603 1960 dbSNP
rs540462445 1962 dbSNP
rs1002515493 1969 dbSNP
rs1239671111 1971 dbSNP
rs367568876 1980 dbSNP
rs1186437866 1986 dbSNP
rs1485346237 1991 dbSNP
rs1298596671 2002 dbSNP
rs1034102496 2003 dbSNP
rs1445473431 2006 dbSNP
rs191403333 2013 dbSNP
rs1222955841 2017 dbSNP
rs753453915 2025 dbSNP
rs1434528509 2026 dbSNP
rs1011442081 2036 dbSNP
rs1362981567 2038 dbSNP
rs1021859127 2044 dbSNP
rs1308132786 2044 dbSNP
rs144126990 2050 dbSNP
rs1343028966 2053 dbSNP
rs893182089 2059 dbSNP
rs552851243 2062 dbSNP
rs1416414794 2065 dbSNP
rs369248532 2069 dbSNP
rs1242144279 2071 dbSNP
rs1475158920 2076 dbSNP
rs1019467798 2079 dbSNP
rs756909621 2080 dbSNP
rs1474486257 2087 dbSNP
rs954297830 2106 dbSNP
rs975352310 2112 dbSNP
rs921385001 2113 dbSNP
rs952907409 2115 dbSNP
rs1266731657 2131 dbSNP
rs1019820861 2132 dbSNP
rs1211653818 2132 dbSNP
rs1334026708 2143 dbSNP
rs1278795839 2145 dbSNP
rs1215762448 2151 dbSNP
rs1359269918 2151 dbSNP
rs984326863 2161 dbSNP
rs377018584 2164 dbSNP
rs562698952 2165 dbSNP
rs183724867 2169 dbSNP
rs1461287288 2171 dbSNP
rs1401610769 2175 dbSNP
rs1184223950 2176 dbSNP
rs574545949 2179 dbSNP
rs1426754709 2191 dbSNP
rs1413024939 2193 dbSNP
rs573479215 2194 dbSNP
rs915554230 2199 dbSNP
rs1157052867 2200 dbSNP
rs1191468284 2203 dbSNP
rs948668224 2207 dbSNP
rs778601719 2215 dbSNP
rs1206539494 2218 dbSNP
rs1467518963 2227 dbSNP
rs112114073 2228 dbSNP
rs1271663791 2232 dbSNP
rs113699576 2239 dbSNP
rs938334881 2242 dbSNP
rs1055461177 2252 dbSNP
rs1378149158 2255 dbSNP
rs1300846214 2261 dbSNP
rs894269135 2281 dbSNP
rs1378129144 2282 dbSNP
rs548699475 2283 dbSNP
rs1460916825 2284 dbSNP
rs1354533261 2286 dbSNP
rs1289791758 2294 dbSNP
rs41286226 2296 dbSNP
rs1227180602 2297 dbSNP
rs1173260229 2300 dbSNP
rs1285912630 2303 dbSNP
rs893225389 2306 dbSNP
rs1178786679 2308 dbSNP
rs1479604569 2319 dbSNP
rs1313505758 2329 dbSNP
rs903033090 2330 dbSNP
rs536428806 2332 dbSNP
rs1211419828 2333 dbSNP
rs1210161311 2336 dbSNP
rs1349449558 2337 dbSNP
rs1019497004 2339 dbSNP
rs775081593 2351 dbSNP
rs139314352 2363 dbSNP
rs1309593150 2372 dbSNP
rs1028264610 2375 dbSNP
rs1008516345 2383 dbSNP
rs1472390529 2385 dbSNP
rs779395769 2394 dbSNP
rs1303951329 2425 dbSNP
rs1416630792 2427 dbSNP
rs1180377477 2428 dbSNP
rs1420521635 2433 dbSNP
rs1382450964 2434 dbSNP
rs1019873549 2435 dbSNP
rs897370372 2453 dbSNP
rs952858258 2455 dbSNP
rs1433893901 2457 dbSNP
rs1176669022 2458 dbSNP
rs566688548 2459 dbSNP
rs1486329895 2460 dbSNP
rs994749943 2462 dbSNP
rs908602553 2463 dbSNP
rs187852122 2469 dbSNP
rs1309639504 2474 dbSNP
rs1370715416 2486 dbSNP
rs2200286 2494 dbSNP
rs747579171 2495 dbSNP
rs982243375 2500 dbSNP
rs1316706203 2501 dbSNP
rs1313976639 2505 dbSNP
rs928236213 2506 dbSNP
rs1354174440 2507 dbSNP
rs984538336 2512 dbSNP
rs1387363833 2514 dbSNP
rs1400730196 2514 dbSNP
rs1305854574 2515 dbSNP
rs1287358429 2525 dbSNP
rs1022619649 2528 dbSNP
rs1344393854 2531 dbSNP
rs563309243 2532 dbSNP
rs1219346118 2550 dbSNP
rs1476142860 2551 dbSNP
rs1415630886 2559 dbSNP
rs1055497404 2561 dbSNP
rs191859225 2567 dbSNP
rs947048701 2568 dbSNP
rs1263324779 2569 dbSNP
rs1203023195 2573 dbSNP
rs928564561 2578 dbSNP
rs1266402404 2583 dbSNP
rs1230987224 2590 dbSNP
rs756907177 2591 dbSNP
rs1219284943 2592 dbSNP
rs1275796411 2592 dbSNP
rs1328280539 2597 dbSNP
rs1293627286 2600 dbSNP
rs1381848845 2608 dbSNP
rs934568592 2611 dbSNP
rs1326295676 2616 dbSNP
rs1462861030 2618 dbSNP
rs1392134550 2619 dbSNP
rs1043199920 2622 dbSNP
rs1374283710 2623 dbSNP
rs1190485778 2625 dbSNP
rs989071198 2627 dbSNP
rs141162908 2637 dbSNP
rs999126274 2641 dbSNP
rs746817023 2644 dbSNP
rs947490083 2646 dbSNP
rs1040851228 2656 dbSNP
rs555095609 2659 dbSNP
rs1199835438 2660 dbSNP
rs1342154029 2670 dbSNP
rs1249682587 2673 dbSNP
rs1226834117 2676 dbSNP
rs748592566 2679 dbSNP
rs1305923289 2681 dbSNP
rs182180101 2687 dbSNP
rs1190710173 2695 dbSNP
rs996707869 2696 dbSNP
rs1385066 2697 dbSNP
rs1170481638 2699 dbSNP
rs1391896283 2704 dbSNP
rs888465056 2715 dbSNP
rs1390541515 2719 dbSNP
rs7743546 2730 dbSNP
rs1165631319 2735 dbSNP
rs1166297755 2736 dbSNP
rs1016102253 2743 dbSNP
rs186918519 2746 dbSNP
rs1436509796 2750 dbSNP
rs982316947 2751 dbSNP
rs577378861 2765 dbSNP
rs1452899732 2773 dbSNP
rs1252747262 2781 dbSNP
rs1183070112 2785 dbSNP
rs1440028376 2788 dbSNP
rs1249094140 2791 dbSNP
rs959498632 2795 dbSNP
rs1195250537 2800 dbSNP
rs1345841230 2801 dbSNP
rs991087710 2803 dbSNP
rs1027590451 2804 dbSNP
rs1437886863 2807 dbSNP
rs1347520014 2812 dbSNP
rs35173848 2814 dbSNP
rs1302379531 2818 dbSNP
rs1239565634 2829 dbSNP
rs1337412300 2840 dbSNP
rs546134155 2860 dbSNP
rs1390244083 2862 dbSNP
rs915456424 2865 dbSNP
rs1341860501 2866 dbSNP
rs1432472793 2869 dbSNP
rs1006423088 2876 dbSNP
rs1022673428 2878 dbSNP
rs751935531 2881 dbSNP
rs947048781 2887 dbSNP
rs1471372495 2891 dbSNP
rs969746846 2894 dbSNP
rs978441716 2898 dbSNP
rs924393841 2903 dbSNP
rs1245048359 2905 dbSNP
rs1485455950 2909 dbSNP
rs1287039600 2920 dbSNP
rs1224093466 2928 dbSNP
rs150706203 2930 dbSNP
rs1040888494 2933 dbSNP
rs575588676 2937 dbSNP
rs1238225467 2944 dbSNP
rs531600307 2955 dbSNP
rs1248606956 2959 dbSNP
rs932464945 2963 dbSNP
rs1294559385 2965 dbSNP
rs1412436024 2973 dbSNP
rs1448603467 2975 dbSNP
rs192481186 2977 dbSNP
rs1383272681 2981 dbSNP
rs985249736 2986 dbSNP
rs137986710 3005 dbSNP
rs200398397 3011 dbSNP
rs1405591999 3021 dbSNP
rs918576558 3029 dbSNP
rs888337475 3032 dbSNP
rs1445553998 3040 dbSNP
rs1006001052 3041 dbSNP
rs527751628 3046 dbSNP
rs1207918581 3048 dbSNP
rs771074025 3051 dbSNP
rs774246929 3052 dbSNP
rs185730811 3059 dbSNP
rs760676604 3066 dbSNP
rs1045183516 3069 dbSNP
rs1347588990 3073 dbSNP
rs1432459023 3073 dbSNP
rs1458395919 3075 dbSNP
rs562056766 3075 dbSNP
rs1321766551 3082 dbSNP
rs905641226 3107 dbSNP
rs1003641933 3115 dbSNP
rs1035349719 3120 dbSNP
rs35064072 3124 dbSNP
rs1397276735 3142 dbSNP
rs1163410983 3153 dbSNP
rs17063228 3162 dbSNP
rs1380430452 3168 dbSNP
rs1227944339 3169 dbSNP
rs776544072 3170 dbSNP
rs1474531521 3177 dbSNP
rs1241791461 3179 dbSNP
rs1187641842 3180 dbSNP
rs990951816 3182 dbSNP
rs1023003018 3183 dbSNP
rs1274896333 3185 dbSNP
rs761653156 3186 dbSNP
rs1321105418 3191 dbSNP
rs117233699 3196 dbSNP
rs1215869613 3201 dbSNP
rs978855859 3205 dbSNP
rs552177239 3206 dbSNP
rs1188768672 3209 dbSNP
rs149481338 3211 dbSNP
rs144087240 3213 dbSNP
rs1373664960 3216 dbSNP
rs1324367009 3223 dbSNP
rs969004236 3232 dbSNP
rs748696817 3238 dbSNP
rs1355667365 3249 dbSNP
rs1172591676 3250 dbSNP
rs1408298245 3258 dbSNP
rs934301719 3264 dbSNP
rs560962133 3265 dbSNP
rs750130219 3269 dbSNP
rs778049363 3279 dbSNP
rs922319044 3282 dbSNP
rs1254631779 3286 dbSNP
rs1191562285 3287 dbSNP
rs1488106966 3294 dbSNP
rs1180891019 3303 dbSNP
rs1205963041 3309 dbSNP
rs1435575206 3311 dbSNP
rs1415255494 3324 dbSNP
rs911033683 3334 dbSNP
rs1234553845 3338 dbSNP
rs554118750 3342 dbSNP
rs1473261119 3344 dbSNP
rs1301662536 3353 dbSNP
rs1159281799 3366 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUA--AUACACGACGAu 5'
            |||: |||  ||| ||||||| 
Target 5' uaCAAGACAUGAUAU-UGCUGCUu 3'
11 - 33
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000237264.4 | 3UTR | AAAGGAAGUUUACAAGACAUGAUAUUGCUGCUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.623 1.7e-3 0.726 1.5e-4 20 Click to see details
GSE32688 Pancreatic cancer 0.453 4.6e-3 0.394 1.3e-2 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.456 1.3e-2 -0.401 2.6e-2 24 Click to see details
GSE19536 Breast cancer -0.22 1.4e-2 -0.245 7.0e-3 100 Click to see details
GSE19783 ER- ER- breast cancer -0.188 4.9e-2 -0.246 1.4e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.328 5.5e-2 0.324 5.7e-2 25 Click to see details
GSE17306 Multiple myeloma 0.22 6.4e-2 0.173 1.2e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.316 7.1e-2 0.242 1.3e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.419 7.7e-2 -0.324 1.4e-1 13 Click to see details
GSE38226 Liver fibrosis 0.201 1.9e-1 0.347 6.2e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.261 2.1e-1 -0.014 4.8e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.166 2.4e-1 -0.168 2.4e-1 20 Click to see details
GSE21032 Prostate cancer 0.066 2.8e-1 0.017 4.4e-1 83 Click to see details
GSE21687 Ependynoma primary tumors -0.064 3.1e-1 -0.155 1.1e-1 64 Click to see details
GSE27834 Pluripotent stem cells -0.097 3.6e-1 -0.024 4.6e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.038 3.6e-1 0.029 3.9e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.058 3.9e-1 0.022 4.6e-1 25 Click to see details
GSE28544 Breast cancer 0.047 4.1e-1 0.105 3.1e-1 24 Click to see details
GSE21849 B cell lymphoma 0.041 4.2e-1 -0.008 4.8e-1 29 Click to see details
GSE17498 Multiple myeloma -0.034 4.2e-1 -0.110 2.5e-1 40 Click to see details
GSE17498 Multiple myeloma -0.034 4.2e-1 -0.110 2.5e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PCPG 0.981 0.06 1.000 0.5 3 Click to see details
CHOL 0.4 0.14 0.350 0.18 9 Click to see details
KICH -0.205 0.16 -0.182 0.19 25 Click to see details
STAD 0.178 0.16 0.210 0.12 32 Click to see details
KIRC 0.11 0.19 0.035 0.39 68 Click to see details
LIHC -0.11 0.23 -0.130 0.19 49 Click to see details
LUAD 0.24 0.23 -0.042 0.45 12 Click to see details
THCA 0.09 0.25 0.048 0.36 59 Click to see details
COAD -0.274 0.26 -0.452 0.13 8 Click to see details
CESC 0.646 0.28 0.500 0.33 3 Click to see details
PAAD -0.362 0.32 -0.200 0.4 4 Click to see details
PRAD 0.062 0.33 0.022 0.44 50 Click to see details
BRCA 0.042 0.35 0.122 0.13 84 Click to see details
UCEC 0.082 0.37 0.061 0.4 19 Click to see details
ESCA 0.074 0.41 -0.064 0.43 11 Click to see details
KIRP 0.029 0.44 0.066 0.36 32 Click to see details
HNSC 0.024 0.44 0.083 0.3 42 Click to see details
BLCA 0.023 0.46 0.158 0.27 18 Click to see details
LUSC -0.008 0.48 0.172 0.15 38 Click to see details
LUSC -0.008 0.48 0.172 0.15 38 Click to see details
LUSC -0.008 0.48 0.172 0.15 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*