miRTarBase - #MIRT211314 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HSPA4L   
Synonyms APG-1, HSPH3, Osp94
Description heat shock protein family A (Hsp70) member 4 like
Transcript NM_014278   
Expression
Putative miRNA Targets on HSPA4L
3'UTR of HSPA4L
(miRNA target sites are highlighted)
>HSPA4L|NM_014278|3'UTR
   1 GTCTTAATTTTACCTTCACATTAATTCAAACCGTGCAAGTAACCACGGGGTCCATCTTTTACATCTGGTACACACAACAG
  81 ACGCTCAGTTGTTCTTAACCACTTTTGTCATTTGTTTTTTGGAGTAGTTTTGAAAAGTGTTTTATATTGAGTGCACTTCT
 161 GTTCATTTCCATTGCTGCTTATATGCAGTGTTAGCCGAATTAGATTTACAAGACAATCTAAGCTTTCCGGATAATTTTAT
 241 ATATCAAACATACAGGATGGATACATAGTTGGCAACAGTCTACCTTATTTAAAGCTTCTACTGGGATAAACCTCAATTCC
 321 TTTATTCAGGAAAGGATACTTTATTGCATTATTGTTGCAGAAGCATAGATTTAATTGCATCTTTATTTTGAAAAACAAAT
 401 GAAAATTGATGGGGTTTAAAGCTACAGAGGCACTGACCTTTTTCTAGTTATTGTATTGCTACAATTTAAATATTAAAACA
 481 AATAAGAGCTTTCTCAACAAATTAGTCCATCTCATTGATGTACCACAGAAATCCAAAGCTTTGCTGTCATCACATAAATG
 561 AATTAAATCACATGTGAAAGGGAACACACCCAATTTTATGTTAAGGTGAAACCAGCAGTTTGCTTCTTTTATTAGTAATG
 641 TGGATTGATGTTTTCTCAGAGTAACTCGTTGTCTTTTCGCTTGAAATTTTTGATCTTGTCCTGAAGACTAGCTGCTGCTA
 721 AAACAATGCTAGCCTAAAGATACAGGAGTCTCTGACAAAATGACTTTCATGTTAAGGGGAAATGCTGTTTATCTACTCAG
 801 ACATGCATCTGTGATGTTCATAGCCTTGTTTCAGTTATAATAGTTGTCTTGTTTTTTTCTTAATTGATTTTGTTAATAAT
 881 ACCTTAACACAGGGTAGGAAGAAGTGGCACAGTGTATTGCATTATATACATTTATCATTGATTTACCTAATGTTACCTTG
 961 TAGATTAAACACTATTAAGTGGTAATACTTGAAAAGGAGCACTTATACCATAAGTCTTAGGAAATAATGTTTGTAATAAA
1041 CTTAACTATGTTACATATCAACAGGCAAAAATATAGAATGTTACATAGTGTTGTGTGATTAAATTATAGTTCCTGCTGTT
1121 AACATTACCTTTTGAAACCTTGGCTCCAGTTTTGGTGCTTCTTATACAAATTAAATGCGAAAAGGGACTGTAAACTTAAA
1201 AAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAA---UACACGACGAu 5'
                :||||   || ||||||| 
Target 5' ttctgtTCATTTCCAT-TGCTGCTt 3'
157 - 180 151.00 -13.70
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | :|  | ||  ||||||| 
Target 5' tcCTGAAGACTAGCTGCTGCTa 3'
699 - 720 148.00 -13.30
3
miRNA  3' guGUUUGGUAAUA--CACGACGAu 5'
            :|||::|| :|   |||||:| 
Target 5' atTAAATTATAGTTCCTGCTGTTa 3'
1098 - 1121 142.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1633447 1 COSMIC
COSN30502209 14 COSMIC
COSN31605836 23 COSMIC
COSN26979437 33 COSMIC
COSN30119127 34 COSMIC
COSN31603206 47 COSMIC
COSN31536888 70 COSMIC
COSN30539031 108 COSMIC
COSN30172888 126 COSMIC
COSN31532646 171 COSMIC
COSN16774362 198 COSMIC
COSN19660694 331 COSMIC
COSN5052265 722 COSMIC
COSN25994643 1679 COSMIC
COSN21384882 2362 COSMIC
COSN22822405 2611 COSMIC
COSN27033235 3362 COSMIC
COSN17338958 3584 COSMIC
COSN17591552 3585 COSMIC
COSN7773524 3632 COSMIC
COSN17503053 4069 COSMIC
COSN16956989 4689 COSMIC
COSN20977220 4808 COSMIC
COSN1987749 4998 COSMIC
COSN5552275 5068 COSMIC
COSN19489263 5339 COSMIC
COSN23354321 5484 COSMIC
COSN17802837 5636 COSMIC
COSN23305852 6051 COSMIC
COSN19188832 6663 COSMIC
COSN7731480 6808 COSMIC
COSN18946851 6977 COSMIC
COSN5151938 7399 COSMIC
rs187279821 3355 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201654252 1 dbSNP
rs74670156 9 dbSNP
rs77683623 10 dbSNP
rs78599618 11 dbSNP
rs751542982 12 dbSNP
rs1243616824 13 dbSNP
rs759490435 15 dbSNP
rs910509773 19 dbSNP
rs767314277 22 dbSNP
rs1206669181 23 dbSNP
rs1259300578 25 dbSNP
rs1446002574 28 dbSNP
rs1183671718 29 dbSNP
rs3775983 32 dbSNP
rs755810836 33 dbSNP
rs778119980 34 dbSNP
rs1368399415 36 dbSNP
rs1454688860 37 dbSNP
rs1290944017 42 dbSNP
rs1383083378 44 dbSNP
rs754005316 47 dbSNP
rs773748159 48 dbSNP
rs779114144 51 dbSNP
rs1385146611 53 dbSNP
rs531797451 55 dbSNP
rs965155280 63 dbSNP
rs975529567 71 dbSNP
rs1365704231 78 dbSNP
rs1159989081 79 dbSNP
rs1423288921 83 dbSNP
rs1194369871 84 dbSNP
rs759199099 99 dbSNP
rs1462114243 101 dbSNP
rs929499620 111 dbSNP
rs1047860044 117 dbSNP
rs1463289554 118 dbSNP
rs887539299 123 dbSNP
rs921030821 135 dbSNP
rs1215967047 159 dbSNP
rs1320573945 162 dbSNP
rs1309884789 174 dbSNP
rs932118743 177 dbSNP
rs1468646700 178 dbSNP
rs550376289 184 dbSNP
rs1296625078 189 dbSNP
rs568655912 197 dbSNP
rs941740095 198 dbSNP
rs529630583 202 dbSNP
rs547691887 207 dbSNP
rs1052431215 210 dbSNP
rs182705917 216 dbSNP
rs539064794 229 dbSNP
rs557418743 230 dbSNP
rs949419177 239 dbSNP
rs1187107518 240 dbSNP
rs1045524456 242 dbSNP
rs1392232825 249 dbSNP
rs569763285 258 dbSNP
rs1263475387 261 dbSNP
rs995731690 264 dbSNP
rs532675997 268 dbSNP
rs1462912600 270 dbSNP
rs1487915683 281 dbSNP
rs1326462242 285 dbSNP
rs1334714093 298 dbSNP
rs1224006835 301 dbSNP
rs1360133713 311 dbSNP
rs1439382950 314 dbSNP
rs1273787965 315 dbSNP
rs188467211 317 dbSNP
rs1327969196 324 dbSNP
rs1295958507 329 dbSNP
rs999378843 333 dbSNP
rs1032149143 338 dbSNP
rs1365710244 364 dbSNP
rs1305059695 365 dbSNP
rs1373528710 366 dbSNP
rs1233078277 369 dbSNP
rs1271614662 371 dbSNP
rs1463925926 391 dbSNP
rs767274290 396 dbSNP
rs990600690 401 dbSNP
rs1432258896 402 dbSNP
rs1266297527 410 dbSNP
rs1201007221 412 dbSNP
rs1490369422 415 dbSNP
rs1017679730 416 dbSNP
rs1214911206 454 dbSNP
rs965100707 455 dbSNP
rs573764678 463 dbSNP
rs1272906782 471 dbSNP
rs1436216160 475 dbSNP
rs1232201772 476 dbSNP
rs887019727 479 dbSNP
rs923542243 480 dbSNP
rs541282151 483 dbSNP
rs1349961002 485 dbSNP
rs1306184036 488 dbSNP
rs1393676324 494 dbSNP
rs1172409593 496 dbSNP
rs1464830007 501 dbSNP
rs1426850251 507 dbSNP
rs1183995897 510 dbSNP
rs1178126932 516 dbSNP
rs950937704 523 dbSNP
rs1410591336 524 dbSNP
rs1179001219 531 dbSNP
rs1439516048 539 dbSNP
rs1251131700 547 dbSNP
rs983589749 554 dbSNP
rs1004126783 561 dbSNP
rs138956979 564 dbSNP
rs965382438 565 dbSNP
rs1264705226 576 dbSNP
rs192988023 581 dbSNP
rs1186997849 593 dbSNP
rs1415448735 598 dbSNP
rs1476054421 599 dbSNP
rs1224356541 604 dbSNP
rs1040307849 613 dbSNP
rs1395683719 616 dbSNP
rs1407723826 618 dbSNP
rs1028472919 619 dbSNP
rs942208260 620 dbSNP
rs1334079912 646 dbSNP
rs546253814 647 dbSNP
rs184002196 651 dbSNP
rs1291030236 667 dbSNP
rs916320516 668 dbSNP
rs979588104 668 dbSNP
rs142672110 669 dbSNP
rs1270132403 670 dbSNP
rs1337952340 674 dbSNP
rs1364366466 679 dbSNP
rs935486630 680 dbSNP
rs1273753774 681 dbSNP
rs988356129 682 dbSNP
rs1209058727 691 dbSNP
rs543643357 693 dbSNP
rs562267046 706 dbSNP
rs1204007042 710 dbSNP
rs1464652616 716 dbSNP
rs918185578 721 dbSNP
rs1188314354 733 dbSNP
rs1207038710 735 dbSNP
rs542252261 739 dbSNP
rs1053623134 745 dbSNP
rs1372447692 746 dbSNP
rs1316202224 753 dbSNP
rs893670422 753 dbSNP
rs1006711255 758 dbSNP
rs367812857 772 dbSNP
rs1419669769 776 dbSNP
rs1018129473 778 dbSNP
rs964801583 780 dbSNP
rs1310768318 782 dbSNP
rs997483671 783 dbSNP
rs1376824256 787 dbSNP
rs778116252 794 dbSNP
rs1030252415 803 dbSNP
rs188900450 804 dbSNP
rs1325232404 805 dbSNP
rs1230313864 806 dbSNP
rs1195617095 807 dbSNP
rs905263874 812 dbSNP
rs34549428 819 dbSNP
rs931451153 822 dbSNP
rs73847073 829 dbSNP
rs1220291695 833 dbSNP
rs1232180280 835 dbSNP
rs1362283927 838 dbSNP
rs1293105397 839 dbSNP
rs886903633 843 dbSNP
rs916337042 849 dbSNP
rs963910984 849 dbSNP
rs990987486 849 dbSNP
rs949087575 850 dbSNP
rs1004010728 852 dbSNP
rs1367445663 857 dbSNP
rs1260821043 860 dbSNP
rs566045367 865 dbSNP
rs1164117698 866 dbSNP
rs1445041504 868 dbSNP
rs1019461300 875 dbSNP
rs1194464056 881 dbSNP
rs1417134959 882 dbSNP
rs1169392644 891 dbSNP
rs901112961 893 dbSNP
rs532748389 896 dbSNP
rs996902906 922 dbSNP
rs551010958 925 dbSNP
rs1490860738 927 dbSNP
rs1453271310 930 dbSNP
rs1205074392 933 dbSNP
rs1306224762 940 dbSNP
rs1275575023 948 dbSNP
rs1215498643 957 dbSNP
rs760527917 962 dbSNP
rs1339703890 964 dbSNP
rs1171136565 965 dbSNP
rs1282235668 966 dbSNP
rs968869102 973 dbSNP
rs1346864964 974 dbSNP
rs923564410 975 dbSNP
rs1441431722 984 dbSNP
rs978467014 996 dbSNP
rs1031432028 997 dbSNP
rs1330704772 998 dbSNP
rs1157600709 1001 dbSNP
rs1428943095 1007 dbSNP
rs1174533949 1009 dbSNP
rs1383322231 1010 dbSNP
rs934982389 1024 dbSNP
rs193277683 1030 dbSNP
rs1181485103 1038 dbSNP
rs1479971319 1039 dbSNP
rs1319635990 1049 dbSNP
rs988323698 1065 dbSNP
rs918147045 1068 dbSNP
rs1205744804 1075 dbSNP
rs1442192696 1086 dbSNP
rs1261595503 1088 dbSNP
rs1221308182 1092 dbSNP
rs1007153738 1098 dbSNP
rs1222686652 1098 dbSNP
rs1325195523 1098 dbSNP
rs949693119 1110 dbSNP
rs1371148652 1118 dbSNP
rs981174554 1125 dbSNP
rs1305664730 1130 dbSNP
rs1442735749 1132 dbSNP
rs1348640986 1133 dbSNP
rs537111029 1139 dbSNP
rs562027598 1140 dbSNP
rs369026519 1141 dbSNP
rs1407081050 1145 dbSNP
rs1158524600 1147 dbSNP
rs1410875523 1158 dbSNP
rs1417395195 1158 dbSNP
rs1178294118 1163 dbSNP
rs1048431239 1166 dbSNP
rs1241718336 1170 dbSNP
rs373793158 1179 dbSNP
rs1462417122 1180 dbSNP
rs950750897 1187 dbSNP
rs1268704153 1189 dbSNP
rs534828136 1197 dbSNP
rs1040912287 1208 dbSNP
rs901077391 1216 dbSNP
rs1191241082 1231 dbSNP
rs1312707061 1237 dbSNP
rs1427231092 1237 dbSNP
rs553289576 1248 dbSNP
rs996812898 1256 dbSNP
rs1433242012 1258 dbSNP
rs547891268 1260 dbSNP
rs1050110009 1261 dbSNP
rs578019839 1264 dbSNP
rs1383884484 1278 dbSNP
rs1288494728 1285 dbSNP
rs1451822688 1295 dbSNP
rs904153889 1296 dbSNP
rs1347044738 1299 dbSNP
rs999874000 1300 dbSNP
rs1031399581 1305 dbSNP
rs1361706049 1308 dbSNP
rs1383904621 1309 dbSNP
rs1185855857 1320 dbSNP
rs1445619059 1322 dbSNP
rs373966230 1328 dbSNP
rs1185590390 1330 dbSNP
rs1484653245 1342 dbSNP
rs955800290 1346 dbSNP
rs1023770973 1348 dbSNP
rs1215851307 1354 dbSNP
rs1358688621 1357 dbSNP
rs1289496967 1360 dbSNP
rs1247970886 1366 dbSNP
rs1294500891 1368 dbSNP
rs970468040 1368 dbSNP
rs981898211 1373 dbSNP
rs1364289152 1401 dbSNP
rs1289571299 1414 dbSNP
rs1404378693 1434 dbSNP
rs1394428726 1447 dbSNP
rs1364327558 1453 dbSNP
rs1166007978 1457 dbSNP
rs1425786366 1459 dbSNP
rs1460371522 1476 dbSNP
rs770979880 1478 dbSNP
rs923679039 1479 dbSNP
rs1009727974 1483 dbSNP
rs550822045 1484 dbSNP
rs1371888797 1491 dbSNP
rs989136233 1493 dbSNP
rs1266070001 1499 dbSNP
rs1305137194 1502 dbSNP
rs1224647520 1519 dbSNP
rs1337694690 1526 dbSNP
rs1250580375 1527 dbSNP
rs915155908 1528 dbSNP
rs1309536344 1543 dbSNP
rs558171750 1546 dbSNP
rs971386182 1548 dbSNP
rs981009299 1550 dbSNP
rs1296542924 1552 dbSNP
rs1223050717 1554 dbSNP
rs1268483066 1567 dbSNP
rs1304967866 1588 dbSNP
rs926877474 1589 dbSNP
rs952685802 1590 dbSNP
rs901044135 1592 dbSNP
rs1463842979 1604 dbSNP
rs576366589 1605 dbSNP
rs755113454 1606 dbSNP
rs1479873460 1607 dbSNP
rs570905645 1612 dbSNP
rs1194673963 1614 dbSNP
rs137948322 1620 dbSNP
rs886509021 1625 dbSNP
rs1249703800 1627 dbSNP
rs1452149333 1627 dbSNP
rs1193916327 1632 dbSNP
rs1420456935 1633 dbSNP
rs1183398722 1635 dbSNP
rs1258388759 1638 dbSNP
rs1203283974 1639 dbSNP
rs1041272748 1643 dbSNP
rs1417654288 1644 dbSNP
rs1474421273 1654 dbSNP
rs752285892 1657 dbSNP
rs1167818471 1659 dbSNP
rs1335751169 1667 dbSNP
rs1305491421 1670 dbSNP
rs1350904795 1673 dbSNP
rs1004860683 1676 dbSNP
rs1336430785 1685 dbSNP
rs1468997705 1687 dbSNP
rs1403402991 1688 dbSNP
rs1178027872 1692 dbSNP
rs1478061496 1694 dbSNP
rs1363221166 1703 dbSNP
rs1016240191 1705 dbSNP
rs562060220 1715 dbSNP
rs932483969 1720 dbSNP
rs1182703494 1727 dbSNP
rs1296473852 1736 dbSNP
rs1398948186 1749 dbSNP
rs1392223600 1759 dbSNP
rs775961768 1760 dbSNP
rs756469722 1764 dbSNP
rs1231223784 1772 dbSNP
rs1350054368 1776 dbSNP
rs79514883 1784 dbSNP
rs1223705935 1792 dbSNP
rs970919570 1793 dbSNP
rs1052801292 1810 dbSNP
rs1450882143 1823 dbSNP
rs1380195724 1829 dbSNP
rs982256641 1836 dbSNP
rs891546277 1838 dbSNP
rs115321351 1850 dbSNP
rs1226091550 1853 dbSNP
rs956414566 1863 dbSNP
rs1455307098 1874 dbSNP
rs1401358035 1890 dbSNP
rs1182823490 1893 dbSNP
rs34856181 1908 dbSNP
rs1442543495 1914 dbSNP
rs1024479864 1918 dbSNP
rs1244677290 1920 dbSNP
rs1249076084 1926 dbSNP
rs1481313362 1928 dbSNP
rs1188527108 1929 dbSNP
rs1205497504 1932 dbSNP
rs970887060 1932 dbSNP
rs1256359778 1935 dbSNP
rs1355105340 1943 dbSNP
rs989559396 1951 dbSNP
rs1244318871 1952 dbSNP
rs1002798631 1953 dbSNP
rs914870998 1958 dbSNP
rs1448327381 1967 dbSNP
rs1325444069 1971 dbSNP
rs1033912738 1973 dbSNP
rs1361167491 1979 dbSNP
rs1383404086 1979 dbSNP
rs202125968 1981 dbSNP
rs533488001 1991 dbSNP
rs1374911113 1992 dbSNP
rs942355696 1995 dbSNP
rs1163583253 2017 dbSNP
rs1475232469 2018 dbSNP
rs150283357 2021 dbSNP
rs922508795 2022 dbSNP
rs1312573769 2025 dbSNP
rs1373792430 2040 dbSNP
rs933851853 2044 dbSNP
rs908588985 2048 dbSNP
rs1490969279 2049 dbSNP
rs1291069498 2051 dbSNP
rs777957694 2055 dbSNP
rs1268044909 2069 dbSNP
rs886541804 2077 dbSNP
rs1340614733 2081 dbSNP
rs961361367 2081 dbSNP
rs374886094 2087 dbSNP
rs940754006 2087 dbSNP
rs1403064033 2091 dbSNP
rs1351517274 2092 dbSNP
rs1304324848 2094 dbSNP
rs1038110611 2095 dbSNP
rs899204200 2097 dbSNP
rs867862809 2103 dbSNP
rs1169875073 2106 dbSNP
rs1478237568 2109 dbSNP
rs1428706547 2110 dbSNP
rs1197310305 2115 dbSNP
rs1247774896 2122 dbSNP
rs1381624735 2122 dbSNP
rs1293329991 2134 dbSNP
rs1012655404 2137 dbSNP
rs1228402887 2138 dbSNP
rs1275487229 2140 dbSNP
rs761166479 2152 dbSNP
rs1023919681 2154 dbSNP
rs1318123318 2154 dbSNP
rs1282136581 2156 dbSNP
rs1221129666 2178 dbSNP
rs1279174383 2181 dbSNP
rs1345231392 2185 dbSNP
rs1362154410 2190 dbSNP
rs1275364507 2191 dbSNP
rs906759106 2212 dbSNP
rs1352555882 2220 dbSNP
rs551799587 2223 dbSNP
rs993540771 2227 dbSNP
rs1405580388 2241 dbSNP
rs1485733408 2245 dbSNP
rs922689380 2258 dbSNP
rs1185346787 2259 dbSNP
rs1031139954 2260 dbSNP
rs1425886229 2266 dbSNP
rs932475913 2272 dbSNP
rs1450176297 2275 dbSNP
rs558636862 2284 dbSNP
rs985718433 2286 dbSNP
rs925849265 2287 dbSNP
rs1262108530 2288 dbSNP
rs1457973110 2288 dbSNP
rs935939837 2315 dbSNP
rs1022453897 2317 dbSNP
rs1278641098 2318 dbSNP
rs1223169481 2319 dbSNP
rs1393529147 2324 dbSNP
rs1052770373 2325 dbSNP
rs200462267 2328 dbSNP
rs749746562 2328 dbSNP
rs1447212715 2329 dbSNP
rs1334977302 2330 dbSNP
rs1382376298 2330 dbSNP
rs1177025054 2347 dbSNP
rs1359581752 2352 dbSNP
rs1158431286 2354 dbSNP
rs891430309 2354 dbSNP
rs1399508712 2357 dbSNP
rs1382680111 2359 dbSNP
rs975467902 2366 dbSNP
rs1444395690 2371 dbSNP
rs771349208 2377 dbSNP
rs1181384030 2384 dbSNP
rs1429759366 2387 dbSNP
rs955265317 2392 dbSNP
rs1214416093 2393 dbSNP
rs1315105640 2407 dbSNP
rs774989408 2412 dbSNP
rs1287049993 2414 dbSNP
rs1240704923 2418 dbSNP
rs1367197403 2422 dbSNP
rs563250121 2439 dbSNP
rs982589199 2455 dbSNP
rs1398041212 2465 dbSNP
rs1380123022 2472 dbSNP
rs1288417286 2475 dbSNP
rs1428708291 2479 dbSNP
rs908344483 2481 dbSNP
rs1299346757 2489 dbSNP
rs1302012319 2490 dbSNP
rs771761162 2494 dbSNP
rs115589049 2499 dbSNP
rs62335575 2503 dbSNP
rs920663256 2509 dbSNP
rs948097083 2511 dbSNP
rs1045057721 2517 dbSNP
rs1002358739 2521 dbSNP
rs760437972 2524 dbSNP
rs1033843123 2525 dbSNP
rs888696089 2528 dbSNP
rs906791808 2551 dbSNP
rs567404106 2554 dbSNP
rs1015805857 2555 dbSNP
rs1342465872 2557 dbSNP
rs1298834778 2559 dbSNP
rs961329217 2564 dbSNP
rs1251266192 2566 dbSNP
rs1364219997 2567 dbSNP
rs535712428 2571 dbSNP
rs1003758083 2576 dbSNP
rs1169311400 2578 dbSNP
rs1476610826 2585 dbSNP
rs1029726897 2612 dbSNP
rs1052682648 2616 dbSNP
rs954296949 2631 dbSNP
rs892666449 2653 dbSNP
rs35859209 2659 dbSNP
rs1265167873 2660 dbSNP
rs1211489518 2674 dbSNP
rs1011476715 2679 dbSNP
rs1250493105 2681 dbSNP
rs985305616 2685 dbSNP
rs925818186 2686 dbSNP
rs935824321 2687 dbSNP
rs988694929 2690 dbSNP
rs913166951 2691 dbSNP
rs949725720 2721 dbSNP
rs1390786008 2722 dbSNP
rs1045832910 2723 dbSNP
rs183510219 2726 dbSNP
rs1296773288 2731 dbSNP
rs1022067561 2744 dbSNP
rs546862668 2745 dbSNP
rs964112689 2751 dbSNP
rs1391721830 2759 dbSNP
rs763904038 2771 dbSNP
rs188193008 2772 dbSNP
rs1314629177 2775 dbSNP
rs143521841 2784 dbSNP
rs556976275 2785 dbSNP
rs1222448660 2806 dbSNP
rs1015773221 2810 dbSNP
rs1249591875 2811 dbSNP
rs897423178 2813 dbSNP
rs1290556512 2815 dbSNP
rs1459297317 2816 dbSNP
rs1330208468 2817 dbSNP
rs1258934074 2823 dbSNP
rs554960910 2823 dbSNP
rs576355402 2824 dbSNP
rs537062690 2825 dbSNP
rs111999996 2829 dbSNP
rs1234647630 2829 dbSNP
rs568487837 2829 dbSNP
rs908460095 2829 dbSNP
rs1030112394 2830 dbSNP
rs954155298 2835 dbSNP
rs1451389703 2839 dbSNP
rs1399461785 2840 dbSNP
rs1232541738 2845 dbSNP
rs1173778155 2846 dbSNP
rs1468759415 2850 dbSNP
rs555812651 2851 dbSNP
rs1179136295 2858 dbSNP
rs1413967885 2859 dbSNP
rs1033104880 2862 dbSNP
rs1156671471 2869 dbSNP
rs1183234441 2874 dbSNP
rs920701953 2874 dbSNP
rs957164316 2875 dbSNP
rs1164209198 2878 dbSNP
rs1392119202 2880 dbSNP
rs1201091581 2881 dbSNP
rs948099757 2882 dbSNP
rs1045092593 2890 dbSNP
rs1242866199 2898 dbSNP
rs1354885328 2899 dbSNP
rs1314742126 2903 dbSNP
rs1243650026 2906 dbSNP
rs927990583 2912 dbSNP
rs1338303237 2916 dbSNP
rs939323391 2919 dbSNP
rs1406617040 2925 dbSNP
rs1384243385 2926 dbSNP
rs988662418 2939 dbSNP
rs558708831 2942 dbSNP
rs1380705491 2944 dbSNP
rs573846576 2951 dbSNP
rs971749415 2961 dbSNP
rs1471962525 2968 dbSNP
rs541219534 2977 dbSNP
rs1188416523 2978 dbSNP
rs34203429 2981 dbSNP
rs926912030 2989 dbSNP
rs1261050911 2991 dbSNP
rs1351554922 2992 dbSNP
rs937029031 3002 dbSNP
rs1488879974 3010 dbSNP
rs1291554783 3012 dbSNP
rs1208408318 3017 dbSNP
rs1353890881 3018 dbSNP
rs1285583556 3021 dbSNP
rs1244974711 3025 dbSNP
rs1232979638 3026 dbSNP
rs1289940145 3028 dbSNP
rs1048769693 3030 dbSNP
rs1359017533 3035 dbSNP
rs908982236 3036 dbSNP
rs143967177 3037 dbSNP
rs1164063841 3040 dbSNP
rs1037188032 3050 dbSNP
rs897395299 3052 dbSNP
rs1044256402 3059 dbSNP
rs1421618037 3060 dbSNP
rs998884062 3068 dbSNP
rs1478461833 3070 dbSNP
rs1268782901 3071 dbSNP
rs1272427421 3073 dbSNP
rs1436129544 3076 dbSNP
rs1207632483 3081 dbSNP
rs1051354758 3087 dbSNP
rs1290959390 3090 dbSNP
rs889753671 3092 dbSNP
rs1483263230 3098 dbSNP
rs1316874707 3102 dbSNP
rs1006911702 3106 dbSNP
rs750415104 3107 dbSNP
rs1473717670 3113 dbSNP
rs781714891 3117 dbSNP
rs1274188010 3124 dbSNP
rs191497778 3135 dbSNP
rs1332634581 3136 dbSNP
rs1323926008 3137 dbSNP
rs1465335935 3142 dbSNP
rs1398348441 3145 dbSNP
rs1172984460 3148 dbSNP
rs545656807 3150 dbSNP
rs1010061543 3154 dbSNP
rs890827362 3161 dbSNP
rs1003822523 3162 dbSNP
rs563844410 3170 dbSNP
rs1247686344 3176 dbSNP
rs1181511436 3178 dbSNP
rs537426555 3182 dbSNP
rs1235978216 3183 dbSNP
rs1200070827 3189 dbSNP
rs1370776210 3192 dbSNP
rs1277236062 3193 dbSNP
rs1414608301 3194 dbSNP
rs1311412441 3195 dbSNP
rs1342598342 3198 dbSNP
rs1347001618 3200 dbSNP
rs1449428952 3200 dbSNP
rs530510543 3201 dbSNP
rs1337536280 3202 dbSNP
rs1230693562 3203 dbSNP
rs1275690292 3207 dbSNP
rs184154430 3213 dbSNP
rs1347399914 3214 dbSNP
rs1375041441 3214 dbSNP
rs1209938693 3215 dbSNP
rs981730420 3223 dbSNP
rs1358674114 3224 dbSNP
rs1173988752 3227 dbSNP
rs570371129 3228 dbSNP
rs375439885 3229 dbSNP
rs984443648 3232 dbSNP
rs1474176482 3233 dbSNP
rs1169917435 3234 dbSNP
rs148660282 3244 dbSNP
rs928018689 3245 dbSNP
rs1433750253 3255 dbSNP
rs546726000 3259 dbSNP
rs368339581 3260 dbSNP
rs372475811 3261 dbSNP
rs1318322779 3264 dbSNP
rs1325185653 3265 dbSNP
rs1351247697 3266 dbSNP
rs1311115060 3268 dbSNP
rs538475067 3269 dbSNP
rs550814858 3270 dbSNP
rs1298381200 3271 dbSNP
rs1370284963 3276 dbSNP
rs1344034501 3277 dbSNP
rs1232395402 3283 dbSNP
rs1051757905 3284 dbSNP
rs946926331 3285 dbSNP
rs552741446 3290 dbSNP
rs190199861 3291 dbSNP
rs1283540051 3292 dbSNP
rs1054491099 3293 dbSNP
rs555521482 3295 dbSNP
rs1179674009 3297 dbSNP
rs1473495973 3298 dbSNP
rs573708491 3301 dbSNP
rs1237495954 3303 dbSNP
rs893219116 3305 dbSNP
rs1050830008 3306 dbSNP
rs890858579 3309 dbSNP
rs1010285661 3310 dbSNP
rs577557870 3311 dbSNP
rs1379001130 3312 dbSNP
rs1380014966 3313 dbSNP
rs971608739 3318 dbSNP
rs1398740631 3319 dbSNP
rs1299252257 3321 dbSNP
rs181856000 3321 dbSNP
rs544637773 3322 dbSNP
rs1383487624 3326 dbSNP
rs553074068 3328 dbSNP
rs1321749133 3331 dbSNP
rs1192260639 3337 dbSNP
rs1265244203 3338 dbSNP
rs1476826860 3338 dbSNP
rs577782662 3350 dbSNP
rs1022874189 3351 dbSNP
rs969906164 3353 dbSNP
rs187279821 3355 dbSNP
rs1035119829 3356 dbSNP
rs754836243 3357 dbSNP
rs1015921328 3360 dbSNP
rs557611458 3361 dbSNP
rs988150115 3362 dbSNP
rs553890251 3363 dbSNP
rs913854581 3364 dbSNP
rs1386646684 3365 dbSNP
rs972191033 3366 dbSNP
rs573998201 3367 dbSNP
rs1210531306 3368 dbSNP
rs1356164501 3369 dbSNP
rs542914978 3370 dbSNP
rs987010076 3374 dbSNP
rs921513490 3376 dbSNP
rs911451457 3383 dbSNP
rs1432485662 3384 dbSNP
rs1265057737 3386 dbSNP
rs942967843 3387 dbSNP
rs1469121228 3402 dbSNP
rs371235056 3410 dbSNP
rs893107813 3411 dbSNP
rs946042756 3416 dbSNP
rs1042170528 3418 dbSNP
rs907308423 3419 dbSNP
rs1036779468 3424 dbSNP
rs1003104193 3425 dbSNP
rs528095555 3426 dbSNP
rs1034218350 3429 dbSNP
rs540301026 3430 dbSNP
rs1006053575 3431 dbSNP
rs1417763888 3432 dbSNP
rs1330284474 3440 dbSNP
rs1016144917 3442 dbSNP
rs1295334720 3443 dbSNP
rs1167962772 3445 dbSNP
rs961663274 3448 dbSNP
rs375468490 3449 dbSNP
rs1030477038 3450 dbSNP
rs564986158 3451 dbSNP
rs1229998895 3455 dbSNP
rs954515047 3456 dbSNP
rs987367437 3457 dbSNP
rs756310861 3458 dbSNP
rs1334042969 3459 dbSNP
rs562749109 3460 dbSNP
rs1266730879 3463 dbSNP
rs1488492330 3470 dbSNP
rs1482595219 3471 dbSNP
rs1044727557 3472 dbSNP
rs532316265 3473 dbSNP
rs1002718540 3479 dbSNP
rs990370896 3480 dbSNP
rs914845358 3481 dbSNP
rs1329018208 3489 dbSNP
rs1394945469 3494 dbSNP
rs559554757 3494 dbSNP
rs561777265 3494 dbSNP
rs1304525627 3500 dbSNP
rs946011746 3504 dbSNP
rs1041747677 3510 dbSNP
rs1156579509 3514 dbSNP
rs1441828005 3517 dbSNP
rs1364583915 3519 dbSNP
rs1249077914 3528 dbSNP
rs1484277701 3543 dbSNP
rs1422149926 3555 dbSNP
rs550527045 3562 dbSNP
rs1183328901 3563 dbSNP
rs1257487375 3568 dbSNP
rs907270567 3569 dbSNP
rs1167471678 3572 dbSNP
rs1284390313 3575 dbSNP
rs1369143852 3578 dbSNP
rs938817185 3578 dbSNP
rs1461489691 3580 dbSNP
rs1167022127 3583 dbSNP
rs1294546774 3584 dbSNP
rs143823414 3584 dbSNP
rs1491464748 3584 dbSNP
rs375617477 3584 dbSNP
rs552800518 3584 dbSNP
rs1491517049 3585 dbSNP
rs190271609 3585 dbSNP
rs181961093 3586 dbSNP
rs567295993 3587 dbSNP
rs940182648 3588 dbSNP
rs1354540524 3591 dbSNP
rs1394240510 3592 dbSNP
rs897771967 3593 dbSNP
rs185139305 3594 dbSNP
rs754150393 3596 dbSNP
rs993557665 3600 dbSNP
rs1030032645 3608 dbSNP
rs1447954149 3614 dbSNP
rs954612927 3617 dbSNP
rs1289547191 3632 dbSNP
rs1208899130 3634 dbSNP
rs1353777376 3638 dbSNP
rs1274557250 3640 dbSNP
rs1233347786 3643 dbSNP
rs575024423 3643 dbSNP
rs1226050582 3650 dbSNP
rs1007272417 3660 dbSNP
rs189852446 3661 dbSNP
rs182663482 3662 dbSNP
rs1257289274 3673 dbSNP
rs905787821 3675 dbSNP
rs1482450015 3677 dbSNP
rs1165837007 3680 dbSNP
rs1002752792 3701 dbSNP
rs990340070 3706 dbSNP
rs914814283 3707 dbSNP
rs1246528742 3713 dbSNP
rs967688608 3721 dbSNP
rs1197168143 3722 dbSNP
rs539220813 3723 dbSNP
rs1257478552 3725 dbSNP
rs891668978 3726 dbSNP
rs1213853707 3728 dbSNP
rs1428055062 3734 dbSNP
rs1010060753 3738 dbSNP
rs928613195 3758 dbSNP
rs1216299346 3761 dbSNP
rs1430680910 3771 dbSNP
rs968137966 3774 dbSNP
rs1274090944 3784 dbSNP
rs1230792931 3791 dbSNP
rs938687474 3800 dbSNP
rs186500941 3803 dbSNP
rs916017133 3811 dbSNP
rs941852417 3813 dbSNP
rs370150270 3814 dbSNP
rs1398237054 3817 dbSNP
rs1304580994 3821 dbSNP
rs575804406 3830 dbSNP
rs1037526407 3831 dbSNP
rs1433772056 3843 dbSNP
rs954041379 3846 dbSNP
rs1294813265 3865 dbSNP
rs897739166 3868 dbSNP
rs987045159 3870 dbSNP
rs912799333 3871 dbSNP
rs1396007951 3872 dbSNP
rs1366686066 3874 dbSNP
rs779542086 3876 dbSNP
rs1052119474 3879 dbSNP
rs557637919 3895 dbSNP
rs1205992366 3897 dbSNP
rs1438397679 3904 dbSNP
rs1277842924 3906 dbSNP
rs1217351224 3909 dbSNP
rs1349818728 3913 dbSNP
rs1279087184 3918 dbSNP
rs1310882098 3920 dbSNP
rs890098539 3934 dbSNP
rs1007655280 3935 dbSNP
rs1017347703 3941 dbSNP
rs1239745784 3943 dbSNP
rs369713883 3950 dbSNP
rs1281400949 3951 dbSNP
rs957802325 3960 dbSNP
rs1358580891 3967 dbSNP
rs919683471 3969 dbSNP
rs1011741739 3979 dbSNP
rs1437071051 3980 dbSNP
rs1376487232 3982 dbSNP
rs1158397741 3983 dbSNP
rs1438758740 3997 dbSNP
rs931042665 4002 dbSNP
rs1178512041 4008 dbSNP
rs746421633 4012 dbSNP
rs1207341956 4015 dbSNP
rs1236335624 4016 dbSNP
rs1250005420 4019 dbSNP
rs1207978229 4020 dbSNP
rs1486591757 4037 dbSNP
rs1450099129 4039 dbSNP
rs1215605546 4041 dbSNP
rs967950623 4043 dbSNP
rs1044458090 4050 dbSNP
rs1286616236 4052 dbSNP
rs1224484773 4056 dbSNP
rs1378559835 4057 dbSNP
rs926985959 4065 dbSNP
rs1193246686 4067 dbSNP
rs1356646761 4068 dbSNP
rs1160870866 4069 dbSNP
rs564468017 4069 dbSNP
rs891701435 4069 dbSNP
rs977666410 4069 dbSNP
rs542904213 4070 dbSNP
rs1431284267 4071 dbSNP
rs928896300 4077 dbSNP
rs1258128657 4078 dbSNP
rs75562257 4080 dbSNP
rs1177935565 4081 dbSNP
rs1359488930 4086 dbSNP
rs1456665195 4089 dbSNP
rs1262219746 4090 dbSNP
rs1216811058 4092 dbSNP
rs771673253 4093 dbSNP
rs1287892159 4097 dbSNP
rs771083762 4108 dbSNP
rs1318395131 4112 dbSNP
rs1390214050 4123 dbSNP
rs779013625 4124 dbSNP
rs915984762 4138 dbSNP
rs1435183592 4143 dbSNP
rs115141438 4144 dbSNP
rs903945570 4155 dbSNP
rs572840287 4159 dbSNP
rs1365024795 4161 dbSNP
rs1348924738 4163 dbSNP
rs191755708 4166 dbSNP
rs1302448369 4169 dbSNP
rs768195536 4171 dbSNP
rs540262395 4176 dbSNP
rs1169901279 4179 dbSNP
rs1426621832 4180 dbSNP
rs889810398 4184 dbSNP
rs564950100 4186 dbSNP
rs1488317038 4197 dbSNP
rs1008162514 4200 dbSNP
rs761496639 4203 dbSNP
rs1465450868 4205 dbSNP
rs1468985859 4207 dbSNP
rs1257464454 4210 dbSNP
rs1217383305 4211 dbSNP
rs1309754019 4213 dbSNP
rs1213125938 4218 dbSNP
rs1019841743 4219 dbSNP
rs1245246354 4226 dbSNP
rs1489568456 4245 dbSNP
rs1442586464 4251 dbSNP
rs961620565 4252 dbSNP
rs1330053193 4270 dbSNP
rs973319267 4278 dbSNP
rs1425631582 4279 dbSNP
rs1170982445 4285 dbSNP
rs1027116459 4292 dbSNP
rs919058362 4295 dbSNP
rs769676733 4297 dbSNP
rs1051662664 4299 dbSNP
rs773102526 4302 dbSNP
rs1237703690 4319 dbSNP
rs1156942945 4327 dbSNP
rs1414076835 4328 dbSNP
rs927016571 4332 dbSNP
rs1481943036 4335 dbSNP
rs772679813 4338 dbSNP
rs992472609 4356 dbSNP
rs369006394 4357 dbSNP
rs1306031915 4358 dbSNP
rs913155772 4361 dbSNP
rs111845184 4371 dbSNP
rs373148045 4372 dbSNP
rs893555392 4373 dbSNP
rs1397940663 4378 dbSNP
rs1298703843 4381 dbSNP
rs1010618354 4382 dbSNP
rs931792184 4394 dbSNP
rs1175263795 4401 dbSNP
rs1454912404 4402 dbSNP
rs1350257599 4407 dbSNP
rs767535197 4427 dbSNP
rs752786784 4438 dbSNP
rs562498632 4441 dbSNP
rs1049821035 4455 dbSNP
rs999448570 4456 dbSNP
rs1227848783 4458 dbSNP
rs1282973908 4459 dbSNP
rs529924171 4459 dbSNP
rs1212038590 4462 dbSNP
rs1353356696 4466 dbSNP
rs183326681 4469 dbSNP
rs1287848515 4472 dbSNP
rs1236373078 4473 dbSNP
rs1307052166 4476 dbSNP
rs889844859 4476 dbSNP
rs1395437694 4482 dbSNP
rs548047878 4484 dbSNP
rs566465768 4486 dbSNP
rs991441784 4487 dbSNP
rs897401925 4494 dbSNP
rs763219061 4495 dbSNP
rs1157065579 4501 dbSNP
rs1232518241 4505 dbSNP
rs1455504436 4505 dbSNP
rs1364499887 4513 dbSNP
rs994470173 4514 dbSNP
rs1474551576 4521 dbSNP
rs1022961411 4528 dbSNP
rs963351358 4529 dbSNP
rs1260234429 4534 dbSNP
rs1482640502 4545 dbSNP
rs1189197426 4550 dbSNP
rs562774832 4557 dbSNP
rs528446090 4564 dbSNP
rs1260042816 4571 dbSNP
rs1253939207 4572 dbSNP
rs761113186 4574 dbSNP
rs1203052630 4580 dbSNP
rs1469194003 4581 dbSNP
rs973426607 4585 dbSNP
rs1472896006 4591 dbSNP
rs1232141942 4600 dbSNP
rs1331933974 4618 dbSNP
rs1162532984 4619 dbSNP
rs1411011926 4624 dbSNP
rs952939271 4625 dbSNP
rs1406534076 4628 dbSNP
rs1315923086 4629 dbSNP
rs866189759 4635 dbSNP
rs980248264 4654 dbSNP
rs919353733 4657 dbSNP
rs1385928294 4664 dbSNP
rs546637414 4666 dbSNP
rs1162821377 4673 dbSNP
rs571703854 4676 dbSNP
rs929135347 4681 dbSNP
rs1034122013 4688 dbSNP
rs1166328187 4693 dbSNP
rs538717902 4696 dbSNP
rs1244948176 4708 dbSNP
rs987739119 4713 dbSNP
rs1351440856 4715 dbSNP
rs1447966435 4720 dbSNP
rs1195769701 4727 dbSNP
rs1282876973 4730 dbSNP
rs557429815 4732 dbSNP
rs959750995 4734 dbSNP
rs1466765778 4736 dbSNP
rs1228952927 4737 dbSNP
rs992503710 4738 dbSNP
rs1338642093 4743 dbSNP
rs1268257324 4753 dbSNP
rs1229346786 4760 dbSNP
rs1326746716 4761 dbSNP
rs1274253574 4766 dbSNP
rs1325506397 4767 dbSNP
rs569322675 4779 dbSNP
rs1438932447 4786 dbSNP
rs188731801 4786 dbSNP
rs768996236 4790 dbSNP
rs943304860 4792 dbSNP
rs555283926 4807 dbSNP
rs945694359 4812 dbSNP
rs978728544 4816 dbSNP
rs925842595 4817 dbSNP
rs931831897 4818 dbSNP
rs1438127755 4820 dbSNP
rs1038969816 4823 dbSNP
rs1192649557 4827 dbSNP
rs1452149979 4832 dbSNP
rs1235659012 4840 dbSNP
rs1473526147 4842 dbSNP
rs893440605 4843 dbSNP
rs1213756529 4852 dbSNP
rs757534146 4853 dbSNP
rs1389205506 4859 dbSNP
rs911314614 4864 dbSNP
rs1427454479 4873 dbSNP
rs1170040303 4880 dbSNP
rs1270814159 4890 dbSNP
rs946377611 4890 dbSNP
rs1197436415 4896 dbSNP
rs1371566887 4899 dbSNP
rs114573743 4916 dbSNP
rs902286353 4917 dbSNP
rs533764219 4918 dbSNP
rs1342761156 4924 dbSNP
rs1448901127 4925 dbSNP
rs1048664561 4929 dbSNP
rs1331482857 4929 dbSNP
rs546889911 4929 dbSNP
rs888675530 4931 dbSNP
rs896067358 4932 dbSNP
rs1396502378 4933 dbSNP
rs1034485267 4935 dbSNP
rs560281525 4939 dbSNP
rs959781829 4939 dbSNP
rs558228806 4940 dbSNP
rs779456223 4945 dbSNP
rs1279418662 4949 dbSNP
rs1298517932 4950 dbSNP
rs750916428 4959 dbSNP
rs1199649345 4961 dbSNP
rs973398579 4962 dbSNP
rs1276472953 4965 dbSNP
rs1026384438 4971 dbSNP
rs1444031752 4973 dbSNP
rs1204175463 4988 dbSNP
rs13116298 4993 dbSNP
rs1378765594 5003 dbSNP
rs950898310 5005 dbSNP
rs1355369291 5010 dbSNP
rs1311513256 5012 dbSNP
rs1417015531 5014 dbSNP
rs987319080 5033 dbSNP
rs1020439398 5036 dbSNP
rs1399727086 5052 dbSNP
rs967091353 5058 dbSNP
rs911672544 5062 dbSNP
rs1246901105 5064 dbSNP
rs576778968 5068 dbSNP
rs1256727354 5072 dbSNP
rs1190187781 5080 dbSNP
rs978808160 5081 dbSNP
rs1390394087 5082 dbSNP
rs1257912320 5086 dbSNP
rs974627413 5088 dbSNP
rs915178225 5094 dbSNP
rs1404752350 5097 dbSNP
rs1415571735 5104 dbSNP
rs953262690 5106 dbSNP
rs985928795 5121 dbSNP
rs1417119949 5122 dbSNP
rs1320402520 5125 dbSNP
rs1356549541 5127 dbSNP
rs1386548491 5131 dbSNP
rs1437359037 5150 dbSNP
rs1321536552 5162 dbSNP
rs1343071279 5167 dbSNP
rs1319810566 5170 dbSNP
rs1330718203 5179 dbSNP
rs1232306520 5184 dbSNP
rs1272885897 5185 dbSNP
rs1162738562 5186 dbSNP
rs946348342 5187 dbSNP
rs113354942 5198 dbSNP
rs902254892 5209 dbSNP
rs575814010 5210 dbSNP
rs939137633 5219 dbSNP
rs192339414 5220 dbSNP
rs34035451 5220 dbSNP
rs1216696357 5226 dbSNP
rs1442663706 5229 dbSNP
rs1468116180 5230 dbSNP
rs76589892 5231 dbSNP
rs930012382 5236 dbSNP
rs1210035768 5237 dbSNP
rs1336093915 5241 dbSNP
rs1295402184 5244 dbSNP
rs1213187919 5248 dbSNP
rs1364457210 5250 dbSNP
rs895954930 5251 dbSNP
rs1013052990 5263 dbSNP
rs1450715855 5275 dbSNP
rs1001749644 5292 dbSNP
rs562620705 5295 dbSNP
rs1323280708 5296 dbSNP
rs866321276 5298 dbSNP
rs896014252 5300 dbSNP
rs1014411309 5302 dbSNP
rs1020048763 5302 dbSNP
rs1169573459 5302 dbSNP
rs899452165 5304 dbSNP
rs75058190 5308 dbSNP
rs1159158134 5315 dbSNP
rs967501062 5320 dbSNP
rs1026772794 5329 dbSNP
rs1458929848 5340 dbSNP
rs1488811651 5349 dbSNP
rs950748225 5360 dbSNP
rs1033051509 5376 dbSNP
rs1385329571 5388 dbSNP
rs1309660906 5389 dbSNP
rs1296703469 5405 dbSNP
rs541651928 5409 dbSNP
rs953045026 5411 dbSNP
rs1300713524 5430 dbSNP
rs1442470182 5435 dbSNP
rs1367627451 5440 dbSNP
rs1297561857 5444 dbSNP
rs1009360267 5458 dbSNP
rs1356112001 5459 dbSNP
rs1325707705 5460 dbSNP
rs1332681802 5461 dbSNP
rs1434406244 5471 dbSNP
rs1019040038 5476 dbSNP
rs986043843 5478 dbSNP
rs1405318010 5482 dbSNP
rs1287708390 5483 dbSNP
rs560012468 5485 dbSNP
rs1195666230 5490 dbSNP
rs1326961447 5491 dbSNP
rs772923629 5494 dbSNP
rs965873766 5498 dbSNP
rs527620967 5501 dbSNP
rs1481896101 5504 dbSNP
rs1275873801 5514 dbSNP
rs974599484 5515 dbSNP
rs1210613873 5534 dbSNP
rs915150272 5543 dbSNP
rs1230110938 5554 dbSNP
rs918694627 5569 dbSNP
rs967993651 5570 dbSNP
rs1235979098 5571 dbSNP
rs17012703 5576 dbSNP
rs565086388 5577 dbSNP
rs923563913 5586 dbSNP
rs1305646787 5595 dbSNP
rs549295618 5599 dbSNP
rs1389659859 5604 dbSNP
rs1056587924 5607 dbSNP
rs1308486482 5616 dbSNP
rs761477045 5621 dbSNP
rs1490631785 5623 dbSNP
rs1466720375 5625 dbSNP
rs1363350772 5627 dbSNP
rs937310873 5633 dbSNP
rs1421469096 5634 dbSNP
rs1056080918 5640 dbSNP
rs948875165 5642 dbSNP
rs1473874037 5648 dbSNP
rs1160400070 5658 dbSNP
rs1201872056 5659 dbSNP
rs879597136 5665 dbSNP
rs1259701741 5669 dbSNP
rs1044575543 5673 dbSNP
rs183246236 5674 dbSNP
rs1330529696 5675 dbSNP
rs1456395056 5683 dbSNP
rs1288930654 5691 dbSNP
rs1232557568 5692 dbSNP
rs1353368859 5692 dbSNP
rs369562114 5693 dbSNP
rs902936078 5696 dbSNP
rs1391699180 5697 dbSNP
rs1047981548 5701 dbSNP
rs1000390821 5703 dbSNP
rs1032714758 5710 dbSNP
rs886408858 5712 dbSNP
rs550762762 5716 dbSNP
rs1164872870 5742 dbSNP
rs888812056 5742 dbSNP
rs1348341766 5755 dbSNP
rs1474495093 5763 dbSNP
rs1007162711 5764 dbSNP
rs4000710 5778 dbSNP
rs1019020635 5786 dbSNP
rs964820522 5793 dbSNP
rs569191779 5795 dbSNP
rs1266891215 5797 dbSNP
rs150790431 5801 dbSNP
rs1203943469 5805 dbSNP
rs1268168599 5819 dbSNP
rs764828837 5821 dbSNP
rs1026530596 5824 dbSNP
rs369022331 5824 dbSNP
rs1332576965 5825 dbSNP
rs1022179607 5826 dbSNP
rs1245253742 5835 dbSNP
rs1325578408 5839 dbSNP
rs1293733055 5840 dbSNP
rs186644419 5842 dbSNP
rs1389521738 5844 dbSNP
rs951911710 5846 dbSNP
rs1460397953 5871 dbSNP
rs1397329159 5878 dbSNP
rs1178282709 5897 dbSNP
rs1256055695 5907 dbSNP
rs1422189370 5915 dbSNP
rs1189675988 5924 dbSNP
rs967879174 5926 dbSNP
rs1371655467 5936 dbSNP
rs1190624771 5939 dbSNP
rs978380011 5948 dbSNP
rs1450916219 5955 dbSNP
rs1248174968 5964 dbSNP
rs923893935 5968 dbSNP
rs960628663 5969 dbSNP
rs1466701749 5976 dbSNP
rs1291958322 5978 dbSNP
rs1385901696 5980 dbSNP
rs527411733 5984 dbSNP
rs1249372962 5985 dbSNP
rs909948848 5991 dbSNP
rs991866991 5993 dbSNP
rs1366195985 6004 dbSNP
rs1302866691 6009 dbSNP
rs1438818272 6009 dbSNP
rs1332854577 6011 dbSNP
rs937342112 6025 dbSNP
rs139412499 6026 dbSNP
rs1463331174 6030 dbSNP
rs35962257 6030 dbSNP
rs569491601 6033 dbSNP
rs1431326205 6034 dbSNP
rs917510966 6036 dbSNP
rs1192557388 6043 dbSNP
rs1401381478 6044 dbSNP
rs947845984 6048 dbSNP
rs542847858 6051 dbSNP
rs1038087483 6052 dbSNP
rs561122977 6053 dbSNP
rs1382817950 6064 dbSNP
rs200108627 6068 dbSNP
rs374399564 6068 dbSNP
rs930840259 6075 dbSNP
rs1347266309 6081 dbSNP
rs57688880 6081 dbSNP
rs17012708 6090 dbSNP
rs1442187468 6102 dbSNP
rs944692976 6104 dbSNP
rs1205639762 6107 dbSNP
rs1255966958 6110 dbSNP
rs1054157758 6111 dbSNP
rs1482582807 6112 dbSNP
rs1202656069 6120 dbSNP
rs1243839428 6122 dbSNP
rs1040433410 6132 dbSNP
rs1448872556 6132 dbSNP
rs146783637 6138 dbSNP
rs900586130 6142 dbSNP
rs551354291 6144 dbSNP
rs191438198 6148 dbSNP
rs183916277 6149 dbSNP
rs1172643117 6151 dbSNP
rs1469121871 6153 dbSNP
rs189703827 6159 dbSNP
rs1184190782 6170 dbSNP
rs903658049 6177 dbSNP
rs999386596 6183 dbSNP
rs1444326540 6195 dbSNP
rs1464499491 6197 dbSNP
rs541616836 6209 dbSNP
rs993862774 6216 dbSNP
rs960689116 6217 dbSNP
rs991781928 6221 dbSNP
rs1348560041 6224 dbSNP
rs1290780292 6241 dbSNP
rs1229510451 6242 dbSNP
rs1433703864 6248 dbSNP
rs1355271173 6249 dbSNP
rs1311419182 6250 dbSNP
rs951993775 6257 dbSNP
rs1023215162 6260 dbSNP
rs1360543938 6266 dbSNP
rs1399638285 6267 dbSNP
rs984616645 6267 dbSNP
rs969032267 6268 dbSNP
rs973763751 6272 dbSNP
rs919695287 6279 dbSNP
rs1185520448 6286 dbSNP
rs991489678 6289 dbSNP
rs917293916 6291 dbSNP
rs1238286609 6295 dbSNP
rs1215273910 6299 dbSNP
rs930787556 6301 dbSNP
rs971413534 6304 dbSNP
rs559874065 6310 dbSNP
rs908113345 6311 dbSNP
rs576328508 6320 dbSNP
rs1291896709 6326 dbSNP
rs571910896 6330 dbSNP
rs945018161 6331 dbSNP
rs1380287288 6343 dbSNP
rs1284454583 6351 dbSNP
rs1429551810 6361 dbSNP
rs1385863403 6363 dbSNP
rs1040651580 6365 dbSNP
rs924870310 6366 dbSNP
rs936186042 6367 dbSNP
rs1393652417 6379 dbSNP
rs900470038 6380 dbSNP
rs1162534810 6387 dbSNP
rs112839791 6394 dbSNP
rs931985751 6402 dbSNP
rs1414203855 6405 dbSNP
rs1043811121 6406 dbSNP
rs910310960 6410 dbSNP
rs903962349 6412 dbSNP
rs1447866826 6414 dbSNP
rs1250045204 6418 dbSNP
rs1189292261 6426 dbSNP
rs1468043921 6429 dbSNP
rs1464548813 6431 dbSNP
rs377237366 6437 dbSNP
rs999757516 6438 dbSNP
rs1250176287 6451 dbSNP
rs1213684565 6452 dbSNP
rs751432933 6465 dbSNP
rs1299269471 6467 dbSNP
rs1435209803 6470 dbSNP
rs901541973 6471 dbSNP
rs1190779525 6472 dbSNP
rs754925200 6473 dbSNP
rs1459354692 6479 dbSNP
rs1424216022 6480 dbSNP
rs192955027 6490 dbSNP
rs1013419139 6494 dbSNP
rs1023521210 6495 dbSNP
rs747873225 6498 dbSNP
rs767297172 6504 dbSNP
rs1429888439 6505 dbSNP
rs1456289589 6506 dbSNP
rs769535640 6510 dbSNP
rs773012838 6516 dbSNP
rs1489084039 6519 dbSNP
rs973732504 6530 dbSNP
rs959190092 6531 dbSNP
rs1344690533 6533 dbSNP
rs1276367642 6542 dbSNP
rs1431034615 6545 dbSNP
rs1292514181 6546 dbSNP
rs1298533231 6551 dbSNP
rs1027136434 6559 dbSNP
rs796409460 6559 dbSNP
rs1366016747 6561 dbSNP
rs951198482 6566 dbSNP
rs762817986 6568 dbSNP
rs907997924 6570 dbSNP
rs944877347 6572 dbSNP
rs1368213967 6574 dbSNP
rs1297470976 6577 dbSNP
rs571263518 6578 dbSNP
rs1407789105 6584 dbSNP
rs976305229 6586 dbSNP
rs1284536931 6589 dbSNP
rs185027445 6592 dbSNP
rs1024379732 6597 dbSNP
rs931953240 6607 dbSNP
rs1407905989 6608 dbSNP
rs971827614 6609 dbSNP
rs532384290 6622 dbSNP
rs533849336 6623 dbSNP
rs935388111 6629 dbSNP
rs1253807634 6630 dbSNP
rs550978856 6643 dbSNP
rs140557507 6644 dbSNP
rs1352151563 6653 dbSNP
rs896289459 6662 dbSNP
rs990282981 6668 dbSNP
rs1013391169 6670 dbSNP
rs1304745896 6676 dbSNP
rs1466634085 6677 dbSNP
rs1044942721 6679 dbSNP
rs530256016 6681 dbSNP
rs995124603 6687 dbSNP
rs1269286382 6689 dbSNP
rs774330988 6702 dbSNP
rs1179857526 6713 dbSNP
rs1187674232 6715 dbSNP
rs1422365804 6716 dbSNP
rs1253659859 6718 dbSNP
rs951123316 6719 dbSNP
rs190264497 6721 dbSNP
rs1019796472 6723 dbSNP
rs1266914885 6728 dbSNP
rs760651085 6731 dbSNP
rs1331123731 6737 dbSNP
rs976273935 6744 dbSNP
rs567044374 6745 dbSNP
rs553705795 6748 dbSNP
rs1426990549 6758 dbSNP
rs980093610 6759 dbSNP
rs1361426591 6762 dbSNP
rs1318612432 6764 dbSNP
rs1006181633 6766 dbSNP
rs925272001 6777 dbSNP
rs866857502 6786 dbSNP
rs34308715 6791 dbSNP
rs373440595 6792 dbSNP
rs1456735528 6793 dbSNP
rs1370531443 6794 dbSNP
rs1189247752 6795 dbSNP
rs1281711691 6797 dbSNP
rs181767126 6808 dbSNP
rs144280279 6809 dbSNP
rs1465811823 6812 dbSNP
rs1268714781 6815 dbSNP
rs1288049367 6819 dbSNP
rs1209121378 6821 dbSNP
rs577769433 6821 dbSNP
rs760420008 6821 dbSNP
rs907257699 6821 dbSNP
rs1361906402 6822 dbSNP
rs999270054 6826 dbSNP
rs918017500 6833 dbSNP
rs1292249895 6835 dbSNP
rs1385570161 6837 dbSNP
rs145259428 6845 dbSNP
rs1164194511 6848 dbSNP
rs1461736641 6855 dbSNP
rs1389179071 6856 dbSNP
rs1166272418 6865 dbSNP
rs1044909173 6873 dbSNP
rs1203019087 6877 dbSNP
rs1450823279 6877 dbSNP
rs1198140460 6878 dbSNP
rs537440499 6878 dbSNP
rs1468256682 6884 dbSNP
rs1449785045 6888 dbSNP
rs990398357 6893 dbSNP
rs1210218832 6895 dbSNP
rs1341126016 6902 dbSNP
rs1272784826 6903 dbSNP
rs149184532 6906 dbSNP
rs1180739039 6908 dbSNP
rs1410937223 6910 dbSNP
rs1231791337 6916 dbSNP
rs1446102881 6918 dbSNP
rs976190924 6924 dbSNP
rs1324713359 6934 dbSNP
rs1409621138 6938 dbSNP
rs143344063 6943 dbSNP
rs995345257 6947 dbSNP
rs1431233645 6954 dbSNP
rs1390315838 6956 dbSNP
rs1048797971 6957 dbSNP
rs186581494 6964 dbSNP
rs753969887 6965 dbSNP
rs1428212312 6972 dbSNP
rs929030456 6975 dbSNP
rs1331527519 6990 dbSNP
rs1355601579 6992 dbSNP
rs1447896057 6994 dbSNP
rs1482625753 6999 dbSNP
rs1004306848 7001 dbSNP
rs1207632332 7015 dbSNP
rs1483502254 7017 dbSNP
rs1278098860 7019 dbSNP
rs908911297 7022 dbSNP
rs1385015247 7023 dbSNP
rs941662772 7034 dbSNP
rs1275991991 7044 dbSNP
rs1019344461 7051 dbSNP
rs762119420 7057 dbSNP
rs188234205 7060 dbSNP
rs1411353269 7061 dbSNP
rs997678978 7061 dbSNP
rs1354760872 7067 dbSNP
rs556534799 7075 dbSNP
rs1341273817 7081 dbSNP
rs1403672037 7087 dbSNP
rs758896692 7094 dbSNP
rs1275081639 7101 dbSNP
rs1472215006 7101 dbSNP
rs979677111 7106 dbSNP
rs535130391 7116 dbSNP
rs868493327 7142 dbSNP
rs1237136987 7161 dbSNP
rs1208228828 7164 dbSNP
rs1240736811 7169 dbSNP
rs988575876 7170 dbSNP
rs1208717237 7175 dbSNP
rs1032167392 7179 dbSNP
rs893169500 7181 dbSNP
rs553470823 7188 dbSNP
rs1011516394 7190 dbSNP
rs766975648 7192 dbSNP
rs571875202 7199 dbSNP
rs1341803943 7202 dbSNP
rs976658354 7203 dbSNP
rs1183890779 7205 dbSNP
rs1030536582 7209 dbSNP
rs1448096990 7216 dbSNP
rs1161218386 7217 dbSNP
rs950939767 7223 dbSNP
rs949509474 7224 dbSNP
rs1420608756 7228 dbSNP
rs1414414715 7241 dbSNP
rs1473891738 7243 dbSNP
rs1332695580 7251 dbSNP
rs980825547 7252 dbSNP
rs546012293 7261 dbSNP
rs1453461184 7269 dbSNP
rs557744025 7271 dbSNP
rs1320204748 7274 dbSNP
rs1363254196 7286 dbSNP
rs926426156 7287 dbSNP
rs908943358 7294 dbSNP
rs1358030757 7298 dbSNP
rs1480078429 7299 dbSNP
rs941695444 7300 dbSNP
rs576399321 7302 dbSNP
rs1271734863 7304 dbSNP
rs931153289 7305 dbSNP
rs990457605 7307 dbSNP
rs1322509994 7316 dbSNP
rs1431355922 7338 dbSNP
rs916508693 7341 dbSNP
rs1162430413 7354 dbSNP
rs1218577682 7354 dbSNP
rs865808319 7355 dbSNP
rs1386113208 7357 dbSNP
rs1447768198 7358 dbSNP
rs576330579 7358 dbSNP
rs1249944420 7359 dbSNP
rs1187668876 7362 dbSNP
rs1261173864 7363 dbSNP
rs544281335 7375 dbSNP
rs939692199 7383 dbSNP
rs544269118 7385 dbSNP
rs1292087162 7387 dbSNP
rs902380805 7390 dbSNP
rs900839804 7394 dbSNP
rs1402370185 7395 dbSNP
rs1299157485 7396 dbSNP
rs1215161365 7397 dbSNP
rs1366828716 7414 dbSNP
rs562825827 7415 dbSNP
rs1247071640 7417 dbSNP
rs1365921227 7419 dbSNP
rs530140964 7422 dbSNP
rs1428042690 7423 dbSNP
rs1392168259 7426 dbSNP
rs796081638 7433 dbSNP
rs201423850 7434 dbSNP
rs370015637 7434 dbSNP
rs60145460 7434 dbSNP
rs57468576 7435 dbSNP
rs67077675 7435 dbSNP
rs200221457 7437 dbSNP
rs70966056 7437 dbSNP
rs17012710 7459 dbSNP
rs1171402004 7466 dbSNP
rs1001464648 7468 dbSNP
rs1470369318 7481 dbSNP
rs1480991201 7491 dbSNP
rs1251516656 7503 dbSNP
rs1158564666 7509 dbSNP
rs1386478382 7513 dbSNP
rs1384143479 7516 dbSNP