miRTarBase - #MIRT211199 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FGF2   
Synonyms BFGF, FGF-2, FGFB, HBGF-2
Description fibroblast growth factor 2
Transcript NM_002006   
Expression
Putative miRNA Targets on FGF2
3'UTR of FGF2
(miRNA target sites are highlighted)
>FGF2|NM_002006|3'UTR
   1 TTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAA
  81 TAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTA
 161 AAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAGTGAAGCTTACCTAGA
 241 GCAATGATCTTTTTCACGCATTTGCTTTATTCGAAAAGAGGCTTTTAAAATGTGCATGTTTAGAAACAAAATTTCTTCAT
 321 GGAAATCATATACATTAGAAAATCACAGTCAGATGTTTAATCAATCCAAAATGTCCACTATTTCTTATGTCATTCGTTAG
 401 TCTACATGTTTCTAAACATATAAATGTGAATTTAATCAATTCCTTTCATAGTTTTATAATTCTCTGGCAGTTCCTTATGA
 481 TAGAGTTTATAAAACAGTCCTGTGTAAACTGCTGGAAGTTCTTCCACAGTCAGGTCAATTTTGTCAAACCCTTCTCTGTA
 561 CCCATACAGCAGCAGCCTAGCAACTCTGCTGGTGATGGGAGTTGTATTTTCAGTCTTCGCCAGGTCATTGAGATCCATCC
 641 ACTCACATCTTAAGCATTCTTCCTGGCAAAAATTTATGGTGAATGAATATGGCTTTAGGCGGCAGATGATATACATATCT
 721 GACTTCCCAAAAGCTCCAGGATTTGTGTGCTGTTGCCGAATACTCAGGACGGACCTGAATTCTGATTTTATACCAGTCTC
 801 TTCAAAAACTTCTCGAACCGCTGTGTCTCCTACGTAAAAAAAGAGATGTACAAATCAATAATAATTACACTTTTAGAAAC
 881 TGTATCATCAAAGATTTTCAGTTAAAGTAGCATTATGTAAAGGCTCAAAACATTACCCTAACAAAGTAAAGTTTTCAATA
 961 CAAATTCTTTGCCTTGTGGATATCAAGAAATCCCAAAATATTTTCTTACCACTGTAAATTCAAGAAGCTTTTGAAATGCT
1041 GAATATTTCTTTGGCTGCTACTTGGAGGCTTATCTACCTGTACATTTTTGGGGTCAGCTCTTTTTAACTTCTTGCTGCTC
1121 TTTTTCCCAAAAGGTAAAAATATAGATTGAAAAGTTAAAACATTTTGCATGGCTGCAGTTCCTTTGTTTCTTGAGATAAG
1201 ATTCCAAAGAACTTAGATTCATTTCTTCAACACCGAAATGCTGGAGGTGTTTGATCAGTTTTCAAGAAACTTGGAATATA
1281 AATAATTTTATAATTCAACAAAGGTTTTCACATTTTATAAGGTTGATTTTTCAATTAAATGCAAATTTGTGTGGCAGGAT
1361 TTTTATTGCCATTAACATATTTTTGTGGCTGCTTTTTCTACACATCCAGATGGTCCCTCTAACTGGGCTTTCTCTAATTT
1441 TGTGATGTTCTGTCATTGTCTCCCAAAGTATTTAGGAGAAGCCCTTTAAAAAGCTGCCTTCCTCTACCACTTTGCTGGAA
1521 AGCTTCACAATTGTCACAGACAAAGATTTTTGTTCCAATACTCGTTTTGCCTCTATTTTTCTTGTTTGTCAAATAGTAAA
1601 TGATATTTGCCCTTGCAGTAATTCTACTGGTGAAAAACATGCAAAGAAGAGGAAGTCACAGAAACATGTCTCAATTCCCA
1681 TGTGCTGTGACTGTAGACTGTCTTACCATAGACTGTCTTACCCATCCCCTGGATATGCTCTTGTTTTTTCCCTCTAATAG
1761 CTATGGAAAGATGCATAGAAAGAGTATAATGTTTTAAAACATAAGGCATTCGTCTGCCATTTTTCAATTACATGCTGACT
1841 TCCCTTACAATTGAGATTTGCCCATAGGTTAAACATGGTTAGAAACAACTGAAAGCATAAAAGAAAAATCTAGGCCGGGT
1921 GCAGTGGCTCATGCCTATATTCCCTGCACTTTGGGAGGCCAAAGCAGGAGGATCGCTTGAGCCCAGGAGTTCAAGACCAA
2001 CCTGGTGAAACCCCGTCTCTACAAAAAAACACAAAAAATAGCCAGGCATGGTGGCGTGTACATGTGGTCTCAGATACTTG
2081 GGAGGCTGAGGTGGGAGGGTTGATCACTTGAGGCTGAGAGGTCAAGGTTGCAGTGAGCCATAATCGTGCCACTGCAGTCC
2161 AGCCTAGGCAACAGAGTGAGACTTTGTCTCAAAAAAAGAGAAATTTTCCTTAATAAGAAAAGTAATTTTTACTCTGATGT
2241 GCAATACATTTGTTATTAAATTTATTATTTAAGATGGTAGCACTAGTCTTAAATTGTATAAAATATCCCCTAACATGTTT
2321 AAATGTCCATTTTTATTCATTATGCTTTGAAAAATAATTATGGGGAAATACATGTTTGTTATTAAATTTATTATTAAAGA
2401 TAGTAGCACTAGTCTTAAATTTGATATAACATCTCCTAACTTGTTTAAATGTCCATTTTTATTCTTTATGTTTGAAAATA
2481 AATTATGGGGATCCTATTTAGCTCTTAGTACCACTAATCAAAAGTTCGGCATGTAGCTCATGATCTATGCTGTTTCTATG
2561 TCGTGGAAGCACCGGATGGGGGTAGTGAGCAAATCTGCCCTGCTCAGCAGTCACCATAGCAGCTGACTGAAAATCAGCAC
2641 TGCCTGAGTAGTTTTGATCAGTTTAACTTGAATCACTAACTGACTGAAAATTGAATGGGCAAATAAGTGCTTTTGTCTCC
2721 AGAGTATGCGGGAGACCCTTCCACCTCAAGATGGATATTTCTTCCCCAAGGATTTCAAGATGAATTGAAATTTTTAATCA
2801 AGATAGTGTGCTTTATTCTGTTGTATTTTTTATTATTTTAATATACTGTAAGCCAAACTGAAATAACATTTGCTGTTTTA
2881 TAGGTTTGAAGAACATAGGAAAAACTAAGAGGTTTTGTTTTTATTTTTGCTGATGAAGAGATATGTTTAAATATGTTGTA
2961 TTGTTTTGTTTAGTTACAGGACAATAATGAAATGGAGTTTATATTTGTTATTTCTATTTTGTTATATTTAATAATAGAAT
3041 TAGATTGAAATAAAATATAATGGGAAATAATCTGCAGAATGTGGGTTTTCCTGGTGTTTCCCTCTGACTCTAGTGCACTG
3121 ATGATCTCTGATAAGGCTCAGCTGCTTTATAGTTCTCTGGCTAATGCAGCAGATACTCTTCCTGCCAGTGGTAATACGAT
3201 TTTTTAAGAAGGCAGTTTGTCAATTTTAATCTTGTGGATACCTTTATACTCTTAGGGTATTATTTTATACAAAAGCCTTG
3281 AGGATTGCATTCTATTTTCTATATGACCCTCTTGATATTTAAAAAACACTATGGATAACAATTCTTCATTTACCTAGTAT
3361 TATGAAAGAATGAAGGAGTTCAAACAAATGTGTTTCCCAGTTAACTAGGGTTTACTGTTTGAGCCAATATAAATGTTTAA
3441 CTGTTTGTGATGGCAGTATTCCTAAAGTACATTGCATGTTTTCCTAAATACAGAGTTTAAATAATTTCAGTAATTCTTAG
3521 ATGATTCAGCTTCATCATTAAGAATATCTTTTGTTTTATGTTGAGTTAGAAATGCCTTCATATAGACATAGTCTTTCAGA
3601 CCTCTACTGTCAGTTTTCATTTCTAGCTGCTTTCAGGGTTTTATGAATTTTCAGGCAAAGCTTTAATTTATACTAAGCTT
3681 AGGAAGTATGGCTAATGCCAACGGCAGTTTTTTTCTTCTTAATTCCACATGACTGAGGCATATATGATCTCTGGGTAGGT
3761 GAGTTGTTGTGACAACCACAAGCACTTTTTTTTTTTTTAAAGAAAAAAAGGTAGTGAATTTTTAATCATCTGGACTTTAA
3841 GAAGGATTCTGGAGTATACTTAGGCCTGAAATTATATATATTTGGCTTGGAAATGTGTTTTTCTTCAATTACATCTACAA
3921 GTAAGTACAGCTGAAATTCAGAGGACCCATAAGAGTTCACATGAAAAAAATCAATTTATTTGAAAAGGCAAGATGCAGGA
4001 GAGAGGAAGCCTTGCAAACCTGCAGACTGCTTTTTGCCCAATATAGATTGGGTAAGGCTGCAAAACATAAGCTTAATTAG
4081 CTCACATGCTCTGCTCTCACGTGGCACCAGTGGATAGTGTGAGAGAATTAGGCTGTAGAACAAATGGCCTTCTCTTTCAG
4161 CATTCACACCACTACAAAATCATCTTTTATATCAACAGAAGAATAAGCATAAACTAAGCAAAAGGTCAATAAGTACCTGA
4241 AACCAAGATTGGCTAGAGATATATCTTAATGCAATCCATTTTCTGATGGATTGTTACGAGTTGGCTATATAATGTATGTA
4321 TGGTATTTTGATTTGTGTAAAAGTTTTAAAAATCAAGCTTTAAGTACATGGACATTTTTAAATAAAATATTTAAAGACAA
4401 TTTAGAAAATTGCCTTAATATCATTGTTGGCTAAATAGAATAGGGGACATGCATATTAAGGAAAAGGTCATGGAGAAATA
4481 ATATTGGTATCAAACAAATACATTGATTTGTCATGATACACATTGAATTTGATCCAATAGTTTAAGGAATAGGTAGGAAA
4561 ATTTGGTTTCTATTTTTCGATTTCCTGTAAATCAGTGACATAAATAATTCTTAGCTTATTTTATATTTCCTTGTCTTAAA
4641 TACTGAGCTCAGTAAGTTGTGTTAGGGGATTATTTCTCAGTTGAGACTTTCTTATATGACATTTTACTATGTTTTGACTT
4721 CCTGACTATTAAAAATAAATAGTAGATACAATTTTCATAAAGTGAAGAATTATATAATCACTGCTTTATAACTGACTTTA
4801 TTATATTTATTTCAAAGTTCATTTAAAGGCTACTATTCATCCTCTGTGATGGAATGGTCAGGAATTTGTTTTCTCATAGT
4881 TTAATTCCAACAACAATATTAGTCGTATCCAAAATAACCTTTAATGCTAAACTTTACTGATGTATATCCAAAGCTTCTCA
4961 TTTTCAGACAGATTAATCCAGAAGCAGTCATAAACAGAAGAATAGGTGGTATGTTCCTAATGATATTATTTCTACTAATG
5041 GAATAAACTGTAATATTAGAAATTATGCTGCTAATTATATCAGCTCTGAGGTAATTTCTGAAATGTTCAGACTCAGTCGG
5121 AACAAATTGGAAAATTTAAATTTTTATTCTTAGCTATAAAGCAAGAAAGTAAACACATTAATTTCCTCAACATTTTTAAG
5201 CCAATTAAAAATATAAAAGATACACACCAATATCTTCTTCAGGCTCTGACAGGCCTCCTGGAAACTTCCACATATTTTTC
5281 AACTGCAGTATAAAGTCAGAAAATAAAGTTAACATAACTTTCACTAACACACACATATGTAGATTTCACAAAATCCACCT
5361 ATAATTGGTCAAAGTGGTTGAGAATATATTTTTTAGTAATTGCATGCAAAATTTTTCTAGCTTCCATCCTTTCTCCCTCG
5441 TTTCTTCTTTTTTTGGGGGAGCTGGTAACTGATGAAATCTTTTCCCACCTTTTCTCTTCAGGAAATATAAGTGGTTTTGT
5521 TTGGTTAACGTGATACATTCTGTATGAATGAAACATTGGAGGGAAACATCTACTGAATTTCTGTAATTTAAAATATTTTG
5601 CTGCTAGTTAACTATGAACAGATAGAAGAATCTTACAGATGCTGCTATAAATAAGTAGAAAATATAAATTTCATCACTAA
5681 AATATGCTATTTTAAAATCTATTTCCTATATTGTATTTCTAATCAGATGTATTACTCTTATTATTTCTATTGTATGTGTT
5761 AATGATTTTATGTAAAAATGTAATTGCTTTTCATGAGTAGTATGAATAAAATTGATTAGTTTGTGTTTTCTTGTCTCCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||| :||| | ||||||| 
Target 5' ttTAAAATATT-T-TGCTGCTa 3'
5587 - 5606 158.00 -11.40
2
miRNA  3' guGUUU----GGU----AAUACACGACGAu 5'
            ||||    |||    ||:|||||||:| 
Target 5' ccCAAAAGCTCCAGGATTTGTGTGCTGTTg 3'
726 - 755 152.00 -18.20
3
miRNA  3' guGUUUG-----GUAAU-----ACACGACGAu 5'
            :||||     :||||     | ||||||| 
Target 5' aaTAAACTGTAATATTAGAAATTATGCTGCTa 3'
5042 - 5073 152.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5548288 1 COSMIC
COSN1286601 13 COSMIC
COSN30473166 34 COSMIC
COSN26976383 54 COSMIC
COSN30131191 59 COSMIC
COSN14092110 77 COSMIC
COSN30120318 84 COSMIC
COSN30117119 103 COSMIC
COSN30150963 109 COSMIC
COSN31559139 164 COSMIC
COSN31602428 176 COSMIC
COSN31589048 266 COSMIC
COSN30120476 274 COSMIC
COSN31564122 283 COSMIC
COSN30106796 316 COSMIC
COSN31568987 385 COSMIC
COSN30139458 391 COSMIC
COSN30129066 410 COSMIC
COSM392674 440 COSMIC
COSM1259700 441 COSMIC
COSM5626289 449 COSMIC
COSM7311866 456 COSMIC
COSM1050737 463 COSMIC
COSM140494 468 COSMIC
COSM447326 478 COSMIC
COSM6588527 484 COSMIC
COSM8726600 489 COSMIC
COSM7529617 495 COSMIC
COSM4121864 512 COSMIC
COSM6992801 514 COSMIC
COSM1683356 526 COSMIC
COSM1196034 528 COSMIC
COSM1218047 578 COSMIC
COSM4980678 582 COSMIC
COSM3775518 612 COSMIC
COSM9914638 620 COSMIC
COSM8561677 621 COSMIC
COSM8290482 622 COSMIC
COSM5978899 623 COSMIC
COSM5400416 626 COSMIC
COSM8811199 627 COSMIC
COSM6166070 631 COSMIC
COSM4708649 638 COSMIC
COSM1050739 643 COSMIC
COSM9607500 645 COSMIC
COSM4913303 661 COSMIC
COSM9002079 664 COSMIC
COSM8340951 667 COSMIC
COSM7094818 671 COSMIC
COSM8605294 683 COSMIC
COSM5595009 686 COSMIC
COSM1694951 693 COSMIC
COSM4589784 693 COSMIC
COSM1426732 696 COSMIC
COSM4121866 700 COSMIC
COSM7301312 702 COSMIC
COSM6262360 703 COSMIC
COSM5995582 714 COSMIC
COSM8421472 716 COSMIC
COSM6731202 732 COSMIC
COSM9196007 734 COSMIC
COSM4503611 741 COSMIC
COSM9080478 744 COSMIC
COSM149734 758 COSMIC
COSM5476495 759 COSMIC
COSM732735 764 COSMIC
COSM9308099 769 COSMIC
COSM4880255 770 COSMIC
COSM1050741 772 COSMIC
COSM7240291 773 COSMIC
COSM447328 783 COSMIC
COSM9012826 783 COSMIC
COSM6731206 784 COSMIC
COSM5737081 795 COSMIC
COSM9211838 806 COSMIC
COSM5764470 812 COSMIC
COSM4552593 820 COSMIC
COSM1426734 823 COSMIC
COSM8879939 831 COSMIC
COSM8505272 843 COSMIC
COSN30121187 844 COSMIC
COSN30579701 850 COSMIC
COSN31611291 883 COSMIC
COSN30101836 925 COSMIC
COSN30144306 939 COSMIC
COSN31599104 968 COSMIC
COSN20439589 1010 COSMIC
COSN20100516 1053 COSMIC
COSN15115459 1236 COSMIC
COSN7729333 1713 COSMIC
COSN16602427 2769 COSMIC
COSN6795156 3375 COSMIC
COSN30059321 3436 COSMIC
COSN32106946 3543 COSMIC
COSN20100517 3799 COSMIC
COSN27422085 3799 COSMIC
COSN16072531 3800 COSMIC
COSN19428830 4504 COSMIC
COSN20091106 4943 COSMIC
COSN15994130 4976 COSMIC
COSN30166310 5033 COSMIC
COSN5151723 5169 COSMIC
COSN31514882 5180 COSMIC
COSM4121868 5254 COSMIC
COSM3008971 5256 COSMIC
COSM1642394 5272 COSMIC
COSM8407593 5274 COSMIC
COSN30473441 5333 COSMIC
COSN31612902 5356 COSMIC
COSN32065174 5440 COSMIC
COSN28866762 5455 COSMIC
COSN31483173 5485 COSMIC
COSN14932944 5490 COSMIC
COSN26643437 5497 COSMIC
COSN31483177 5571 COSMIC
COSN20646094 5622 COSMIC
COSN31483178 5673 COSMIC
COSN24007440 5836 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374325832 7 dbSNP
rs111250029 8 dbSNP
rs1376111478 10 dbSNP
rs1386421267 12 dbSNP
rs747380347 20 dbSNP
rs768841530 21 dbSNP
rs533153673 23 dbSNP
rs540014635 26 dbSNP
rs1175092224 30 dbSNP
rs750165063 35 dbSNP
rs746414739 42 dbSNP
rs773898530 46 dbSNP
rs758996004 47 dbSNP
rs767472121 49 dbSNP
rs1184378765 50 dbSNP
rs1477239824 52 dbSNP
rs995769417 67 dbSNP
rs1022966604 69 dbSNP
rs970068523 70 dbSNP
rs1484980206 72 dbSNP
rs112067954 85 dbSNP
rs567018446 90 dbSNP
rs1002942849 93 dbSNP
rs186312788 96 dbSNP
rs1309589289 99 dbSNP
rs956165877 102 dbSNP
rs3804156 105 dbSNP
rs549279198 109 dbSNP
rs749867177 113 dbSNP
rs1193367714 129 dbSNP
rs1412936181 133 dbSNP
rs1376898803 135 dbSNP
rs936650217 140 dbSNP
rs1462345144 142 dbSNP
rs1356043242 143 dbSNP
rs913742022 152 dbSNP
rs1464779960 155 dbSNP
rs1053694639 158 dbSNP
rs968361878 161 dbSNP
rs45627736 169 dbSNP
rs1178247153 170 dbSNP
rs1481852001 171 dbSNP
rs1007087469 175 dbSNP
rs775917043 177 dbSNP
rs531174738 181 dbSNP
rs1198326823 187 dbSNP
rs551476719 190 dbSNP
rs1335727886 197 dbSNP
rs571209115 204 dbSNP
rs1471416040 215 dbSNP
rs780912676 226 dbSNP
rs1178318881 228 dbSNP
rs1321167905 231 dbSNP
rs1311986455 234 dbSNP
rs1391888480 243 dbSNP
rs1407270116 247 dbSNP
rs1050732403 255 dbSNP
rs747377047 258 dbSNP
rs1394793361 259 dbSNP
rs1166599503 261 dbSNP
rs1455967799 267 dbSNP
rs1367355416 272 dbSNP
rs1167258062 273 dbSNP
rs912275852 274 dbSNP
rs1236810451 291 dbSNP
rs1461156533 293 dbSNP
rs1178421678 296 dbSNP
rs1469145733 298 dbSNP
rs1179985961 299 dbSNP
rs901307514 299 dbSNP
rs994757888 320 dbSNP
rs1261387492 323 dbSNP
rs1241195468 329 dbSNP
rs1318671871 338 dbSNP
rs1347921910 339 dbSNP
rs1239199050 342 dbSNP
rs939790419 344 dbSNP
rs752131741 347 dbSNP
rs898699814 348 dbSNP
rs950430943 365 dbSNP
rs533874938 373 dbSNP
rs931552904 378 dbSNP
rs752574363 389 dbSNP
rs1015931553 393 dbSNP
rs1484326648 395 dbSNP
rs377651203 396 dbSNP
rs200167049 397 dbSNP
rs1178299478 402 dbSNP
rs1472942037 404 dbSNP
rs753637879 408 dbSNP
rs1409656208 419 dbSNP
rs1002849676 420 dbSNP
rs917832452 425 dbSNP
rs757474041 426 dbSNP
rs779232613 428 dbSNP
rs745979112 429 dbSNP
rs777295362 432 dbSNP
rs146460670 438 dbSNP
rs371113958 440 dbSNP
rs1411117195 447 dbSNP
rs1215777056 448 dbSNP
rs891839631 449 dbSNP
rs1305349499 450 dbSNP
rs1285992854 455 dbSNP
rs1327621976 463 dbSNP
rs769196837 466 dbSNP
rs776896778 469 dbSNP
rs372832872 474 dbSNP
rs1010354711 478 dbSNP
rs1208516087 479 dbSNP
rs1237104557 482 dbSNP
rs566701149 483 dbSNP
rs1358036216 487 dbSNP
rs1184352064 497 dbSNP
rs1435879096 501 dbSNP
rs535779044 504 dbSNP
rs1472194302 513 dbSNP
rs865973634 523 dbSNP
rs779631528 524 dbSNP
rs1171202512 526 dbSNP
rs555602769 534 dbSNP
rs779629744 537 dbSNP
rs377283871 539 dbSNP
rs1175170658 544 dbSNP
rs369858295 545 dbSNP
rs760571272 550 dbSNP
rs764073917 551 dbSNP
rs753601927 555 dbSNP
rs1442066035 557 dbSNP
rs967879543 561 dbSNP
rs765564750 569 dbSNP
rs148123353 574 dbSNP
rs758677840 576 dbSNP
rs780344502 577 dbSNP
rs1262548268 578 dbSNP
rs747077036 580 dbSNP
rs979306193 585 dbSNP
rs1215885037 592 dbSNP
rs140973799 593 dbSNP
rs1280569642 595 dbSNP
rs537801998 597 dbSNP
rs375542320 600 dbSNP
rs770075653 610 dbSNP
rs1285529901 611 dbSNP
rs778098774 613 dbSNP
rs45606640 614 dbSNP
rs771682042 617 dbSNP
rs760186313 619 dbSNP
rs138619142 620 dbSNP
rs776567689 622 dbSNP
rs1166362770 623 dbSNP
rs1369606495 625 dbSNP
rs1405425282 628 dbSNP
rs761529651 629 dbSNP
rs765178237 638 dbSNP
rs1254471955 646 dbSNP
rs750236034 648 dbSNP
rs763303117 649 dbSNP
rs1366411895 654 dbSNP
rs766682539 655 dbSNP
rs751612205 661 dbSNP
rs1339043418 669 dbSNP
rs1486929585 671 dbSNP
rs755045449 675 dbSNP
rs781553867 677 dbSNP
rs753188971 681 dbSNP
rs756611528 682 dbSNP
rs201373471 685 dbSNP
rs931437932 690 dbSNP
rs1357944142 691 dbSNP
rs749632195 692 dbSNP
rs1186498251 694 dbSNP
rs771737486 697 dbSNP
rs1472923739 700 dbSNP
rs142756927 701 dbSNP
rs746508996 702 dbSNP
rs1404054559 703 dbSNP
rs1005973997 705 dbSNP
rs1390077505 708 dbSNP
rs768158192 709 dbSNP
rs1319038330 713 dbSNP
rs775987914 716 dbSNP
rs1326010866 717 dbSNP
rs761906165 719 dbSNP
rs1476199423 720 dbSNP
rs369473521 727 dbSNP
rs1285985072 729 dbSNP
rs769818641 734 dbSNP
rs199533328 735 dbSNP
rs1232794693 748 dbSNP
rs938922060 751 dbSNP
rs372728120 755 dbSNP
rs1331213636 757 dbSNP
rs1048201 758 dbSNP
rs751736046 759 dbSNP
rs1442589239 764 dbSNP
rs891833866 769 dbSNP
rs201458145 771 dbSNP
rs113836715 772 dbSNP
rs752689945 781 dbSNP
rs1159329715 793 dbSNP
rs1413333514 794 dbSNP
rs201412128 795 dbSNP
rs778205008 797 dbSNP
rs746637657 798 dbSNP
rs374780215 799 dbSNP
rs754662853 804 dbSNP
rs11541431 809 dbSNP
rs1336368273 809 dbSNP
rs1000632355 813 dbSNP
rs757555425 815 dbSNP
rs779588436 816 dbSNP
rs1331293000 818 dbSNP
rs200650453 820 dbSNP
rs112477231 821 dbSNP
rs769871543 822 dbSNP
rs773244045 824 dbSNP
rs749100285 825 dbSNP
rs770699994 827 dbSNP
rs1161447988 828 dbSNP
rs774001782 830 dbSNP
rs1472430319 833 dbSNP
rs199833283 834 dbSNP
rs45625032 835 dbSNP
rs780673190 836 dbSNP
rs760708952 844 dbSNP
rs764593074 847 dbSNP
rs754288121 848 dbSNP
rs757751594 849 dbSNP
rs961097422 850 dbSNP
rs189490769 852 dbSNP
rs1400332181 859 dbSNP
rs750719917 861 dbSNP
rs754704992 871 dbSNP
rs780655874 874 dbSNP
rs1408120815 877 dbSNP
rs747690672 878 dbSNP
rs755616712 880 dbSNP
rs777866250 882 dbSNP
rs1185617908 884 dbSNP
rs1227177922 895 dbSNP
rs942694248 897 dbSNP
rs1312031111 900 dbSNP
rs1041426515 902 dbSNP
rs1376584405 914 dbSNP
rs1475887428 917 dbSNP
rs1168259754 922 dbSNP
rs919650766 924 dbSNP
rs1438857320 928 dbSNP
rs549267078 937 dbSNP
rs1401308744 939 dbSNP
rs930214766 948 dbSNP
rs569407789 949 dbSNP
rs112392401 951 dbSNP
rs1047386335 959 dbSNP
rs776751365 972 dbSNP
rs927479012 973 dbSNP
rs1175447772 974 dbSNP
rs1478807462 981 dbSNP
rs1244560309 988 dbSNP
rs1375464095 1014 dbSNP
rs1447033909 1015 dbSNP
rs1005733655 1021 dbSNP
rs1215057434 1030 dbSNP
rs11340920 1050 dbSNP
rs397799351 1050 dbSNP
rs938912235 1053 dbSNP
rs1057396138 1060 dbSNP
rs1221238414 1074 dbSNP
rs1331710005 1079 dbSNP
rs1274445746 1080 dbSNP
rs1327794813 1084 dbSNP
rs1362520254 1089 dbSNP
rs538523416 1090 dbSNP
rs1300027157 1097 dbSNP
rs1359743984 1101 dbSNP
rs1417786922 1101 dbSNP
rs1176538470 1106 dbSNP
rs1431070381 1107 dbSNP
rs913211527 1109 dbSNP
rs1333455006 1111 dbSNP
rs1422655741 1112 dbSNP
rs1190239570 1114 dbSNP
rs557915213 1119 dbSNP
rs1340517863 1120 dbSNP
rs1264688309 1121 dbSNP
rs1192207329 1137 dbSNP
rs894913251 1143 dbSNP
rs1012020496 1155 dbSNP
rs577950644 1162 dbSNP
rs1310776300 1168 dbSNP
rs1347864817 1173 dbSNP
rs1215373915 1182 dbSNP
rs1342528428 1182 dbSNP
rs765733621 1189 dbSNP
rs534326153 1198 dbSNP
rs1276393461 1203 dbSNP
rs1198772027 1207 dbSNP
rs181591190 1221 dbSNP
rs970452726 1227 dbSNP
rs752617826 1236 dbSNP
rs573903132 1246 dbSNP
rs1174985971 1248 dbSNP
rs904577699 1256 dbSNP
rs1425241329 1259 dbSNP
rs1167946257 1265 dbSNP
rs999845948 1272 dbSNP
rs996226566 1273 dbSNP
rs1030879115 1274 dbSNP
rs1247111755 1275 dbSNP
rs1184088247 1311 dbSNP
rs1447452440 1313 dbSNP
rs1175347846 1324 dbSNP
rs1205586715 1337 dbSNP
rs1395612675 1338 dbSNP
rs1245179646 1340 dbSNP
rs1218121232 1343 dbSNP
rs3804158 1350 dbSNP
rs1170268867 1351 dbSNP
rs1397700530 1365 dbSNP
rs186943746 1370 dbSNP
rs1302048698 1372 dbSNP
rs576303782 1382 dbSNP
rs1417596663 1393 dbSNP
rs911078607 1401 dbSNP
rs964463113 1408 dbSNP
rs1317199157 1411 dbSNP
rs559617255 1420 dbSNP
rs1008545457 1428 dbSNP
rs191364640 1432 dbSNP
rs371852060 1436 dbSNP
rs1363396392 1442 dbSNP
rs1019496601 1449 dbSNP
rs1167614296 1462 dbSNP
rs375179461 1466 dbSNP
rs45604541 1468 dbSNP
rs1179675098 1470 dbSNP
rs1459337512 1475 dbSNP
rs993808118 1477 dbSNP
rs753576362 1482 dbSNP
rs952431648 1484 dbSNP
rs979887443 1486 dbSNP
rs927426815 1494 dbSNP
rs752038063 1502 dbSNP
rs1267298826 1505 dbSNP
rs941484368 1515 dbSNP
rs75598432 1518 dbSNP
rs993418738 1519 dbSNP
rs1319867484 1522 dbSNP
rs1311871436 1523 dbSNP
rs1204718241 1529 dbSNP
rs41501547 1531 dbSNP
rs1445580472 1532 dbSNP
rs1390925109 1536 dbSNP
rs543969022 1541 dbSNP
rs1195237386 1542 dbSNP
rs527244941 1558 dbSNP
rs1043004115 1564 dbSNP
rs183122876 1565 dbSNP
rs1159742459 1572 dbSNP
rs925990858 1573 dbSNP
rs1441978358 1577 dbSNP
rs112645817 1585 dbSNP
rs529453831 1591 dbSNP
rs1269662253 1593 dbSNP
rs1196702870 1600 dbSNP
rs889606764 1603 dbSNP
rs1364953793 1605 dbSNP
rs906151578 1606 dbSNP
rs1470209229 1619 dbSNP
rs1488181417 1625 dbSNP
rs1264843916 1628 dbSNP
rs1217231735 1630 dbSNP
rs1157848949 1644 dbSNP
rs1008035736 1652 dbSNP
rs1239091927 1661 dbSNP
rs999208253 1665 dbSNP
rs1302898578 1675 dbSNP
rs1384604130 1676 dbSNP
rs1366259302 1678 dbSNP
rs1041277452 1682 dbSNP
rs897034417 1686 dbSNP
rs994524506 1689 dbSNP
rs1299400379 1693 dbSNP
rs1385988849 1694 dbSNP
rs1359109976 1696 dbSNP
rs1158432748 1698 dbSNP
rs1466827588 1701 dbSNP
rs975199363 1703 dbSNP
rs529256276 1709 dbSNP
rs1462734994 1715 dbSNP
rs1379630433 1724 dbSNP
rs1196996921 1727 dbSNP
rs1026647734 1732 dbSNP
rs952380289 1734 dbSNP
rs1263994409 1735 dbSNP
rs1326940526 1738 dbSNP
rs1394246865 1739 dbSNP
rs1283741819 1746 dbSNP
rs1030853054 1750 dbSNP
rs45552632 1752 dbSNP
rs1257441182 1759 dbSNP
rs1230590455 1762 dbSNP
rs778746823 1764 dbSNP
rs778578145 1767 dbSNP
rs569432713 1781 dbSNP
rs1339123865 1782 dbSNP
rs1298093828 1784 dbSNP
rs1271777763 1785 dbSNP
rs1404788364 1786 dbSNP
rs960078195 1786 dbSNP
rs531941128 1788 dbSNP
rs1238421307 1792 dbSNP
rs1018056666 1800 dbSNP
rs45520244 1802 dbSNP
rs386679151 1811 dbSNP
rs879668023 1811 dbSNP
rs2893026 1812 dbSNP
rs41348645 1813 dbSNP
rs979023511 1828 dbSNP
rs1442844720 1835 dbSNP
rs1258003934 1843 dbSNP
rs982797183 1852 dbSNP
rs1322416313 1857 dbSNP
rs779864774 1865 dbSNP
rs746927339 1870 dbSNP
rs768643348 1873 dbSNP
rs932015012 1877 dbSNP
rs986110910 1883 dbSNP
rs1246161518 1892 dbSNP
rs776738141 1893 dbSNP
rs909906269 1898 dbSNP
rs1332628572 1901 dbSNP
rs748445540 1917 dbSNP
rs45492897 1918 dbSNP
rs770123959 1920 dbSNP
rs780603575 1929 dbSNP
rs1422990228 1938 dbSNP
rs1475960483 1939 dbSNP
rs929891218 1941 dbSNP
rs1165199244 1945 dbSNP
rs45626132 1948 dbSNP
rs1185169470 1950 dbSNP
rs950247422 1959 dbSNP
rs1456699166 1960 dbSNP
rs888372665 1964 dbSNP
rs545246204 1972 dbSNP
rs935105793 1973 dbSNP
rs1271687630 1975 dbSNP
rs1034033862 1976 dbSNP
rs536736816 1977 dbSNP
rs895537387 1980 dbSNP
rs1397792222 1981 dbSNP
rs1014448128 1987 dbSNP
rs1311806434 1992 dbSNP
rs1409797092 1992 dbSNP
rs1399741235 1993 dbSNP
rs556111147 2015 dbSNP
rs1407104012 2020 dbSNP
rs1392832862 2023 dbSNP
rs1161360267 2026 dbSNP
rs1443841883 2029 dbSNP
rs1018195627 2033 dbSNP
rs899631702 2033 dbSNP
rs998044060 2039 dbSNP
rs1231908426 2048 dbSNP
rs1020431692 2049 dbSNP
rs1221705211 2051 dbSNP
rs1452807346 2052 dbSNP
rs1030138664 2054 dbSNP
rs951480502 2056 dbSNP
rs967988047 2057 dbSNP
rs978972790 2059 dbSNP
rs1033187945 2063 dbSNP
rs982895360 2072 dbSNP
rs1238354133 2075 dbSNP
rs1372897275 2076 dbSNP
rs1292924411 2083 dbSNP
rs45446702 2085 dbSNP
rs1242338070 2092 dbSNP
rs1329406466 2093 dbSNP
rs1301289825 2099 dbSNP
rs986068213 2100 dbSNP
rs962745161 2103 dbSNP
rs991701647 2109 dbSNP
rs111829757 2114 dbSNP
rs1204385825 2131 dbSNP
rs1406850138 2138 dbSNP
rs1191394129 2146 dbSNP
rs1248897509 2147 dbSNP
rs1244467861 2181 dbSNP
rs950234380 2182 dbSNP
rs1488910067 2183 dbSNP
rs1383011791 2186 dbSNP
rs981615529 2191 dbSNP
rs1214946182 2195 dbSNP
rs1316666022 2198 dbSNP
rs1279664860 2215 dbSNP
rs944792732 2220 dbSNP
rs1188115110 2223 dbSNP
rs397729357 2224 dbSNP
rs45571542 2224 dbSNP
rs1343056085 2227 dbSNP
rs972599068 2228 dbSNP
rs1282743562 2229 dbSNP
rs1400640518 2233 dbSNP
rs1341091721 2234 dbSNP
rs1421725883 2235 dbSNP
rs1172955137 2247 dbSNP
rs1344377243 2249 dbSNP
rs918419496 2252 dbSNP
rs935073161 2257 dbSNP
rs1052173563 2269 dbSNP
rs113612713 2270 dbSNP
rs893432771 2279 dbSNP
rs1374020485 2284 dbSNP
rs1477838819 2286 dbSNP
rs1266023509 2294 dbSNP
rs1429635210 2295 dbSNP
rs929761116 2296 dbSNP
rs1485784353 2297 dbSNP
rs78432795 2306 dbSNP
rs1039995970 2308 dbSNP
rs1440933780 2309 dbSNP
rs45440094 2315 dbSNP
rs1219373990 2316 dbSNP
rs937253872 2326 dbSNP
rs111907203 2327 dbSNP
rs895493971 2330 dbSNP
rs1013999951 2340 dbSNP
rs1361100929 2343 dbSNP
rs1303221348 2345 dbSNP
rs1449891964 2346 dbSNP
rs1403478760 2350 dbSNP
rs1297401965 2362 dbSNP
rs1020485341 2370 dbSNP
rs1465734199 2372 dbSNP
rs1227498620 2373 dbSNP
rs886977351 2375 dbSNP
rs902938017 2379 dbSNP
rs1415098272 2388 dbSNP
rs1000299804 2397 dbSNP
rs1272369554 2401 dbSNP
rs1033155503 2403 dbSNP
rs953618789 2407 dbSNP
rs991519881 2411 dbSNP
rs1256236795 2428 dbSNP
rs1350043361 2433 dbSNP
rs45504296 2472 dbSNP
rs867780755 2475 dbSNP
rs1313290352 2487 dbSNP
rs1236434542 2495 dbSNP
rs1229859927 2508 dbSNP
rs1018944992 2510 dbSNP
rs1313998615 2513 dbSNP
rs966476011 2528 dbSNP
rs972098938 2534 dbSNP
rs774740454 2543 dbSNP
rs186613784 2546 dbSNP
rs983926260 2548 dbSNP
rs1167503423 2553 dbSNP
rs760065305 2559 dbSNP
rs1449259178 2563 dbSNP
rs924799930 2564 dbSNP
rs937222548 2566 dbSNP
rs1187133069 2569 dbSNP
rs1397427349 2570 dbSNP
rs2168915 2574 dbSNP
rs1175423285 2575 dbSNP
rs1357531179 2578 dbSNP
rs1455480005 2583 dbSNP
rs1266010840 2593 dbSNP
rs1223654990 2597 dbSNP
rs1357095523 2599 dbSNP
rs1290777705 2613 dbSNP
rs1289680043 2617 dbSNP
rs916912183 2618 dbSNP
rs779327102 2641 dbSNP
rs915003139 2649 dbSNP
rs1304376220 2650 dbSNP
rs949715965 2657 dbSNP
rs1390369063 2669 dbSNP
rs1434081446 2671 dbSNP
rs1367683860 2675 dbSNP
rs1041383153 2677 dbSNP
rs868279757 2681 dbSNP
rs946359168 2686 dbSNP
rs562974963 2692 dbSNP
rs1159647421 2694 dbSNP
rs1219757832 2697 dbSNP
rs531899850 2704 dbSNP
rs1277249781 2708 dbSNP
rs1362319791 2709 dbSNP
rs748530905 2711 dbSNP
rs902914644 2721 dbSNP
rs1269552740 2727 dbSNP
rs1260935934 2730 dbSNP
rs1489845989 2730 dbSNP
rs776825001 2733 dbSNP
rs1217121697 2739 dbSNP
rs6853268 2741 dbSNP
rs889323544 2746 dbSNP
rs1007758157 2747 dbSNP
rs1191127996 2750 dbSNP
rs1302789222 2752 dbSNP
rs11540088 2767 dbSNP
rs966322238 2771 dbSNP
rs993882293 2778 dbSNP
rs190613209 2803 dbSNP
rs1388139727 2806 dbSNP
rs1004057578 2813 dbSNP
rs952095262 2820 dbSNP
rs1158279999 2828 dbSNP
rs898599819 2865 dbSNP
rs1379538732 2875 dbSNP
rs1013447164 2876 dbSNP
rs1318236660 2910 dbSNP
rs1480132224 2912 dbSNP
rs764883431 2930 dbSNP
rs1194278069 2931 dbSNP
rs529589754 2935 dbSNP
rs1022957677 2945 dbSNP
rs1483388287 2946 dbSNP
rs182205477 2950 dbSNP
rs1221199503 2951 dbSNP
rs1322190442 2953 dbSNP
rs1437029355 2961 dbSNP
rs1221001502 2966 dbSNP
rs1003086506 2978 dbSNP
rs1365479845 2991 dbSNP
rs1396933362 2995 dbSNP
rs1404669037 2996 dbSNP
rs1224963610 2999 dbSNP
rs1401114221 3004 dbSNP
rs1469405304 3004 dbSNP
rs1288474683 3011 dbSNP
rs1476356927 3012 dbSNP
rs958560639 3017 dbSNP
rs1192248613 3022 dbSNP
rs45441398 3022 dbSNP
rs1328026390 3026 dbSNP
rs1226214352 3036 dbSNP
rs113615485 3038 dbSNP
rs1460542621 3043 dbSNP
rs1258150418 3044 dbSNP
rs1196971271 3047 dbSNP
rs1338051183 3058 dbSNP
rs868378144 3065 dbSNP
rs956177693 3066 dbSNP
rs1246046620 3080 dbSNP
rs991343985 3082 dbSNP
rs77571189 3088 dbSNP
rs1452194295 3092 dbSNP
rs914763970 3103 dbSNP
rs950013055 3104 dbSNP
rs1221367721 3110 dbSNP
rs1408242744 3115 dbSNP
rs536775550 3129 dbSNP
rs1394302784 3133 dbSNP
rs1167241389 3140 dbSNP
rs187737646 3143 dbSNP
rs1041765819 3151 dbSNP
rs6854081 3157 dbSNP
rs1452059226 3160 dbSNP
rs935750934 3162 dbSNP
rs377638739 3164 dbSNP
rs1443645239 3182 dbSNP
rs371110764 3183 dbSNP
rs975604868 3185 dbSNP
rs1238365977 3186 dbSNP
rs1054167739 3192 dbSNP
rs920939054 3193 dbSNP
rs933655099 3196 dbSNP
rs1050991146 3198 dbSNP
rs758225723 3199 dbSNP
rs1210951253 3200 dbSNP
rs908473028 3202 dbSNP
rs1290056363 3210 dbSNP
rs1245632438 3211 dbSNP
rs1471708293 3221 dbSNP
rs888874282 3224 dbSNP
rs939812850 3237 dbSNP
rs1440179009 3241 dbSNP
rs1335234779 3242 dbSNP
rs45495095 3243 dbSNP
rs532022111 3255 dbSNP
rs1367307747 3257 dbSNP
rs779852076 3260 dbSNP
rs993793559 3265 dbSNP
rs1380580432 3277 dbSNP
rs1159924325 3281 dbSNP
rs1468213710 3282 dbSNP
rs1026299721 3301 dbSNP
rs887816963 3303 dbSNP
rs1322730393 3312 dbSNP
rs1198878709 3317 dbSNP
rs1348019917 3321 dbSNP
rs1006301133 3327 dbSNP
rs1444355197 3328 dbSNP
rs1308062170 3330 dbSNP
rs1044876755 3332 dbSNP
rs1267328923 3340 dbSNP
rs397897556 3342 dbSNP
rs45546532 3342 dbSNP
rs1003296875 3355 dbSNP
rs552192823 3356 dbSNP
rs1033728974 3359 dbSNP
rs112480130 3361 dbSNP
rs991705966 3364 dbSNP
rs1275530225 3366 dbSNP
rs1225376851 3377 dbSNP
rs754935265 3407 dbSNP
rs1228075281 3408 dbSNP
rs956271000 3427 dbSNP
rs1011810659 3433 dbSNP
rs971704996 3434 dbSNP
rs139580294 3439 dbSNP
rs1428302654 3447 dbSNP
rs149304849 3457 dbSNP
rs373292533 3464 dbSNP
rs1427881010 3470 dbSNP
rs144487286 3477 dbSNP
rs1199316928 3478 dbSNP
rs554173630 3487 dbSNP
rs1488861955 3490 dbSNP
rs1251081492 3502 dbSNP
rs1482124773 3503 dbSNP
rs781185451 3513 dbSNP
rs1446660503 3518 dbSNP
rs111822781 3524 dbSNP
rs533484365 3528 dbSNP
rs1225482167 3535 dbSNP
rs1321488084 3546 dbSNP
rs1281372292 3549 dbSNP
rs1222827022 3550 dbSNP
rs1362497847 3556 dbSNP
rs1028500710 3573 dbSNP
rs1428332452 3576 dbSNP
rs1040929262 3581 dbSNP
rs574079883 3583 dbSNP
rs986484591 3589 dbSNP
rs1403264160 3600 dbSNP
rs908231899 3609 dbSNP
rs3804159 3625 dbSNP
rs563367945 3629 dbSNP
rs531818863 3638 dbSNP
rs1475278250 3648 dbSNP
rs3827582 3672 dbSNP
rs888035201 3687 dbSNP
rs551545047 3694 dbSNP
rs1262602117 3702 dbSNP
rs45507392 3703 dbSNP
rs62323463 3704 dbSNP
rs1274985678 3706 dbSNP
rs1212643090 3708 dbSNP
rs1361001206 3713 dbSNP
rs1315390650 3721 dbSNP
rs1454253381 3723 dbSNP
rs1407447891 3731 dbSNP
rs1314216898 3738 dbSNP
rs112821043 3753 dbSNP
rs1013696827 3760 dbSNP
rs1462015966 3763 dbSNP
rs1356832992 3764 dbSNP
rs1446860801 3767 dbSNP
rs891834290 3772 dbSNP
rs1386252829 3775 dbSNP
rs1011783103 3780 dbSNP
rs192660532 3782 dbSNP
rs1364525839 3783 dbSNP
rs1179376896 3784 dbSNP
rs1481644220 3785 dbSNP
rs1253070070 3786 dbSNP
rs1292249741 3786 dbSNP
rs3840102 3786 dbSNP
rs397757243 3786 dbSNP
rs1247836360 3787 dbSNP
rs200464258 3789 dbSNP
rs1274541924 3793 dbSNP
rs1313885239 3799 dbSNP
rs62855160 3799 dbSNP
rs977234675 3800 dbSNP
rs1031511530 3804 dbSNP
rs900637119 3806 dbSNP
rs996762680 3808 dbSNP
rs1213076668 3810 dbSNP
rs1442134113 3812 dbSNP
rs1366677183 3831 dbSNP
rs773598541 3836 dbSNP
rs1028050464 3841 dbSNP
rs41512344 3842 dbSNP
rs182831170 3856 dbSNP
rs1160091525 3858 dbSNP
rs1421030781 3867 dbSNP
rs1185728497 3873 dbSNP
rs1176638281 3874 dbSNP
rs1482701379 3875 dbSNP
rs775628398 3877 dbSNP
rs989746114 3879 dbSNP
rs749470526 3904 dbSNP
rs1489789497 3913 dbSNP
rs1290663499 3918 dbSNP
rs1239322970 3919 dbSNP
rs1451083319 3919 dbSNP
rs1318286541 3923 dbSNP
rs1322209019 3929 dbSNP
rs879044443 3931 dbSNP
rs41481046 3932 dbSNP
rs1305462474 3946 dbSNP
rs1389443923 3950 dbSNP
rs1403546078 3950 dbSNP
rs1289752468 3954 dbSNP
rs1427794052 3955 dbSNP
rs1174916342 3961 dbSNP
rs1402332801 3962 dbSNP
rs1455554374 3962 dbSNP
rs1413482177 3964 dbSNP
rs973951028 3968 dbSNP
rs1480788284 3970 dbSNP
rs919849869 3973 dbSNP
rs948556474 3976 dbSNP
rs7655413 3978 dbSNP
rs1436278362 4002 dbSNP
rs928514116 4003 dbSNP
rs938755496 4006 dbSNP
rs1258545289 4011 dbSNP
rs563704133 4016 dbSNP
rs568687158 4035 dbSNP
rs367996400 4040 dbSNP
rs113212565 4042 dbSNP
rs1222230058 4045 dbSNP
rs1047926674 4049 dbSNP
rs947400170 4051 dbSNP
rs1384235598 4059 dbSNP
rs1383127007 4068 dbSNP
rs1288490017 4077 dbSNP
rs760029872 4082 dbSNP
rs900770132 4087 dbSNP
rs888003891 4097 dbSNP
rs1174291707 4099 dbSNP
rs1479428312 4102 dbSNP
rs1376958151 4114 dbSNP
rs996467123 4116 dbSNP
rs45575341 4124 dbSNP
rs942270371 4126 dbSNP
rs1030904029 4137 dbSNP
rs890668398 4138 dbSNP
rs1344407240 4146 dbSNP
rs1198888359 4148 dbSNP
rs1286603368 4160 dbSNP
rs1007942008 4176 dbSNP
rs1465546045 4180 dbSNP
rs1015358906 4183 dbSNP
rs1209097361 4183 dbSNP
rs961003031 4185 dbSNP
rs1325038010 4191 dbSNP
rs538748070 4195 dbSNP
rs763990069 4202 dbSNP
rs1295210187 4204 dbSNP
rs1453671195 4216 dbSNP
rs1385197876 4219 dbSNP
rs1334826782 4226 dbSNP
rs1447536318 4228 dbSNP
rs1401464499 4234 dbSNP
rs1168409858 4247 dbSNP
rs1200914823 4248 dbSNP
rs1371137137 4249 dbSNP
rs1055114081 4250 dbSNP
rs893768451 4254 dbSNP
rs552393727 4255 dbSNP
rs895189412 4257 dbSNP
rs1477403056 4264 dbSNP
rs1014080476 4275 dbSNP
rs1244560776 4277 dbSNP
rs1181262140 4286 dbSNP
rs1441313935 4288 dbSNP
rs1170369068 4296 dbSNP
rs565514636 4298 dbSNP
rs1457491318 4299 dbSNP
rs45555832 4300 dbSNP
rs1320251507 4306 dbSNP
rs1274394999 4308 dbSNP
rs970363670 4310 dbSNP
rs1361914172 4315 dbSNP
rs768055918 4319 dbSNP
rs112306097 4325 dbSNP
rs998622818 4330 dbSNP
rs1324799380 4331 dbSNP
rs1330898618 4334 dbSNP
rs45598131 4336 dbSNP
rs1394191836 4339 dbSNP
rs1167767532 4355 dbSNP
rs1231119981 4357 dbSNP
rs1425033814 4358 dbSNP
rs1386759405 4359 dbSNP
rs554409081 4364 dbSNP
rs1281394381 4368 dbSNP
rs1472218310 4369 dbSNP
rs1330031790 4370 dbSNP
rs957271937 4376 dbSNP
rs775919255 4385 dbSNP
rs988823739 4397 dbSNP
rs1211473743 4403 dbSNP
rs45561135 4411 dbSNP
rs188483729 4414 dbSNP
rs1289947208 4420 dbSNP
rs947367640 4424 dbSNP
rs964442763 4429 dbSNP
rs1413563776 4432 dbSNP
rs111912304 4437 dbSNP
rs1348604300 4438 dbSNP
rs1307313577 4441 dbSNP
rs923005712 4452 dbSNP
rs950536750 4456 dbSNP
rs1410143246 4470 dbSNP
rs1459758270 4487 dbSNP
rs1367206401 4491 dbSNP
rs557179954 4491 dbSNP
rs76656561 4494 dbSNP
rs983588864 4505 dbSNP
rs932218561 4508 dbSNP
rs750100571 4509 dbSNP
rs761610705 4514 dbSNP
rs942260245 4515 dbSNP
rs1159837406 4521 dbSNP
rs1055419691 4523 dbSNP
rs3747676 4524 dbSNP
rs1411945786 4526 dbSNP
rs7683093 4535 dbSNP
rs576914614 4538 dbSNP
rs776616085 4538 dbSNP
rs1351185840 4539 dbSNP
rs1046852113 4548 dbSNP
rs902568482 4553 dbSNP
rs1286577241 4572 dbSNP
rs1203525070 4573 dbSNP
rs545579663 4579 dbSNP
rs373076210 4580 dbSNP
rs45598031 4590 dbSNP
rs1347259915 4591 dbSNP
rs1265865520 4607 dbSNP
rs1435455203 4634 dbSNP
rs1345469037 4638 dbSNP
rs1355497847 4644 dbSNP
rs754667365 4653 dbSNP
rs1208022410 4669 dbSNP
rs571992641 4681 dbSNP
rs45594531 4697 dbSNP
rs1471257279 4698 dbSNP
rs752640425 4718 dbSNP
rs1476215 4721 dbSNP
rs115581650 4722 dbSNP
rs1191300188 4722 dbSNP
rs1464560820 4723 dbSNP
rs1263850085 4730 dbSNP
rs913091467 4731 dbSNP
rs1325633370 4736 dbSNP
rs968761944 4737 dbSNP
rs1218488014 4740 dbSNP
rs1476216 4748 dbSNP
rs193177947 4750 dbSNP
rs1165868606 4752 dbSNP
rs1432461672 4752 dbSNP
rs983240927 4756 dbSNP
rs536593273 4757 dbSNP
rs1336856904 4758 dbSNP
rs1454092587 4764 dbSNP
rs909374689 4774 dbSNP
rs963506997 4775 dbSNP
rs1410945980 4778 dbSNP
rs1422102665 4789 dbSNP
rs991400504 4794 dbSNP
rs1166459267 4804 dbSNP
rs916815778 4830 dbSNP
rs1171045571 4842 dbSNP
rs1185550658 4845 dbSNP
rs1460026519 4850 dbSNP
rs949683611 4860 dbSNP
rs932009163 4864 dbSNP
rs1371774563 4876 dbSNP
rs1429178606 4877 dbSNP
rs765435562 4880 dbSNP
rs1046380015 4895 dbSNP
rs1052417278 4903 dbSNP
rs923961176 4905 dbSNP
rs912165524 4906 dbSNP
rs1376339992 4910 dbSNP
rs935415415 4919 dbSNP
rs1053831439 4923 dbSNP
rs538183843 4938 dbSNP
rs530807859 4943 dbSNP
rs1429485655 4945 dbSNP
rs1313115993 4949 dbSNP
rs552375660 4955 dbSNP
rs1476217 4961 dbSNP
rs1177802066 4970 dbSNP
rs1276675687 4985 dbSNP
rs1202826678 4986 dbSNP
rs1482600573 4992 dbSNP
rs1292142420 5004 dbSNP
rs41278093 5006 dbSNP
rs1319493632 5007 dbSNP
rs548083088 5011 dbSNP
rs1311418479 5012 dbSNP
rs1376225484 5015 dbSNP
rs1203781382 5016 dbSNP
rs995659823 5017 dbSNP
rs535041419 5018 dbSNP
rs1366587470 5020 dbSNP
rs1305274088 5025 dbSNP
rs900385457 5027 dbSNP
rs1456600835 5032 dbSNP
rs1484006017 5050 dbSNP
rs1182090084 5055 dbSNP
rs1255834344 5060 dbSNP
rs997869608 5067 dbSNP
rs1420936820 5070 dbSNP
rs1029997213 5072 dbSNP
rs905494591 5078 dbSNP
rs45628734 5083 dbSNP
rs1472186064 5086 dbSNP
rs1004560832 5091 dbSNP
rs1224376753 5096 dbSNP
rs1487320412 5098 dbSNP
rs1264470053 5100 dbSNP
rs549708129 5106 dbSNP
rs1429728189 5111 dbSNP
rs778210679 5111 dbSNP
rs184614458 5113 dbSNP
rs749509338 5119 dbSNP
rs771186721 5120 dbSNP
rs1346637602 5127 dbSNP
rs963142260 5128 dbSNP
rs990975941 5132 dbSNP
rs112096878 5146 dbSNP
rs189884686 5161 dbSNP
rs1385421039 5165 dbSNP
rs1024252509 5170 dbSNP
rs746258608 5177 dbSNP
rs369016432 5178 dbSNP
rs1386556735 5180 dbSNP
rs553073380 5181 dbSNP
rs770744253 5182 dbSNP
rs201425662 5183 dbSNP
rs201003321 5189 dbSNP
rs1194784074 5192 dbSNP
rs1250416558 5195 dbSNP
rs772371931 5199 dbSNP
rs1429863111 5202 dbSNP
rs775626826 5205 dbSNP
rs760759960 5209 dbSNP
rs1029092528 5215 dbSNP
rs1169432364 5216 dbSNP
rs561457664 5226 dbSNP
rs935299140 5232 dbSNP
rs747627491 5233 dbSNP
rs201825800 5242 dbSNP
rs762419554 5245 dbSNP
rs765636272 5258 dbSNP
rs1298859944 5263 dbSNP
rs147264289 5272 dbSNP
rs758646216 5273 dbSNP
rs1488072426 5275 dbSNP
rs1299335139 5280 dbSNP
rs1339705271 5286 dbSNP
rs767282153 5287 dbSNP
rs543736031 5288 dbSNP
rs112772657 5294 dbSNP
rs1189212297 5299 dbSNP
rs1489064276 5300 dbSNP
rs752337670 5302 dbSNP
rs1251724999 5309 dbSNP
rs113287409 5310 dbSNP
rs200889371 5322 dbSNP
rs1363235036 5323 dbSNP
rs753377427 5325 dbSNP
rs771405199 5327 dbSNP
rs61524225 5335 dbSNP
rs757241610 5335 dbSNP
rs796750853 5335 dbSNP
rs1048593293 5336 dbSNP
rs1459041515 5341 dbSNP
rs1376866729 5345 dbSNP
rs532370438 5350 dbSNP
rs1450978340 5356 dbSNP
rs1245783407 5357 dbSNP
rs1187440065 5366 dbSNP
rs937111937 5371 dbSNP
rs1389107949 5373 dbSNP
rs1199250845 5377 dbSNP
rs545915939 5378 dbSNP
rs1056713682 5383 dbSNP
rs559374356 5384 dbSNP
rs1287030710 5387 dbSNP
rs1369720285 5389 dbSNP
rs886360972 5400 dbSNP
rs1340358308 5420 dbSNP
rs565714132 5440 dbSNP
rs772259180 5441 dbSNP
rs904336574 5441 dbSNP
rs1300056984 5442 dbSNP
rs898903575 5446 dbSNP
rs1012433660 5452 dbSNP
rs548024082 5455 dbSNP
rs45593942 5463 dbSNP
rs1431375288 5465 dbSNP
rs1464740467 5480 dbSNP
rs1167567745 5483 dbSNP
rs1444796894 5489 dbSNP
rs111619148 5490 dbSNP
rs1442385785 5492 dbSNP
rs550565571 5497 dbSNP
rs1031172262 5498 dbSNP
rs1248961607 5505 dbSNP
rs768489984 5506 dbSNP
rs956968770 5508 dbSNP
rs191242224 5509 dbSNP
rs1358672809 5513 dbSNP
rs1423189185 5514 dbSNP
rs915269110 5524 dbSNP
rs1244116413 5530 dbSNP
rs528761310 5531 dbSNP
rs942779061 5538 dbSNP
rs987992426 5556 dbSNP
rs1456500173 5557 dbSNP
rs1156714610 5558 dbSNP
rs1351521655 5568 dbSNP
rs975938811 5587 dbSNP
rs922721467 5596 dbSNP
rs1424926633 5601 dbSNP
rs1392388147 5602 dbSNP
rs1018951863 5612 dbSNP
rs933110778 5615 dbSNP
rs1437137723 5616 dbSNP
rs776563923 5617 dbSNP
rs1292399388 5620 dbSNP
rs972278038 5624 dbSNP
rs111907732 5627 dbSNP
rs920862030 5646 dbSNP
rs1453579925 5647 dbSNP
rs761125988 5648 dbSNP
rs183971761 5651 dbSNP
rs930784381 5652 dbSNP
rs1288575186 5653 dbSNP
rs980947220 5656 dbSNP
rs1222395640 5658 dbSNP
rs1270024203 5659 dbSNP
rs1230165481 5666 dbSNP
rs907765347 5674 dbSNP
rs1287528565 5677 dbSNP
rs1322805912 5683 dbSNP
rs926813684 5685 dbSNP
rs1244997436 5689 dbSNP
rs940617108 5694 dbSNP
rs937100665 5700 dbSNP
rs573960906 5703 dbSNP
rs1404321040 5704 dbSNP
rs1484069293 5705 dbSNP
rs1183068673 5709 dbSNP
rs1160672287 5717 dbSNP
rs1037354396 5730 dbSNP
rs769345353 5737 dbSNP
rs1056849122 5738 dbSNP
rs1411833383 5738 dbSNP
rs1471759832 5740 dbSNP
rs1491133371 5741 dbSNP
rs1491461073 5742 dbSNP
rs1479200930 5744 dbSNP
rs1011989580 5745 dbSNP
rs1198431971 5751 dbSNP
rs1447741507 5751 dbSNP
rs1206858558 5753 dbSNP
rs945728414 5753 dbSNP
rs1045177615 5757 dbSNP
rs772680808 5765 dbSNP
rs1219650492 5774 dbSNP
rs1004096259 5775 dbSNP
rs553110156 5780 dbSNP
rs956937592 5782 dbSNP
rs1363699739 5784 dbSNP
rs1011135504 5794 dbSNP
rs1431101834 5795 dbSNP
rs1435331660 5818 dbSNP
rs144978673 5820 dbSNP
rs1322014710 5822 dbSNP
rs1349474525 5841 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000264498.3 | 3UTR | UUUUUAACUUCUUGCUGCUCUUUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000264498.3 | 3UTR | AAUAUUUCUUUGGCUGCUACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000264498.3 | 3UTR | AAUCUUACAGAUGCUGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000264498.3 | 3UTR | AAUUUAAAAUAUUUUGCUGCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.596 2.8e-3 0.487 1.5e-2 20 Click to see details
GSE21032 Prostate cancer -0.259 9.0e-3 -0.214 2.6e-2 83 Click to see details
GSE21687 Ependynoma primary tumors 0.286 1.1e-2 0.335 3.4e-3 64 Click to see details
GSE19536 Breast cancer -0.21 1.8e-2 -0.257 4.9e-3 100 Click to see details
GSE19783 ER- ER- breast cancer -0.215 2.9e-2 -0.263 9.6e-3 79 Click to see details
GSE17498 Multiple myeloma -0.244 6.5e-2 -0.177 1.4e-1 40 Click to see details
GSE38226 Liver fibrosis 0.288 1.0e-1 0.382 4.4e-2 21 Click to see details
GSE17306 Multiple myeloma -0.152 1.5e-1 -0.150 1.5e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.215 1.6e-1 -0.230 1.4e-1 24 Click to see details
GSE28544 Breast cancer 0.147 2.5e-1 0.480 8.8e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.15 2.5e-1 -0.371 4.1e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.188 2.7e-1 -0.088 3.9e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.11 3.0e-1 -0.138 2.6e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.136 3.1e-1 0.229 2.0e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.119 3.1e-1 -0.171 2.4e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.044 3.4e-1 0.020 4.3e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.094 3.9e-1 0.259 2.1e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.036 4.3e-1 -0.053 4.0e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.009 4.8e-1 0.088 3.2e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.009 4.8e-1 0.088 3.2e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.009 4.8e-1 0.088 3.2e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.751 0 -0.799 0 32 Click to see details
PRAD -0.378 0 -0.286 0.02 50 Click to see details
HNSC -0.264 0.05 -0.256 0.05 42 Click to see details
LIHC 0.241 0.05 0.187 0.1 49 Click to see details
BLCA -0.383 0.06 -0.261 0.15 18 Click to see details
LUSC 0.249 0.07 0.218 0.09 38 Click to see details
KIRC -0.167 0.09 -0.160 0.1 68 Click to see details
CHOL -0.437 0.12 -0.517 0.08 9 Click to see details
COAD -0.443 0.14 -0.619 0.05 8 Click to see details
PAAD -0.687 0.16 -1.000 0.5 4 Click to see details
ESCA 0.223 0.25 0.291 0.19 11 Click to see details
THCA -0.085 0.26 -0.247 0.03 59 Click to see details
KICH -0.099 0.32 -0.162 0.22 25 Click to see details
BRCA 0.047 0.34 0.037 0.37 84 Click to see details
UCEC -0.08 0.37 -0.011 0.48 19 Click to see details
CESC -0.386 0.37 -0.500 0.33 3 Click to see details
KIRP -0.054 0.38 -0.047 0.4 32 Click to see details
LUAD -0.046 0.44 -0.077 0.41 12 Click to see details
PCPG -0.087 0.47 0.500 0.33 3 Click to see details
PCPG -0.087 0.47 0.500 0.33 3 Click to see details
PCPG -0.087 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B