miRTarBase - #MIRT206020 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NUP50   
Synonyms NPAP60, NPAP60L
Description nucleoporin 50
Transcript NM_007172   
Other Transcripts NM_153645   
Expression
Putative miRNA Targets on NUP50
3'UTR of NUP50
(miRNA target sites are highlighted)
>NUP50|NM_007172|3'UTR
   1 ACACGCAAAGTCGGCTGCAGAATTATTGCCAAGTTGCTGCTGCTTCCACCGCCCCTTAAAGTTAGTCAGTTTTTCTTCTC
  81 TTCTTTGACATTCTAAGAACTTATAGATAACTTAAAACTTTTGTGAGGAAGATTAATGTGGCCAATAAAACCTTTAAATG
 161 TTAAGTGTCAAGAAACTGCACTCTCCCTTCTTAAGAACTGCCTAAAGTGTAAAATACATTTGAATGCAATTTTTGGAAGA
 241 TTTTTTAATGTTCGTTTATTAAACTAACCCTAAGTGATTTCTTCAAGGACTGCAATCAGGGTATCAATTTGCTTTCCCAA
 321 AGGCTCTTCCAACCCGTGGGTTTTGGGGTCCACCGCCACCACGAGAGAGGCTTTTGAACAGGTGCCTGGCTGTGTTCAGA
 401 AGGAAGCTGGCCTGTGTGCTTCTCTCCGGTGGGCTCAGCCGACGTGTGAGACTTGTTCTGTTACCAAATGAACCGGGCTG
 481 CCACGCTGTGACAGGCGTTTGTCCTCTGCTTTATTTTTACTTTGAAGCTCAAATGCGAGTACTAAGTGTTCACCTCAGCG
 561 TTCGAATCATTGGCCTGTAACCCTGTGGGCTGCTTCACGAGAATTCAGGACCTGCATTTTCATTCTAAAAAGAAATGAAC
 641 AGCTTGTGAAGGAGTTTTTTGGCTTCATAGTTTCTATTCATGAGGTAGTGTTACTTCTTTATCCCCCTAAAGACAAAATG
 721 AAGATAAAGGGGGATTGCCAGGAATGGGTTTAAAAGCACAAATGTGGTAGCTTATCATCTACACCATGGAGAGTGAACCC
 801 TTACGAAATGAAAGTCAAATGAGACCATCCGAGAAAAAGATGCGCATAGGCATTTGTACCATGATCAACCCCACGCACAT
 881 GAAAACTGTGACCAAGTGACGTGCCTGGGAGCTTTGACACACGAGCCGTGTGAATTCACTAGGAAACATGTAATAAAGTC
 961 ATGGAAGAGAAAATCGTGTGTAAACTTTGCCTTTAACTTTAGACCGCAGTATATTATAATACATTTGATATCTGAAATAT
1041 CTTTACTTTTTTAAGAGTAAGATTCCATATGTCTGTCTGGAAGGGAGCCATGGTTATTCACACGAATATCCCTGTCACTT
1121 CTCCAGAGGTGTCAGGTAACTAACACGAGCATTCTTTGAAGACTCTGGGCACATGAATGATACACAGAATTGAATGTTTA
1201 AATTTCCACTGAGTCCTCATGAATCATTTGAGACTAGTACCAGCTGATCTTGTGTACAGGCTCAGGGTCAGTGCCCAAGG
1281 GCTCCCGCGTGTGTGTTCTGATCTTCAGTGCGTAGCACATTCTCCATTTAGAAAAGAGTGGTCAGAATAATTGTGGACGG
1361 TACAGTGGCTTTTTAAAACTACAGTCTTTAGGTGTAAGGTTTGGCGCCGGGAGCAATTTTATGATCAAATATGATGAACT
1441 CCTAAGTCACTGAGGTGTGATTGGGCCAATGTTGGCATGAGGTTCTTGCTCTACTTCCAGTGTTTTGATTCCACTGGGAG
1521 AATTTGGCCTAGTGTGTGGCTTTGGATGAATCCGTGTAGAGAGAGGTGAGCTTGTCCTGTTACAGATGCTGTCAGACATA
1601 GCGATAGTAGGCACCTAGGGAGGAAGTGGCCGTTAGTTTTACACTGACTTTTTAAGAATGGAGAATGCACGTGGGTTTCT
1681 GTTGCGGATGATTCATAGTAAGCAAGCGGTTGATGCTGTTAATACCGGCCCCACCCGATTGACATTAAGTTTATTCAGCT
1761 TTTAAAAAGATGAAGAACTAAGGGGAACAAATTTAAGTTTGTTGCAACTTAGCCACACATGCTTCCCTGGTACCAGCTGG
1841 AATCAGCAGCTCACAGGCATCTTCAGGACACTTCAGTGTATATGACACAGTACTTTGTTAGCGTCTGCGTGTGTATGGAA
1921 AGTTGACAAAAAATGGCATGAAAAGATCATGATTGGATTTTCTTTTAAACCTGCCCTTCTGTAAAAAATAGTTTATATAT
2001 TTTTAAATTAGTAGGTATGTGTGGCTTCCTTTTTTCCTAACATTCCCAGCAAATTTTTGCTGCTAAGACTATCACTGTTA
2081 AAGTGAAAATTACAGGGAAAAATGTGATGAATATACCGTAACTCAAAATGTGATATTTTCTTAAAATCACTCTTTTATGC
2161 TTTAGGAACTGGTTGGTCTCCACTTTGATTATTAGTGTAAAGAGCCTGAGTATACGTGGATTTCATTGTAAAATTTAACT
2241 CCTTGTCTTTTACTTGGGGCACGGGGCCCCTGGAGGGCTTCCCTACTTTCCCCACTATGTTAACAGGTAATTCTGATTTA
2321 TGCGTTTAGTTTGACTTATTTTTAACAAAATATTAGAAGTTATGCTTTAAAATGTTTAATGTGGACTGAAATTTTCATCT
2401 TTTGTTTGAGAATCTATGAAGTGTATCATATACGTGGCCTAAAGCAAGGTGTGTATTTTGTTATTCTGAAATTGTTTTGC
2481 ATCTGGACAAATACTAAATATCCCAGTGGCCTTTTTTTTTTTTTTTTTAAAACCTGTGTATCCATCTCATCCTTTTGCGC
2561 ATTCCTAGTAAGCAAAAAAATTTGTTATGCCATCTTCATTATTCGAATTACAGACTGAAAAAATATGGCCAGTTTTTAAA
2641 GAAGTTTAGATTATGTTTTCCATGGAAGGACAAGTCTGACTGTTCATAGGCTGATTTTCTTTAAGAGGATTATTCTGTTT
2721 TACAATTTCAATTCTAGATCACATTTTATATATGCTGCATGCCAAAAAAAAAAAAAAGAGAAAACTGCCTTTTCTGGTGT
2801 GGAGGGGAAGAAAAACTAATATTCTACCTTACTAGTAGAGTTCAAAACAAGTTTTCACTGAGAGCCTTTTCAGTAAAAGT
2881 TAAACAAGTTTGTTTTTTGAGCATTTGTCAGTTATTCTATTTCAGAAGAGTCAAAATTCAAGCACGATACATTTTGAAGG
2961 CTTTGCAAACTCCTAAACCCCTGATGAGTCCTCTCATTCTGGAAGTGGGAATTTGAGTAGATACTGATTTGTCCCGTAGT
3041 ATGGCAGATGACAGGGAGGTCTTTTCCAAGCAGGCACTCAGAACACAGGTCACCGTATGTTCTCAGCCAGTAACAATCAT
3121 ACTGAGGACGAAGGACTCTCCGTTTGATGCAGACACAATTGTAATGGAGATGTAAAACTTCTTAGCAATCAGATGGATAA
3201 ATTGTTTGCTTTTTACTTTAAATAGGAAATTGTTTTCTAAAACTAAAATACTTGAATTGTCAGACAATATAATCTCAGCT
3281 TGTATTAGTTTTTGAATGCTCCCATCGAGGAAGTGTAACAATCCATGAAATGTGAATAAATGAAAAGTAAACAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGU-UUGGUAA---UAC-ACGACGAu 5'
            || ||::|||   | | ||||||| 
Target 5' tgCAGAATTATTGCCAAGTTGCTGCTg 3'
16 - 42 156.00 -13.50
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | |:| | | | ||||||| 
Target 5' tcCCAGCAAATTTTTGCTGCTa 3'
2044 - 2065 156.00 -12.30
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||:| :||:  |||||:| 
Target 5' agCAAGCGGTTG-ATGCTGTTa 3'
1701 - 1721 143.00 -16.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168785 11 COSMIC
COSN13920459 13 COSMIC
COSN31605365 23 COSMIC
COSN20117547 36 COSMIC
COSN15315774 37 COSMIC
COSN15322190 38 COSMIC
COSN31541378 51 COSMIC
COSN17153236 60 COSMIC
COSN8566696 90 COSMIC
COSN31510966 91 COSMIC
COSN30183612 94 COSMIC
COSN31482727 196 COSMIC
COSN31596519 263 COSMIC
COSN28794666 301 COSMIC
COSN25058324 392 COSMIC
COSN31516169 777 COSMIC
COSN14842555 961 COSMIC
COSN20117551 1211 COSMIC
COSN8020079 1508 COSMIC
COSN1900182 1520 COSMIC
COSN1900183 1622 COSMIC
COSN31541711 1875 COSMIC
COSN31584577 1967 COSMIC
COSN31579911 2021 COSMIC
COSN14838399 2056 COSMIC
COSN30164290 2107 COSMIC
COSN30542335 2119 COSMIC
COSN29242309 2141 COSMIC
COSN31513690 2196 COSMIC
COSN31967763 2380 COSMIC
COSN20117554 2529 COSMIC
COSN20117556 2529 COSMIC
COSN20117557 2778 COSMIC
COSN28727910 2991 COSMIC
COSN30040490 3173 COSMIC
COSN31571991 3201 COSMIC
COSN28648449 3205 COSMIC
COSN31967764 3226 COSMIC
COSN31967765 3227 COSMIC
COSN28648450 3268 COSMIC
COSN26578578 3300 COSMIC
COSN20986489 3308 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1228619481 4 dbSNP
rs1240395572 5 dbSNP
rs774655476 5 dbSNP
rs376546951 6 dbSNP
rs1470137682 7 dbSNP
rs928952035 8 dbSNP
rs530983812 13 dbSNP
rs761314487 14 dbSNP
rs1195868910 17 dbSNP
rs764070666 18 dbSNP
rs1477524646 20 dbSNP
rs753982532 21 dbSNP
rs1302715078 23 dbSNP
rs1433439060 25 dbSNP
rs757489913 27 dbSNP
rs765589224 28 dbSNP
rs751350630 30 dbSNP
rs1324988957 33 dbSNP
rs369753596 34 dbSNP
rs1362334802 35 dbSNP
rs879312095 35 dbSNP
rs1491582382 36 dbSNP
rs386821877 36 dbSNP
rs1052234 37 dbSNP
rs1491542901 37 dbSNP
rs1063693 38 dbSNP
rs201566541 38 dbSNP
rs1461699366 47 dbSNP
rs781107879 48 dbSNP
rs1383921667 49 dbSNP
rs748021618 51 dbSNP
rs777194973 52 dbSNP
rs199877687 55 dbSNP
rs141363348 56 dbSNP
rs372662193 56 dbSNP
rs1000043278 58 dbSNP
rs200921847 60 dbSNP
rs1246545942 64 dbSNP
rs373980842 64 dbSNP
rs536352478 71 dbSNP
rs1450043947 79 dbSNP
rs1170442715 81 dbSNP
rs1413438170 81 dbSNP
rs1010633576 82 dbSNP
rs1383245319 83 dbSNP
rs1457224903 86 dbSNP
rs568595491 87 dbSNP
rs183359655 91 dbSNP
rs1458622899 94 dbSNP
rs1029699384 96 dbSNP
rs955410573 97 dbSNP
rs774142280 103 dbSNP
rs1018431780 105 dbSNP
rs1259098397 108 dbSNP
rs773205063 108 dbSNP
rs563729216 114 dbSNP
rs962885091 114 dbSNP
rs1291480464 118 dbSNP
rs3178096 120 dbSNP
rs1229172299 127 dbSNP
rs1272938576 132 dbSNP
rs1231903390 136 dbSNP
rs796141064 138 dbSNP
rs111542786 141 dbSNP
rs534493773 142 dbSNP
rs983513937 147 dbSNP
rs1324709204 160 dbSNP
rs1244601620 161 dbSNP
rs1325666587 163 dbSNP
rs1387535876 165 dbSNP
rs1052241 173 dbSNP
rs916921410 176 dbSNP
rs949765028 186 dbSNP
rs1425518271 187 dbSNP
rs1266387492 188 dbSNP
rs769719082 201 dbSNP
rs1171256068 202 dbSNP
rs1475057115 205 dbSNP
rs1370822664 206 dbSNP
rs1200452366 208 dbSNP
rs1044141786 211 dbSNP
rs1251923275 238 dbSNP
rs1211439386 241 dbSNP
rs1202967177 242 dbSNP
rs1459338383 250 dbSNP
rs905674255 250 dbSNP
rs12168191 254 dbSNP
rs1464971757 255 dbSNP
rs1234130500 258 dbSNP
rs1370356628 262 dbSNP
rs1189866915 269 dbSNP
rs1301438269 271 dbSNP
rs891701084 275 dbSNP
rs1010164986 277 dbSNP
rs1241277298 284 dbSNP
rs1409272355 287 dbSNP
rs1030038853 290 dbSNP
rs1174256971 293 dbSNP
rs1165280744 297 dbSNP
rs1393987615 297 dbSNP
rs1369948611 298 dbSNP
rs891152186 300 dbSNP
rs9614613 301 dbSNP
rs1018359514 302 dbSNP
rs974645698 304 dbSNP
rs1025845049 305 dbSNP
rs1157247259 306 dbSNP
rs1388108982 315 dbSNP
rs35234255 316 dbSNP
rs1347197471 321 dbSNP
rs1278318672 324 dbSNP
rs1435911226 335 dbSNP
rs1322637801 336 dbSNP
rs537309944 337 dbSNP
rs1333768990 350 dbSNP
rs1336045249 351 dbSNP
rs1435288361 353 dbSNP
rs992424306 353 dbSNP
rs1313929703 355 dbSNP
rs1380591391 356 dbSNP
rs556997758 356 dbSNP
rs868652924 358 dbSNP
rs1176283578 359 dbSNP
rs575194821 360 dbSNP
rs1226886255 363 dbSNP
rs2673084 364 dbSNP
rs1329427354 367 dbSNP
rs1210117680 369 dbSNP
rs542761546 379 dbSNP
rs1283742569 389 dbSNP
rs1222310185 390 dbSNP
rs1348215478 391 dbSNP
rs751293082 395 dbSNP
rs763917288 398 dbSNP
rs757014701 411 dbSNP
rs559476801 417 dbSNP
rs781117141 421 dbSNP
rs751122458 422 dbSNP
rs573413800 427 dbSNP
rs761226982 428 dbSNP
rs1333560151 429 dbSNP
rs1398620075 431 dbSNP
rs1457953099 435 dbSNP
rs750297530 438 dbSNP
rs1475166947 441 dbSNP
rs1255950123 444 dbSNP
rs1161523750 445 dbSNP
rs1051022982 446 dbSNP
rs1213879116 448 dbSNP
rs1453578143 449 dbSNP
rs1465571032 453 dbSNP
rs755934291 459 dbSNP
rs1006878978 468 dbSNP
rs1291288832 472 dbSNP
rs780052391 475 dbSNP
rs545269956 476 dbSNP
rs898574904 478 dbSNP
rs1428182035 483 dbSNP
rs1350783722 484 dbSNP
rs6007494 485 dbSNP
rs186493907 487 dbSNP
rs951595794 488 dbSNP
rs1014224218 489 dbSNP
rs1025166440 493 dbSNP
rs1429678881 495 dbSNP
rs1418852474 497 dbSNP
rs755080818 498 dbSNP
rs779004120 503 dbSNP
rs1479121190 504 dbSNP
rs969633844 507 dbSNP
rs1482029840 510 dbSNP
rs979733394 514 dbSNP
rs1467837006 524 dbSNP
rs1271062714 530 dbSNP
rs1204248424 531 dbSNP
rs144010532 537 dbSNP
rs1294232892 538 dbSNP
rs1473062964 540 dbSNP
rs1212353251 541 dbSNP
rs989935532 542 dbSNP
rs1303631647 544 dbSNP
rs913028943 547 dbSNP
rs945888617 549 dbSNP
rs1333835703 557 dbSNP
rs550816782 560 dbSNP
rs942628110 561 dbSNP
rs1434915502 565 dbSNP
rs1039692587 566 dbSNP
rs898498872 567 dbSNP
rs995971970 570 dbSNP
rs1428360071 576 dbSNP
rs1480913161 579 dbSNP
rs1307853649 583 dbSNP
rs147264730 584 dbSNP
rs748348382 586 dbSNP
rs1272732134 587 dbSNP
rs1366385056 592 dbSNP
rs767282597 593 dbSNP
rs561601177 594 dbSNP
rs1302747670 597 dbSNP
rs1392269659 598 dbSNP
rs1340027899 599 dbSNP
rs1025135332 600 dbSNP
rs1468051607 607 dbSNP
rs1275214454 609 dbSNP
rs905443371 612 dbSNP
rs1483925156 617 dbSNP
rs530018557 622 dbSNP
rs1173141089 623 dbSNP
rs1002416331 624 dbSNP
rs1382465637 633 dbSNP
rs1160129534 638 dbSNP
rs1033954670 644 dbSNP
rs1249577679 650 dbSNP
rs1175388435 651 dbSNP
rs1486632872 653 dbSNP
rs546715213 657 dbSNP
rs990252622 661 dbSNP
rs772338263 662 dbSNP
rs1287633257 667 dbSNP
rs1239359223 674 dbSNP
rs967572990 681 dbSNP
rs986623932 682 dbSNP
rs566845752 685 dbSNP
rs942554462 686 dbSNP
rs1312339880 689 dbSNP
rs1362548235 690 dbSNP
rs867876247 691 dbSNP
rs1453376019 693 dbSNP
rs975346282 694 dbSNP
rs1156745514 705 dbSNP
rs919891140 734 dbSNP
rs755603115 737 dbSNP
rs1418414001 746 dbSNP
rs1187143470 748 dbSNP
rs931315476 749 dbSNP
rs534859341 752 dbSNP
rs1263249917 757 dbSNP
rs1485364633 763 dbSNP
rs773445786 768 dbSNP
rs1235595793 772 dbSNP
rs572977487 774 dbSNP
rs1432023087 776 dbSNP
rs949502974 785 dbSNP
rs1046511569 786 dbSNP
rs1436720741 787 dbSNP
rs1381857727 788 dbSNP
rs1383147022 792 dbSNP
rs1294814552 793 dbSNP
rs1362438915 794 dbSNP
rs1394984706 794 dbSNP
rs1164070100 795 dbSNP
rs747406030 798 dbSNP
rs1474213659 799 dbSNP
rs1374263270 800 dbSNP
rs769551267 803 dbSNP
rs1002383709 805 dbSNP
rs1215185502 805 dbSNP
rs1298255316 806 dbSNP
rs1032583952 811 dbSNP
rs1344139909 814 dbSNP
rs894073989 817 dbSNP
rs551296168 819 dbSNP
rs1011240489 821 dbSNP
rs1270831066 829 dbSNP
rs6007495 831 dbSNP
rs967120727 832 dbSNP
rs1441946292 833 dbSNP
rs1321394399 839 dbSNP
rs986550091 844 dbSNP
rs536967259 845 dbSNP
rs573494625 849 dbSNP
rs115621416 853 dbSNP
rs1168442416 857 dbSNP
rs963885500 863 dbSNP
rs762334681 864 dbSNP
rs1463613121 870 dbSNP
rs191291915 871 dbSNP
rs919833061 874 dbSNP
rs931260643 876 dbSNP
rs982794213 880 dbSNP
rs908543014 881 dbSNP
rs1413484525 887 dbSNP
rs1337475508 888 dbSNP
rs183030537 893 dbSNP
rs1046479778 894 dbSNP
rs187938822 901 dbSNP
rs1302400438 908 dbSNP
rs1433713690 917 dbSNP
rs192977501 921 dbSNP
rs905317494 923 dbSNP
rs1367333605 924 dbSNP
rs139118087 928 dbSNP
rs767280423 929 dbSNP
rs938166098 938 dbSNP
rs1171367162 940 dbSNP
rs528050032 942 dbSNP
rs1054402242 943 dbSNP
rs1229763440 944 dbSNP
rs1436620088 945 dbSNP
rs111498818 948 dbSNP
rs1010242776 951 dbSNP
rs1208252023 959 dbSNP
rs1268828940 965 dbSNP
rs1278383929 966 dbSNP
rs185074842 969 dbSNP
rs1186085976 976 dbSNP
rs1238231901 977 dbSNP
rs1348617002 979 dbSNP
rs60565093 985 dbSNP
rs1811817 986 dbSNP
rs1414793647 990 dbSNP
rs1374352080 991 dbSNP
rs1473336731 992 dbSNP
rs1331734281 993 dbSNP
rs1402134459 1000 dbSNP
rs189148506 1001 dbSNP
rs192395918 1003 dbSNP
rs1469047903 1004 dbSNP
rs755958193 1006 dbSNP
rs1007950467 1007 dbSNP
rs530079398 1008 dbSNP
rs1456361963 1009 dbSNP
rs1485355990 1010 dbSNP
rs1159316077 1016 dbSNP
rs1255528126 1022 dbSNP
rs748513734 1022 dbSNP
rs1218168977 1023 dbSNP
rs1447862179 1024 dbSNP
rs1284692219 1027 dbSNP
rs1019361277 1029 dbSNP
rs1386541388 1032 dbSNP
rs1295001725 1033 dbSNP
rs542059940 1037 dbSNP
rs1354234973 1041 dbSNP
rs566099376 1041 dbSNP
rs11090729 1042 dbSNP
rs1317199267 1043 dbSNP
rs1455921940 1044 dbSNP
rs1397167029 1046 dbSNP
rs1166230717 1047 dbSNP
rs1475188519 1048 dbSNP
rs1411707302 1052 dbSNP
rs952624309 1056 dbSNP
rs1450037082 1057 dbSNP
rs1475787421 1059 dbSNP
rs1286213680 1064 dbSNP
rs1348916291 1067 dbSNP
rs983125512 1068 dbSNP
rs1463347595 1070 dbSNP
rs1274859014 1074 dbSNP
rs908513179 1085 dbSNP
rs970692261 1087 dbSNP
rs754956260 1093 dbSNP
rs761444256 1100 dbSNP
rs778951227 1104 dbSNP
rs926707802 1105 dbSNP
rs938131984 1115 dbSNP
rs1443491223 1117 dbSNP
rs1053925921 1120 dbSNP
rs1213535149 1124 dbSNP
rs1373603509 1125 dbSNP
rs1327047662 1127 dbSNP
rs560456575 1131 dbSNP
rs1250031764 1135 dbSNP
rs771782216 1137 dbSNP
rs532503103 1140 dbSNP
rs945624484 1141 dbSNP
rs1410558692 1145 dbSNP
rs1043044859 1147 dbSNP
rs1455785720 1148 dbSNP
rs1476759291 1155 dbSNP
rs117394653 1162 dbSNP
rs1007879754 1165 dbSNP
rs1467870907 1166 dbSNP
rs1040770723 1167 dbSNP
rs899573721 1174 dbSNP
rs201991339 1179 dbSNP
rs997006009 1179 dbSNP
rs1271723834 1180 dbSNP
rs1225695831 1181 dbSNP
rs1303703970 1182 dbSNP
rs7287656 1182 dbSNP
rs952668494 1187 dbSNP
rs1004079272 1188 dbSNP
rs1300377241 1193 dbSNP
rs1305996843 1196 dbSNP
rs1015449356 1208 dbSNP
rs149514518 1209 dbSNP
rs147361184 1210 dbSNP
rs3041106 1210 dbSNP
rs376254136 1211 dbSNP
rs397798595 1211 dbSNP
rs982071209 1212 dbSNP
rs1173261567 1216 dbSNP
rs1432333734 1220 dbSNP
rs1265037944 1224 dbSNP
rs1337687018 1224 dbSNP
rs926634133 1242 dbSNP
rs959410728 1244 dbSNP
rs1274316360 1247 dbSNP
rs1346379843 1248 dbSNP
rs184963048 1250 dbSNP
rs1233154303 1253 dbSNP
rs770954972 1264 dbSNP
rs1310777473 1268 dbSNP
rs1309670092 1269 dbSNP
rs1224815392 1270 dbSNP
rs748294951 1271 dbSNP
rs1306723181 1273 dbSNP
rs1482943130 1274 dbSNP
rs188112978 1276 dbSNP
rs1376164227 1279 dbSNP
rs945522530 1280 dbSNP
rs1252314890 1283 dbSNP
rs1464765421 1286 dbSNP
rs758551417 1288 dbSNP
rs1411072214 1289 dbSNP
rs1419462531 1289 dbSNP
rs767460098 1289 dbSNP
rs180854610 1290 dbSNP
rs1257654088 1299 dbSNP
rs34645037 1304 dbSNP
rs1482105035 1306 dbSNP
rs1262860672 1308 dbSNP
rs373237994 1309 dbSNP
rs139278962 1313 dbSNP
rs2179059 1316 dbSNP
rs899500385 1318 dbSNP
rs1455164072 1320 dbSNP
rs1356133005 1326 dbSNP
rs932392344 1327 dbSNP
rs546500330 1332 dbSNP
rs1389415488 1333 dbSNP
rs552706755 1334 dbSNP
rs114692025 1335 dbSNP
rs1454080894 1335 dbSNP
rs1387676977 1337 dbSNP
rs1398975982 1338 dbSNP
rs538380124 1345 dbSNP
rs1476175523 1346 dbSNP
rs149945684 1347 dbSNP
rs575776168 1350 dbSNP
rs1421547457 1353 dbSNP
rs544396624 1359 dbSNP
rs532474971 1360 dbSNP
rs6007496 1362 dbSNP
rs574801310 1364 dbSNP
rs1296056318 1366 dbSNP
rs959649253 1373 dbSNP
rs1336180816 1375 dbSNP
rs989523707 1381 dbSNP
rs1242629689 1383 dbSNP
rs771360388 1385 dbSNP
rs540477114 1387 dbSNP
rs1381908401 1390 dbSNP
rs560307119 1393 dbSNP
rs532502291 1401 dbSNP
rs1462944932 1402 dbSNP
rs867457478 1406 dbSNP
rs546017059 1407 dbSNP
rs912070405 1409 dbSNP
rs144156546 1410 dbSNP
rs975008611 1414 dbSNP
rs530773463 1416 dbSNP
rs559975243 1419 dbSNP
rs1469429854 1422 dbSNP
rs1469189985 1426 dbSNP
rs1186043096 1427 dbSNP
rs932292241 1440 dbSNP
rs1208617065 1447 dbSNP
rs1449988961 1451 dbSNP
rs1048102053 1456 dbSNP
rs888187961 1461 dbSNP
rs550786843 1462 dbSNP
rs1162909475 1470 dbSNP
rs186254977 1471 dbSNP
rs1385046500 1472 dbSNP
rs1395413971 1476 dbSNP
rs768493700 1477 dbSNP
rs530022815 1478 dbSNP
rs1428694726 1480 dbSNP
rs1387861669 1481 dbSNP
rs1318606886 1482 dbSNP
rs1003387214 1483 dbSNP
rs1033543812 1486 dbSNP
rs1440115390 1492 dbSNP
rs1251331473 1493 dbSNP
rs773929369 1498 dbSNP
rs1282677716 1502 dbSNP
rs1235339071 1509 dbSNP
rs1022329409 1514 dbSNP
rs1274077017 1517 dbSNP
rs1230955282 1524 dbSNP
rs189514545 1525 dbSNP
rs967161198 1527 dbSNP
rs761420032 1529 dbSNP
rs1273429921 1530 dbSNP
rs566362298 1531 dbSNP
rs966189614 1534 dbSNP
rs371376574 1535 dbSNP
rs974933141 1540 dbSNP
rs1401932486 1546 dbSNP
rs1171262152 1549 dbSNP
rs1471365356 1553 dbSNP
rs1364821442 1554 dbSNP
rs1182120680 1555 dbSNP
rs922177360 1557 dbSNP
rs1259749640 1558 dbSNP
rs930946241 1558 dbSNP
rs984159498 1558 dbSNP
rs909552792 1561 dbSNP
rs939743364 1563 dbSNP
rs538604750 1567 dbSNP
rs1352583773 1572 dbSNP
rs1036755502 1582 dbSNP
rs1227756330 1582 dbSNP
rs927745739 1584 dbSNP
rs939168438 1594 dbSNP
rs1448296347 1596 dbSNP
rs1188234845 1598 dbSNP
rs558413661 1599 dbSNP
rs1274948338 1603 dbSNP
rs1253925305 1604 dbSNP
rs6007497 1605 dbSNP
rs895047857 1609 dbSNP
rs1456159451 1613 dbSNP
rs1420096795 1616 dbSNP
rs1188826473 1619 dbSNP
rs1418922667 1621 dbSNP
rs1476297471 1632 dbSNP
rs548811579 1633 dbSNP
rs1388039663 1636 dbSNP
rs1235886127 1638 dbSNP
rs772947000 1641 dbSNP
rs1195624848 1642 dbSNP
rs1448489488 1645 dbSNP
rs1268584712 1646 dbSNP
rs1044077879 1647 dbSNP
rs902529146 1649 dbSNP
rs999580226 1662 dbSNP
rs1228336578 1669 dbSNP
rs879701437 1671 dbSNP
rs554745935 1672 dbSNP
rs34705077 1676 dbSNP
rs574664260 1686 dbSNP
rs374066874 1687 dbSNP
rs1433522218 1688 dbSNP
rs1294273567 1689 dbSNP
rs1397236458 1691 dbSNP
rs1166124308 1697 dbSNP
rs1404785796 1702 dbSNP
rs996340363 1708 dbSNP
rs540902289 1709 dbSNP
rs1248408982 1710 dbSNP
rs985079383 1711 dbSNP
rs1463387968 1714 dbSNP
rs1254764537 1719 dbSNP
rs117937600 1723 dbSNP
rs1320557739 1725 dbSNP
rs1287187637 1726 dbSNP
rs181517487 1727 dbSNP
rs562881380 1728 dbSNP
rs1433270313 1729 dbSNP
rs146735713 1731 dbSNP
rs927714627 1737 dbSNP
rs1254252027 1738 dbSNP
rs1436462143 1741 dbSNP
rs1348191889 1745 dbSNP
rs1331054555 1760 dbSNP
rs1430495998 1761 dbSNP
rs939137321 1772 dbSNP
rs1166974476 1781 dbSNP
rs1447395646 1789 dbSNP
rs1482879150 1790 dbSNP
rs1427055884 1791 dbSNP
rs1211394069 1800 dbSNP
rs1055332476 1806 dbSNP
rs1244470477 1807 dbSNP
rs1205922733 1808 dbSNP
rs542299170 1820 dbSNP
rs946600536 1821 dbSNP
rs1043659857 1825 dbSNP
rs1350480577 1826 dbSNP
rs142588390 1830 dbSNP
rs999526022 1839 dbSNP
rs529882079 1845 dbSNP
rs1281794567 1848 dbSNP
rs1410461911 1855 dbSNP
rs901896342 1855 dbSNP
rs150918638 1866 dbSNP
rs1161371464 1873 dbSNP
rs560391459 1875 dbSNP
rs1465957460 1881 dbSNP
rs1313911200 1888 dbSNP
rs996265587 1891 dbSNP
rs761716059 1892 dbSNP
rs1029552520 1894 dbSNP
rs1184284132 1898 dbSNP
rs781513187 1904 dbSNP
rs1250476477 1908 dbSNP
rs1006831172 1909 dbSNP
rs1484069784 1909 dbSNP
rs1307033526 1919 dbSNP
rs140716375 1929 dbSNP
rs1209788847 1931 dbSNP
rs1225032540 1934 dbSNP
rs1310833672 1936 dbSNP
rs1298533198 1939 dbSNP
rs962308948 1940 dbSNP
rs1229593613 1949 dbSNP
rs1311574079 1956 dbSNP
rs1416849470 1963 dbSNP
rs186639298 1966 dbSNP
rs1302498135 1969 dbSNP
rs1465314500 1972 dbSNP
rs1234971308 1983 dbSNP
rs1282321269 1988 dbSNP
rs1481957312 1991 dbSNP
rs1161242919 1994 dbSNP
rs972363731 1999 dbSNP
rs1410580911 2000 dbSNP
rs1179309525 2006 dbSNP
rs1425056025 2008 dbSNP
rs1189549067 2009 dbSNP
rs767218296 2012 dbSNP
rs1204096235 2014 dbSNP
rs1232589892 2015 dbSNP
rs1482464149 2017 dbSNP
rs1270475274 2019 dbSNP
rs1209891027 2025 dbSNP
rs927641106 2025 dbSNP
rs565582968 2029 dbSNP
rs1235151574 2036 dbSNP
rs1179070481 2038 dbSNP
rs960403927 2048 dbSNP
rs1265317519 2052 dbSNP
rs1394547466 2054 dbSNP
rs1432623566 2058 dbSNP
rs1322378488 2062 dbSNP
rs1435553166 2070 dbSNP
rs1387747753 2075 dbSNP
rs1156890714 2079 dbSNP
rs1174832829 2092 dbSNP
rs1458958377 2099 dbSNP
rs1368581158 2102 dbSNP
rs1163608532 2104 dbSNP
rs1397359372 2104 dbSNP
rs1250281535 2106 dbSNP
rs1482979084 2110 dbSNP
rs990601297 2117 dbSNP
rs537571847 2118 dbSNP
rs547844840 2119 dbSNP
rs1212180674 2124 dbSNP
rs1488828649 2134 dbSNP
rs916369696 2137 dbSNP
rs1242861849 2145 dbSNP
rs946555872 2150 dbSNP
rs1298630822 2151 dbSNP
rs979715019 2157 dbSNP
rs923847729 2159 dbSNP
rs935246293 2161 dbSNP
rs1318425792 2164 dbSNP
rs1388499138 2166 dbSNP
rs1390812043 2174 dbSNP
rs1040361934 2175 dbSNP
rs767231299 2185 dbSNP
rs1391571996 2190 dbSNP
rs1168862393 2207 dbSNP
rs1449196546 2208 dbSNP
rs1388747380 2210 dbSNP
rs901863435 2211 dbSNP
rs773033606 2212 dbSNP
rs117586534 2216 dbSNP
rs867231488 2217 dbSNP
rs1050521388 2225 dbSNP
rs534382725 2227 dbSNP
rs754906078 2229 dbSNP
rs554216290 2242 dbSNP
rs1204755477 2243 dbSNP
rs1006386483 2244 dbSNP
rs879856688 2245 dbSNP
rs1235323597 2248 dbSNP
rs1331540413 2251 dbSNP
rs1245148891 2255 dbSNP
rs570489782 2263 dbSNP
rs1384517944 2264 dbSNP
rs377382102 2265 dbSNP
rs370149184 2268 dbSNP
rs539704916 2269 dbSNP
rs1369078782 2273 dbSNP
rs1174746259 2285 dbSNP
rs528175720 2285 dbSNP
rs1377515277 2286 dbSNP
rs1197416723 2287 dbSNP
rs12165531 2296 dbSNP
rs752717533 2307 dbSNP
rs1252690179 2312 dbSNP
rs1181715475 2319 dbSNP
rs758498250 2320 dbSNP
rs1411954739 2324 dbSNP
rs1058024 2325 dbSNP
rs1345479002 2328 dbSNP
rs1348868965 2332 dbSNP
rs576480115 2333 dbSNP
rs1221649928 2350 dbSNP
rs1351770285 2351 dbSNP
rs1327315230 2353 dbSNP
rs1408831596 2354 dbSNP
rs1333567993 2357 dbSNP
rs1362999481 2362 dbSNP
rs1434236017 2365 dbSNP
rs1335808816 2373 dbSNP
rs1270651814 2379 dbSNP
rs1023383003 2387 dbSNP
rs968238352 2390 dbSNP
rs1171313415 2401 dbSNP
rs1459339430 2416 dbSNP
rs1412792310 2422 dbSNP
rs1288075951 2423 dbSNP
rs1181467964 2424 dbSNP
rs1334429921 2426 dbSNP
rs1214455878 2428 dbSNP
rs542360566 2429 dbSNP
rs562150593 2430 dbSNP
rs935212102 2434 dbSNP
rs574730046 2435 dbSNP
rs540411521 2442 dbSNP
rs1201671637 2455 dbSNP
rs560047081 2459 dbSNP
rs1268693689 2464 dbSNP
rs190561878 2483 dbSNP
rs976010307 2486 dbSNP
rs1285560777 2487 dbSNP
rs1243143800 2496 dbSNP
rs923214286 2502 dbSNP
rs1340239225 2507 dbSNP
rs1390991975 2510 dbSNP
rs1159098611 2511 dbSNP
rs1389943044 2511 dbSNP
rs1398980286 2511 dbSNP
rs1437736116 2511 dbSNP
rs1252930633 2512 dbSNP
rs1431927035 2512 dbSNP
rs1466106697 2512 dbSNP
rs36054964 2512 dbSNP
rs754414678 2512 dbSNP
rs765672308 2512 dbSNP
rs79761340 2513 dbSNP
rs1180474180 2523 dbSNP
rs1050894597 2524 dbSNP
rs1475317864 2525 dbSNP
rs1166513202 2526 dbSNP
rs752832586 2527 dbSNP
rs765843011 2527 dbSNP
rs1312484917 2528 dbSNP
rs1456661894 2528 dbSNP
rs148586793 2528 dbSNP
rs756394115 2528 dbSNP
rs1320430486 2529 dbSNP
rs201638442 2529 dbSNP
rs887859316 2529 dbSNP
rs172866 2530 dbSNP
rs1346891807 2531 dbSNP
rs1445624639 2534 dbSNP
rs1283362371 2537 dbSNP
rs1324358656 2538 dbSNP
rs1355112503 2539 dbSNP
rs552158925 2545 dbSNP
rs1404843509 2546 dbSNP
rs183069900 2547 dbSNP
rs1295298550 2559 dbSNP
rs1451065347 2566 dbSNP
rs1036449740 2568 dbSNP
rs6006951 2572 dbSNP
rs1248391063 2573 dbSNP
rs1221590483 2574 dbSNP
rs1450560117 2576 dbSNP
rs1289086830 2580 dbSNP
rs1223227681 2581 dbSNP
rs570462500 2581 dbSNP
rs1003048195 2584 dbSNP
rs757474239 2587 dbSNP
rs376520839 2589 dbSNP
rs1285654820 2593 dbSNP
rs1297402970 2598 dbSNP
rs1213318462 2605 dbSNP
rs6007498 2606 dbSNP
rs567813443 2607 dbSNP
rs1023731258 2618 dbSNP
rs1310062749 2618 dbSNP
rs534169764 2619 dbSNP
rs967786830 2627 dbSNP
rs1189650096 2630 dbSNP
rs61348899 2633 dbSNP
rs979612260 2642 dbSNP
rs1030811948 2648 dbSNP
rs142100663 2650 dbSNP
rs1409236136 2652 dbSNP
rs1191729955 2654 dbSNP
rs956513622 2657 dbSNP
rs1266208071 2663 dbSNP
rs1183875918 2670 dbSNP
rs547978679 2672 dbSNP
rs1273471590 2677 dbSNP
rs746235849 2679 dbSNP
rs753007777 2686 dbSNP
rs923181910 2691 dbSNP
rs1279918678 2692 dbSNP
rs1412660148 2692 dbSNP
rs1343704883 2694 dbSNP
rs1290365132 2696 dbSNP
rs570911005 2697 dbSNP
rs1350044396 2700 dbSNP
rs1296693094 2708 dbSNP
rs142658935 2716 dbSNP
rs909208130 2719 dbSNP
rs753169388 2730 dbSNP
rs1469276493 2731 dbSNP
rs777938880 2732 dbSNP
rs1348852492 2734 dbSNP
rs919369770 2740 dbSNP
rs1175161338 2743 dbSNP
rs1484430192 2751 dbSNP
rs1238472301 2754 dbSNP
rs938832934 2757 dbSNP
rs1321953727 2758 dbSNP
rs1270595353 2760 dbSNP
rs1229033684 2761 dbSNP
rs1328624336 2762 dbSNP
rs1305091534 2764 dbSNP
rs1403742988 2764 dbSNP
rs1451652552 2764 dbSNP
rs35783804 2764 dbSNP
rs796183101 2764 dbSNP
rs62231099 2765 dbSNP
rs1057269995 2774 dbSNP
rs1238492838 2775 dbSNP
rs894693820 2776 dbSNP
rs1156480074 2777 dbSNP
rs1414073654 2777 dbSNP
rs186240600 2777 dbSNP
rs1280187284 2779 dbSNP
rs1353518453 2781 dbSNP
rs1250406250 2798 dbSNP
rs1460280492 2798 dbSNP
rs1044714609 2800 dbSNP
rs1218008373 2811 dbSNP
rs1280178583 2818 dbSNP
rs1349060663 2820 dbSNP
rs1213381750 2821 dbSNP
rs535676955 2823 dbSNP
rs1436843551 2827 dbSNP
rs1000564954 2833 dbSNP
rs1234150043 2834 dbSNP
rs1030740218 2838 dbSNP
rs956484424 2845 dbSNP
rs540150859 2856 dbSNP
rs1172952712 2860 dbSNP
rs1286543726 2860 dbSNP
rs1459009186 2864 dbSNP
rs1350064140 2873 dbSNP
rs1395541667 2874 dbSNP
rs1443134831 2875 dbSNP
rs1392468060 2876 dbSNP
rs566231058 2879 dbSNP
rs1436429506 2882 dbSNP
rs373776352 2888 dbSNP
rs1030175899 2889 dbSNP
rs953280145 2893 dbSNP
rs986468900 2900 dbSNP
rs1329743785 2903 dbSNP
rs1337631091 2908 dbSNP
rs909185924 2911 dbSNP
rs1220586580 2916 dbSNP
rs963695157 2935 dbSNP
rs1299636738 2938 dbSNP
rs972062377 2939 dbSNP
rs919338398 2940 dbSNP
rs368553193 2946 dbSNP
rs1237026069 2947 dbSNP
rs1272897114 2948 dbSNP
rs938778005 2951 dbSNP
rs1057190573 2965 dbSNP
rs372321206 2979 dbSNP
rs948969722 2980 dbSNP
rs1058030 2997 dbSNP
rs1461808908 3006 dbSNP
rs1274606400 3008 dbSNP
rs1043691229 3011 dbSNP
rs1449383734 3013 dbSNP
rs1192463423 3022 dbSNP
rs904799873 3031 dbSNP
rs1253606179 3032 dbSNP
rs1268345602 3033 dbSNP
rs1455514055 3036 dbSNP
rs374381586 3037 dbSNP
rs1196112221 3049 dbSNP
rs892184173 3050 dbSNP
rs1249516448 3052 dbSNP
rs1462256183 3054 dbSNP
rs1323605074 3055 dbSNP
rs1168724667 3056 dbSNP
rs997266954 3069 dbSNP
rs1030138996 3070 dbSNP
rs1058033 3071 dbSNP
rs1460001265 3080 dbSNP
rs574661600 3080 dbSNP
rs1325278526 3081 dbSNP
rs1007421498 3082 dbSNP
rs1443795328 3091 dbSNP
rs377398307 3091 dbSNP
rs1174805973 3092 dbSNP
rs572510118 3094 dbSNP
rs780726730 3095 dbSNP
rs963364163 3096 dbSNP
rs1174295637 3105 dbSNP
rs6007499 3107 dbSNP
rs1228530969 3117 dbSNP
rs1436997091 3119 dbSNP
rs1248218599 3120 dbSNP
rs553954872 3121 dbSNP
rs1271641830 3123 dbSNP
rs576928056 3130 dbSNP
rs1221099724 3131 dbSNP
rs146738389 3135 dbSNP
rs992885692 3137 dbSNP
rs745966009 3139 dbSNP
rs916029176 3142 dbSNP
rs1206762560 3143 dbSNP
rs1453855264 3150 dbSNP
rs1260886556 3151 dbSNP
rs1335360092 3158 dbSNP
rs1458864614 3159 dbSNP
rs1158200420 3171 dbSNP
rs1468855521 3171 dbSNP
rs562419387 3178 dbSNP
rs531253547 3182 dbSNP
rs1428899591 3183 dbSNP
rs1195052586 3185 dbSNP
rs948884259 3189 dbSNP
rs1242408918 3196 dbSNP
rs1375052182 3199 dbSNP
rs1474332174 3203 dbSNP
rs1164431549 3204 dbSNP
rs1058040 3205 dbSNP
rs1348028007 3206 dbSNP
rs1285619382 3211 dbSNP
rs557712477 3219 dbSNP
rs1382558539 3230 dbSNP
rs1313531743 3237 dbSNP
rs1437979533 3245 dbSNP
rs1287639610 3256 dbSNP
rs1317640954 3258 dbSNP
rs1058043 3268 dbSNP
rs527383861 3272 dbSNP
rs1052059684 3275 dbSNP
rs1384433487 3277 dbSNP
rs1181664353 3280 dbSNP
rs1451182880 3288 dbSNP
rs1320664268 3307 dbSNP
rs547151492 3307 dbSNP
rs1345477219 3308 dbSNP
rs770556430 3313 dbSNP
rs933026608 3314 dbSNP
rs1359161450 3316 dbSNP
rs776341583 3325 dbSNP
rs865786684 3331 dbSNP
rs1363195467 3337 dbSNP
rs62231100 3348 dbSNP
rs1336323739 3355 dbSNP
rs571042637 3357 dbSNP
rs1428671515 3359 dbSNP
rs191042137 3361 dbSNP
rs548632223 3362 dbSNP
rs226515 3363 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000347635.4 | 3UTR | CAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000347635.4 | 3UTR | CAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000347635.4 | 3UTR | GCAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000347635.4 | 3UTR | CAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000347635.4 | 3UTR | CUUCCUUUUUUCCUAACAUUCCCAGCAAAUUUUUGCUGCUAAGACUAUCACUGUUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000347635.4 | 3UTR | CAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000347635.4 | 3UTR | AACAUUCCCAGCAAAUUUUUGCUGCUAAGACUAUCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000347635.4 | 3UTR | CUUCCUUUUUUCCUAACAUUCCCAGCAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000347635.4 | 3UTR | CAAAUUUUUGCUGCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.724 1.5e-4 0.785 2.1e-5 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.5 6.4e-3 -0.326 6.0e-2 24 Click to see details
GSE32688 Pancreatic cancer 0.411 9.7e-3 0.202 1.3e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.338 5.7e-2 -0.325 6.5e-2 23 Click to see details
GSE21687 Ependynoma primary tumors -0.191 6.5e-2 -0.189 6.7e-2 64 Click to see details
GSE28544 Breast cancer -0.304 7.4e-2 -0.322 6.2e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.146 1.0e-1 -0.150 9.4e-2 79 Click to see details
GSE21032 Prostate cancer 0.107 1.7e-1 0.095 2.0e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.244 1.8e-1 0.332 1.0e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.24 2.3e-1 -0.350 1.3e-1 12 Click to see details
GSE19536 Breast cancer -0.072 2.4e-1 -0.095 1.7e-1 100 Click to see details
GSE38226 Liver fibrosis -0.162 2.4e-1 0.005 4.9e-1 21 Click to see details
GSE21849 B cell lymphoma -0.122 2.6e-1 -0.192 1.6e-1 29 Click to see details
GSE17498 Multiple myeloma 0.099 2.7e-1 -0.097 2.8e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.041 3.5e-1 -0.069 2.6e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.078 4.0e-1 -0.121 3.5e-1 13 Click to see details
GSE17306 Multiple myeloma 0.037 4.0e-1 -0.028 4.2e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.056 4.1e-1 -0.086 3.6e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.049 4.1e-1 0.000 5.0e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.002 5.0e-1 0.025 4.5e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.002 5.0e-1 0.025 4.5e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.694 0 0.701 0 32 Click to see details
BLCA 0.748 0 0.624 0 18 Click to see details
PRAD 0.301 0.02 0.284 0.02 50 Click to see details
KIRP -0.303 0.05 -0.262 0.07 32 Click to see details
LIHC -0.232 0.05 -0.291 0.02 49 Click to see details
PAAD 0.887 0.06 0.400 0.3 4 Click to see details
HNSC 0.213 0.09 0.284 0.03 42 Click to see details
KIRC 0.163 0.09 0.162 0.09 68 Click to see details
LUSC 0.22 0.09 0.254 0.06 38 Click to see details
CESC 0.946 0.11 1.000 0.5 3 Click to see details
PCPG 0.842 0.18 0.500 0.33 3 Click to see details
LUAD 0.287 0.18 0.112 0.36 12 Click to see details
ESCA -0.302 0.18 -0.427 0.1 11 Click to see details
KICH 0.099 0.32 0.154 0.23 25 Click to see details
BRCA -0.037 0.37 -0.052 0.32 84 Click to see details
UCEC -0.047 0.42 -0.046 0.43 19 Click to see details
CHOL -0.031 0.47 0.033 0.47 9 Click to see details
COAD 0.029 0.47 -0.262 0.27 8 Click to see details
THCA 0.004 0.49 -0.016 0.45 59 Click to see details
THCA 0.004 0.49 -0.016 0.45 59 Click to see details
THCA 0.004 0.49 -0.016 0.45 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487