miRTarBase - #MIRT204741 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BZW1   
Synonyms BZAP45, Nbla10236
Description basic leucine zipper and W2 domains 1
Transcript NM_014670   
Expression
Putative miRNA Targets on BZW1
3'UTR of BZW1
(miRNA target sites are highlighted)
>BZW1|NM_014670|3'UTR
   1 ATTTTGAAACTACACCCTCAGTAAAGCAAACAGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATC
  81 TTCCTACCTCCCTGTATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTGCTGGAAA
 161 TGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTCTTTT
 241 CAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTATTCC
 321 CTGGGTTTTCTATAAACAGTTTTAAGGATATGATTTGGTTAAAAAATAATTTGTTATAAAAATTCTGTTTGCAAATTAAA
 401 CTGGAAAAGTATCCAGAGTCTCAAAAGGCAATGATTTGTGAGATAATATGGCATGCCCGGAGCCCTGCTCATCAATGAAA
 481 AACCCATATGTAATAATCGAATTCATTTAACATGAATCTTGAGTACGTGGACCATTGCTTGCATGTTAACTTTTTGTTTT
 561 GTTTTGTTTTGTTTTGTTTTGCATTTTTAACTCCAGATATCCTAAAGCTCAATTGTTTGGTCTCTGGTTTTCATCCTTAG
 641 AGAAGCCATGGAGAACAGACTTGAAAAGTTTAGGAAATCATAATGTGGCAGAGGTGGTGGGAAGAAGAAAGTTGAGCTTT
 721 TTCCCCTTGAGAAACTTCTGCATTTAGTTTCTATCTTTCCAGGCAAAACAAATGGGTATTCTTTTCATACAACCATTTTC
 801 AAATGAACCTTAGAAAAGTCTTAACATTTAAGGTATTTTATGCACAGAATACACTTAGATTGATAGGAAAGAACTCGTAA
 881 TGGAGTTTGAGTAAAGAAAATGACTGATGTACTAAACCCAGTAAAAATTGTTGAAAATGTTAAAGGTCAGCATGTTCTAA
 961 TTGGGAATCTAGATATAGCTTAGATTTCCTATTGGCTTAGAGTATTTGCTATAACAAATGAAGTGCAATGACAATTATAT
1041 ATTCCTACTCGGTCATACTGGACTGGCTTCGTTCTCTTAATATACTCAGTAATGACTCAAGCCTCTGGCTATTAACATAC
1121 CCTAGTTGCCGTTTTTTAATTGCCATGAGCCAAATACTTCTTGGTATACAATTGATCCATTTATTTTAATGGCTGCCTTT
1201 TCATTTTCATCTTTTCTTGCTGCTACCCATCTATGTATGTAGTCATTGGGGGGAAAATGTAGCCACATTTTTTATGGGAA
1281 GACTTTGTGTTAAAAGTGAACATTTTGAAGGTTTTTAACTGGTGAAACTAGCCTGGAATAATGCCACCAGAGACTGAGTG
1361 GAAATCGCCCCTTTTGAAGGTGCCATTCTTATGAGCCAAAAGTTTGTCATTTAAAAGTTCATTTTGAGGGAATAACATGT
1441 AATATAATTTGAAATAAAGGTATAGTAACCTTAAAAAGAACATTATAACTGATTGTTGTGAATGGGGTGAATTTGTTAAA
1521 ATGAGTAACTTTGATAAAGTTTTTCATGCACAGGCAAAATGTATTCACTAGATTTCTACGTAGTGATCTGCTTTTACTTT
1601 GTAATTTGTAGTTCTCAAAAGACTTTTTTTTAAAAAAATAAAGTCCATACTTACACTTAGGCTTTATAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |:| ||   ||||||| 
Target 5' ttttcATCTTTTCTTGCTGCTa 3'
1204 - 1225 149.00 -10.70
2
miRNA  3' guguUUGGUA---AUAC--ACGACgau 5'
              |||::|   ||||  |||||   
Target 5' ttttAACTGTTTCTATGGTTGCTGgaa 3'
133 - 159 120.00 -10.30
3
miRNA  3' guGUUUGGUAAUACACG-ACGAu 5'
            :::||||||:  ||| ||:| 
Target 5' cgTGGACCATTGCTTGCATGTTa 3'
526 - 548 120.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30154169 14 COSMIC
COSN30447252 18 COSMIC
COSN31611618 62 COSMIC
COSN31520625 112 COSMIC
COSN31527075 264 COSMIC
COSN20958114 368 COSMIC
COSN31479454 652 COSMIC
COSN31490607 664 COSMIC
COSN31602929 726 COSMIC
COSN31479435 814 COSMIC
COSN31606499 825 COSMIC
COSN30142128 929 COSMIC
COSN20088142 1069 COSMIC
COSN30544763 1131 COSMIC
COSN17258481 1132 COSMIC
COSN21682634 1194 COSMIC
COSN26507589 1580 COSMIC
COSN16107099 1688 COSMIC
COSN27423049 1688 COSMIC
COSN5787394 1831 COSMIC
COSN6932477 1892 COSMIC
COSN4801095 2055 COSMIC
COSN6164135 2379 COSMIC
COSN16897448 2471 COSMIC
COSN18778578 2513 COSMIC
COSN1818727 3003 COSMIC
COSN31793030 3115 COSMIC
COSN18927958 3197 COSMIC
COSN1231701 3209 COSMIC
COSN19358208 3507 COSMIC
COSN6164136 3958 COSMIC
COSN1818728 3960 COSMIC
COSN1818729 3972 COSMIC
COSN17056652 4184 COSMIC
COSN27190335 4319 COSMIC
COSN6164137 4347 COSMIC
COSN1818730 4351 COSMIC
COSN15997270 4775 COSMIC
COSN27424024 4775 COSMIC
COSN9303958 4781 COSMIC
COSN20731991 4789 COSMIC
COSN9303959 4825 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1374338587 4 dbSNP
rs1242134567 7 dbSNP
rs535075677 14 dbSNP
rs1344234601 16 dbSNP
rs1217479754 21 dbSNP
rs1280855337 22 dbSNP
rs1461869506 26 dbSNP
rs1198216151 28 dbSNP
rs891515874 41 dbSNP
rs566974628 54 dbSNP
rs1427979110 60 dbSNP
rs1396951834 62 dbSNP
rs1011415758 78 dbSNP
rs1478318328 83 dbSNP
rs1246017228 85 dbSNP
rs1196510662 87 dbSNP
rs1439320626 89 dbSNP
rs1274961436 104 dbSNP
rs1368850578 107 dbSNP
rs1339534438 110 dbSNP
rs1021837767 115 dbSNP
rs1219261522 119 dbSNP
rs1367542250 127 dbSNP
rs371647667 127 dbSNP
rs1273557913 128 dbSNP
rs375138240 148 dbSNP
rs367742415 161 dbSNP
rs1331292002 165 dbSNP
rs113564918 167 dbSNP
rs1229300273 168 dbSNP
rs1408248054 177 dbSNP
rs1176923492 203 dbSNP
rs578097815 223 dbSNP
rs1424437313 229 dbSNP
rs1170712304 231 dbSNP
rs1450821524 233 dbSNP
rs1252261432 234 dbSNP
rs1030236115 236 dbSNP
rs1219035446 237 dbSNP
rs1238793354 240 dbSNP
rs1210264092 241 dbSNP
rs955377727 243 dbSNP
rs547139039 255 dbSNP
rs986770822 272 dbSNP
rs750659085 291 dbSNP
rs1488742755 301 dbSNP
rs1226899821 309 dbSNP
rs908637286 311 dbSNP
rs1447446151 315 dbSNP
rs1181321575 324 dbSNP
rs961417134 326 dbSNP
rs1249047211 327 dbSNP
rs1332184401 332 dbSNP
rs1458768588 333 dbSNP
rs1412565861 338 dbSNP
rs1473279152 341 dbSNP
rs1159531189 351 dbSNP
rs1416628203 352 dbSNP
rs1471473508 378 dbSNP
rs868388494 379 dbSNP
rs1182079904 384 dbSNP
rs1482675447 397 dbSNP
rs1235257033 416 dbSNP
rs1209984313 417 dbSNP
rs1465769809 423 dbSNP
rs1167290610 425 dbSNP
rs1351011280 432 dbSNP
rs1337371042 450 dbSNP
rs1442175548 451 dbSNP
rs1377182601 452 dbSNP
rs1306698759 457 dbSNP
rs1435837434 458 dbSNP
rs1352474839 459 dbSNP
rs1319768403 460 dbSNP
rs1410435526 463 dbSNP
rs1292917124 467 dbSNP
rs974184547 471 dbSNP
rs1411129758 476 dbSNP
rs1189965885 481 dbSNP
rs36047720 483 dbSNP
rs1449522287 487 dbSNP
rs1354446398 499 dbSNP
rs1226427038 500 dbSNP
rs920120011 513 dbSNP
rs1221216114 519 dbSNP
rs948900460 527 dbSNP
rs1254715328 552 dbSNP
rs1296858196 552 dbSNP
rs1432825918 552 dbSNP
rs540532271 552 dbSNP
rs1291810684 557 dbSNP
rs1322078347 571 dbSNP
rs1293926802 572 dbSNP
rs1204420041 582 dbSNP
rs1457175876 583 dbSNP
rs1045064616 590 dbSNP
rs1429913169 596 dbSNP
rs1389000895 605 dbSNP
rs928866434 613 dbSNP
rs1272383484 623 dbSNP
rs1268603801 626 dbSNP
rs1483753398 628 dbSNP
rs938362821 634 dbSNP
rs1182198527 637 dbSNP
rs1277110292 642 dbSNP
rs1206136180 655 dbSNP
rs1236560119 659 dbSNP
rs1052685406 660 dbSNP
rs891548634 672 dbSNP
rs1011780590 679 dbSNP
rs557343854 682 dbSNP
rs1343396258 693 dbSNP
rs1309540098 695 dbSNP
rs1042800173 697 dbSNP
rs1369490872 701 dbSNP
rs1166194470 702 dbSNP
rs1190579675 718 dbSNP
rs1415043358 718 dbSNP
rs1409740945 725 dbSNP
rs1378772117 727 dbSNP
rs900356897 730 dbSNP
rs996000991 731 dbSNP
rs1167264879 739 dbSNP
rs1030267563 747 dbSNP
rs1372881778 754 dbSNP
rs1482865517 756 dbSNP
rs1430507057 759 dbSNP
rs182040538 762 dbSNP
rs954577585 765 dbSNP
rs1338743261 769 dbSNP
rs34649998 772 dbSNP
rs1450521134 774 dbSNP
rs1256575654 791 dbSNP
rs1232432709 792 dbSNP
rs543003114 793 dbSNP
rs1289993935 797 dbSNP
rs1228724596 808 dbSNP
rs1349524366 810 dbSNP
rs1326424767 817 dbSNP
rs1397331319 820 dbSNP
rs1402293090 821 dbSNP
rs1301685173 828 dbSNP
rs1464997855 840 dbSNP
rs1379705175 855 dbSNP
rs1227310509 857 dbSNP
rs1295334147 858 dbSNP
rs1015645024 864 dbSNP
rs561372909 865 dbSNP
rs1344166908 877 dbSNP
rs1443142135 878 dbSNP
rs1205296102 903 dbSNP
rs974590003 908 dbSNP
rs1440178524 910 dbSNP
rs1211877945 912 dbSNP
rs1198741524 924 dbSNP
rs1459940304 928 dbSNP
rs1269892687 940 dbSNP
rs1027050874 946 dbSNP
rs970648087 949 dbSNP
rs980209436 954 dbSNP
rs1340644324 959 dbSNP
rs928897268 960 dbSNP
rs1391519509 966 dbSNP
rs1449253148 968 dbSNP
rs1321782380 971 dbSNP
rs1383253112 972 dbSNP
rs1165294628 976 dbSNP
rs938896740 977 dbSNP
rs1185546656 978 dbSNP
rs1451371787 988 dbSNP
rs1392598677 992 dbSNP
rs528644496 1012 dbSNP
rs989019694 1022 dbSNP
rs1400230520 1027 dbSNP
rs912934130 1029 dbSNP
rs1264463516 1035 dbSNP
rs1335109826 1037 dbSNP
rs947055094 1039 dbSNP
rs1299078748 1040 dbSNP
rs1435016534 1042 dbSNP
rs1325137682 1051 dbSNP
rs1043217811 1052 dbSNP
rs1406276573 1056 dbSNP
rs1434122915 1058 dbSNP
rs1390333824 1060 dbSNP
rs565417904 1071 dbSNP
rs1390873615 1072 dbSNP
rs1167979465 1078 dbSNP
rs1448817582 1081 dbSNP
rs879169509 1082 dbSNP
rs186634977 1083 dbSNP
rs1229076445 1090 dbSNP
rs931816697 1099 dbSNP
rs532952992 1107 dbSNP
rs1219791080 1112 dbSNP
rs890293171 1113 dbSNP
rs1220443739 1116 dbSNP
rs1004839184 1118 dbSNP
rs1278958746 1125 dbSNP
rs140367396 1131 dbSNP
rs1206395873 1132 dbSNP
rs1437686121 1138 dbSNP
rs1330883449 1139 dbSNP
rs1014833815 1148 dbSNP
rs13032481 1150 dbSNP
rs1411915814 1153 dbSNP
rs1371349269 1154 dbSNP
rs1168073877 1157 dbSNP
rs1250316938 1161 dbSNP
rs897168943 1165 dbSNP
rs1174234369 1171 dbSNP
rs995494344 1172 dbSNP
rs1198782675 1175 dbSNP
rs1376425489 1178 dbSNP
rs11550642 1180 dbSNP
rs1479081044 1183 dbSNP
rs551666055 1193 dbSNP
rs1411553959 1195 dbSNP
rs1203860008 1207 dbSNP
rs1455869431 1210 dbSNP
rs1281436857 1212 dbSNP
rs1220324984 1217 dbSNP
rs1322748383 1224 dbSNP
rs1027495642 1226 dbSNP
rs1351381256 1230 dbSNP
rs1390574604 1232 dbSNP
rs1307629692 1238 dbSNP
rs1440187885 1241 dbSNP
rs1360960650 1244 dbSNP
rs569809160 1247 dbSNP
rs1174029503 1257 dbSNP
rs1473431199 1263 dbSNP
rs1412314217 1264 dbSNP
rs970132144 1268 dbSNP
rs1468228094 1274 dbSNP
rs530425715 1276 dbSNP
rs980240717 1279 dbSNP
rs1461290510 1281 dbSNP
rs1261783118 1282 dbSNP
rs1438042287 1292 dbSNP
rs1346635669 1299 dbSNP
rs1288037213 1305 dbSNP
rs1222285537 1307 dbSNP
rs1381542110 1313 dbSNP
rs1327813842 1317 dbSNP
rs1035858166 1318 dbSNP
rs960189723 1332 dbSNP
rs1462214460 1333 dbSNP
rs1334576867 1334 dbSNP
rs1458667156 1359 dbSNP
rs1226206662 1361 dbSNP
rs552513765 1364 dbSNP
rs989046013 1367 dbSNP
rs913460820 1368 dbSNP
rs947055458 1369 dbSNP
rs1328314060 1384 dbSNP
rs1443458769 1384 dbSNP
rs1241895509 1385 dbSNP
rs1191051768 1386 dbSNP
rs548614178 1389 dbSNP
rs1260518222 1391 dbSNP
rs145445048 1393 dbSNP
rs1290818909 1403 dbSNP
rs1227859494 1409 dbSNP
rs921681179 1414 dbSNP
rs931791578 1422 dbSNP
rs1051504534 1423 dbSNP
rs56192577 1424 dbSNP
rs1428351900 1437 dbSNP
rs534445347 1438 dbSNP
rs1251198911 1450 dbSNP
rs890324534 1456 dbSNP
rs940484589 1460 dbSNP
rs552770304 1461 dbSNP
rs1036296591 1464 dbSNP
rs1471616056 1465 dbSNP
rs899051525 1468 dbSNP
rs1247566339 1471 dbSNP
rs1489656779 1471 dbSNP
rs1222013696 1473 dbSNP
rs1357465306 1474 dbSNP
rs1229184505 1477 dbSNP
rs1161652024 1480 dbSNP
rs1308050672 1485 dbSNP
rs1294746451 1486 dbSNP
rs1380374855 1490 dbSNP
rs1412963837 1492 dbSNP
rs1454167145 1493 dbSNP
rs1369461094 1496 dbSNP
rs1293831954 1499 dbSNP
rs571833965 1506 dbSNP
rs1403966562 1516 dbSNP
rs1363276332 1523 dbSNP
rs1309350721 1528 dbSNP
rs1429789067 1530 dbSNP
rs1373055350 1532 dbSNP
rs1168931692 1534 dbSNP
rs1199092908 1536 dbSNP
rs1426313421 1536 dbSNP
rs1435345087 1536 dbSNP
rs1162404241 1542 dbSNP
rs1388264289 1546 dbSNP
rs995919562 1547 dbSNP
rs1480342157 1550 dbSNP
rs1303630975 1551 dbSNP
rs1250757589 1564 dbSNP
rs1225160829 1573 dbSNP
rs1349343025 1580 dbSNP
rs1026946475 1581 dbSNP
rs1343297520 1584 dbSNP
rs1348538984 1584 dbSNP
rs1289807995 1593 dbSNP
rs905855737 1599 dbSNP
rs1395132194 1605 dbSNP
rs1289895026 1611 dbSNP
rs1295876985 1612 dbSNP
rs1001606875 1614 dbSNP
rs1360212909 1617 dbSNP
rs1350703284 1622 dbSNP
rs1176214368 1624 dbSNP
rs1244565956 1624 dbSNP
rs1479650896 1624 dbSNP
rs1183157138 1625 dbSNP
rs1035724160 1632 dbSNP
rs538823656 1633 dbSNP
rs1202197923 1636 dbSNP
rs1010332327 1649 dbSNP
rs1263647439 1653 dbSNP
rs1202850673 1656 dbSNP
rs1210969653 1657 dbSNP
rs1321129571 1663 dbSNP
rs1289899638 1664 dbSNP
rs963148737 1671 dbSNP
rs1020964646 1673 dbSNP
rs1239319968 1673 dbSNP
rs557645844 1674 dbSNP
rs1397240042 1675 dbSNP
rs1361963128 1677 dbSNP
rs879908217 1677 dbSNP
rs968957395 1677 dbSNP
rs1184415683 1678 dbSNP
rs1391294366 1684 dbSNP
rs575962973 1688 dbSNP
rs536944615 1689 dbSNP
rs1185632039 1690 dbSNP
rs1366513275 1691 dbSNP
rs1459191113 1694 dbSNP
rs1362234615 1703 dbSNP
rs1189752739 1707 dbSNP
rs557637346 1715 dbSNP
rs137957921 1719 dbSNP
rs1182903517 1721 dbSNP
rs573261427 1724 dbSNP
rs949717762 1734 dbSNP
rs987245763 1740 dbSNP
rs1205450737 1743 dbSNP
rs1349559559 1747 dbSNP
rs911622993 1748 dbSNP
rs1246428154 1754 dbSNP
rs376630609 1756 dbSNP
rs1036165575 1763 dbSNP
rs1313653279 1763 dbSNP
rs1367913186 1764 dbSNP
rs1319424616 1777 dbSNP
rs1309282558 1781 dbSNP
rs1383137162 1783 dbSNP
rs1396539460 1785 dbSNP
rs920511142 1801 dbSNP
rs1384686247 1812 dbSNP
rs1161684658 1815 dbSNP
rs977518237 1821 dbSNP
rs1442723589 1822 dbSNP
rs1193697146 1824 dbSNP
rs1395112658 1825 dbSNP
rs1446205781 1826 dbSNP
rs930617705 1831 dbSNP
rs924364792 1837 dbSNP
rs935790113 1840 dbSNP
rs1045379020 1842 dbSNP
rs1054542716 1851 dbSNP
rs899978769 1856 dbSNP
rs1243085578 1861 dbSNP
rs932825695 1866 dbSNP
rs1051332193 1868 dbSNP
rs1001467473 1878 dbSNP
rs1207874817 1885 dbSNP
rs540751501 1892 dbSNP
rs1004204988 1900 dbSNP
rs1482936174 1901 dbSNP
rs1198954080 1902 dbSNP
rs1258529796 1905 dbSNP
rs565198422 1906 dbSNP
rs1301403550 1909 dbSNP
rs1431686221 1910 dbSNP
rs1421639066 1912 dbSNP
rs577775198 1915 dbSNP
rs1475006758 1918 dbSNP
rs544828504 1923 dbSNP
rs577237868 1924 dbSNP
rs548299065 1925 dbSNP
rs898579099 1929 dbSNP
rs1267693833 1930 dbSNP
rs995625771 1930 dbSNP
rs1219677415 1939 dbSNP
rs563137976 1940 dbSNP
rs958503422 1941 dbSNP
rs1274405077 1954 dbSNP
rs1195735312 1955 dbSNP
rs1337950361 1964 dbSNP
rs1276992824 1970 dbSNP
rs1170356616 1973 dbSNP
rs1354625056 1975 dbSNP
rs1345171564 1978 dbSNP
rs1465048106 1986 dbSNP
rs1300781812 1987 dbSNP
rs1411820918 1987 dbSNP
rs1012768857 1988 dbSNP
rs1409326891 1992 dbSNP
rs368407431 1995 dbSNP
rs1403881619 2001 dbSNP
rs1394201387 2006 dbSNP
rs76641878 2008 dbSNP
rs1480626838 2011 dbSNP
rs1320346264 2015 dbSNP
rs548849739 2015 dbSNP
rs1363412470 2026 dbSNP
rs1428234252 2033 dbSNP
rs1231276513 2034 dbSNP
rs1196830574 2038 dbSNP
rs115856102 2040 dbSNP
rs1311749465 2041 dbSNP
rs1231144948 2042 dbSNP
rs911653968 2046 dbSNP
rs528047479 2055 dbSNP
rs957045251 2056 dbSNP
rs747143457 2057 dbSNP
rs920474569 2070 dbSNP
rs1247206276 2072 dbSNP
rs989821163 2079 dbSNP
rs1323272976 2083 dbSNP
rs765866684 2087 dbSNP
rs930460281 2088 dbSNP
rs1374266967 2096 dbSNP
rs1279070040 2097 dbSNP
rs1190434953 2098 dbSNP
rs1333956859 2103 dbSNP
rs1338608426 2105 dbSNP
rs1470186001 2115 dbSNP
rs1405089234 2124 dbSNP
rs1173910716 2131 dbSNP
rs932796007 2135 dbSNP
rs1408209395 2137 dbSNP
rs1176162917 2143 dbSNP
rs1432148003 2147 dbSNP
rs188686665 2148 dbSNP
rs1051731227 2151 dbSNP
rs937349953 2152 dbSNP
rs1461218370 2156 dbSNP
rs1241709217 2160 dbSNP
rs1378825477 2161 dbSNP
rs751466449 2162 dbSNP
rs1222192986 2172 dbSNP
rs536905690 2173 dbSNP
rs1315737396 2184 dbSNP
rs1453304845 2184 dbSNP
rs1386917613 2193 dbSNP
rs1037028464 2197 dbSNP
rs1381882677 2200 dbSNP
rs376029277 2207 dbSNP
rs898458872 2209 dbSNP
rs1367489804 2212 dbSNP
rs1432596536 2217 dbSNP
rs1345467446 2219 dbSNP
rs539226998 2227 dbSNP
rs1398529471 2228 dbSNP
rs1055184885 2234 dbSNP
rs755316519 2234 dbSNP
rs904711537 2236 dbSNP
rs555689425 2237 dbSNP
rs1324310574 2242 dbSNP
rs1188711201 2246 dbSNP
rs1486389106 2256 dbSNP
rs1000745490 2258 dbSNP
rs895261634 2263 dbSNP
rs1266396453 2267 dbSNP
rs1326888825 2271 dbSNP
rs550942624 2275 dbSNP
rs1245284024 2282 dbSNP
rs77228155 2285 dbSNP
rs1018662494 2287 dbSNP
rs961699631 2288 dbSNP
rs1242679908 2296 dbSNP
rs1024596218 2297 dbSNP
rs1367009035 2298 dbSNP
rs1303274778 2299 dbSNP
rs971329935 2303 dbSNP
rs951925974 2306 dbSNP
rs1429557283 2308 dbSNP
rs1419266300 2313 dbSNP
rs746067287 2315 dbSNP
rs999142523 2316 dbSNP
rs1031591420 2333 dbSNP
rs1268861866 2334 dbSNP
rs1221902076 2337 dbSNP
rs957014139 2338 dbSNP
rs201091182 2340 dbSNP
rs1158050246 2341 dbSNP
rs1206557640 2342 dbSNP
rs1307959743 2343 dbSNP
rs528441830 2343 dbSNP
rs917275037 2343 dbSNP
rs992028259 2343 dbSNP
rs76112445 2344 dbSNP
rs1363172568 2348 dbSNP
rs1299325827 2349 dbSNP
rs1041821623 2352 dbSNP
rs573287723 2354 dbSNP
rs533898356 2355 dbSNP
rs1349620975 2358 dbSNP
rs1456859582 2360 dbSNP
rs1198974205 2376 dbSNP
rs1479547025 2377 dbSNP
rs559011222 2381 dbSNP
rs986985573 2391 dbSNP
rs1177811675 2392 dbSNP
rs770011225 2394 dbSNP
rs577312741 2395 dbSNP
rs1250672591 2396 dbSNP
rs1196592774 2398 dbSNP
rs1325421808 2404 dbSNP
rs1286751290 2407 dbSNP
rs940212807 2408 dbSNP
rs1486844850 2416 dbSNP
rs1191578590 2417 dbSNP
rs1222536419 2418 dbSNP
rs1328943291 2425 dbSNP
rs1308549181 2430 dbSNP
rs867410332 2431 dbSNP
rs1373310076 2440 dbSNP
rs889286730 2446 dbSNP
rs1009188768 2447 dbSNP
rs1407317480 2460 dbSNP
rs1225291818 2469 dbSNP
rs1468463412 2471 dbSNP
rs920187436 2472 dbSNP
rs1418567031 2473 dbSNP
rs1249815973 2474 dbSNP
rs185466541 2475 dbSNP
rs897519165 2476 dbSNP
rs1243548552 2478 dbSNP
rs1293856539 2479 dbSNP
rs1490387551 2480 dbSNP
rs1180800114 2482 dbSNP
rs1262624706 2495 dbSNP
rs1336530964 2495 dbSNP
rs1455077464 2495 dbSNP
rs563435041 2495 dbSNP
rs1249217148 2496 dbSNP
rs993547605 2502 dbSNP
rs76016066 2512 dbSNP
rs1289665683 2513 dbSNP
rs1262218096 2514 dbSNP
rs1413541182 2516 dbSNP
rs574932600 2518 dbSNP
rs1167608085 2519 dbSNP
rs1053401398 2521 dbSNP
rs1366716151 2526 dbSNP
rs1429242745 2527 dbSNP
rs1306222944 2528 dbSNP
rs1372435499 2529 dbSNP
rs1205357249 2530 dbSNP
rs1443226268 2535 dbSNP
rs1283299315 2536 dbSNP
rs1283753394 2536 dbSNP
rs1378259875 2539 dbSNP
rs1360853851 2546 dbSNP
rs1314954116 2556 dbSNP
rs1243162071 2557 dbSNP
rs1226387321 2558 dbSNP
rs1317138947 2562 dbSNP
rs13016917 2563 dbSNP
rs1204303524 2564 dbSNP
rs9677143 2568 dbSNP
rs11895100 2574 dbSNP
rs10178887 2577 dbSNP
rs866351739 2580 dbSNP
rs1482512593 2581 dbSNP
rs1471730321 2583 dbSNP
rs189826566 2587 dbSNP
rs895226907 2588 dbSNP
rs564895167 2595 dbSNP
rs1224152056 2596 dbSNP
rs1167202119 2601 dbSNP
rs1290319442 2602 dbSNP
rs977794520 2612 dbSNP
rs774048521 2614 dbSNP
rs375504045 2619 dbSNP
rs1333829519 2620 dbSNP
rs998719558 2624 dbSNP
rs1344970969 2629 dbSNP
rs1321605535 2630 dbSNP
rs1357621972 2637 dbSNP
rs1445596249 2639 dbSNP
rs1031523087 2640 dbSNP
rs763781920 2643 dbSNP
rs183997345 2644 dbSNP
rs771921766 2646 dbSNP
rs1480528916 2648 dbSNP
rs1295227667 2649 dbSNP
rs1196076909 2650 dbSNP
rs1027984861 2651 dbSNP
rs1274292675 2654 dbSNP
rs1214631406 2655 dbSNP
rs569503654 2656 dbSNP
rs1440306678 2657 dbSNP
rs1345077100 2661 dbSNP
rs11890126 2662 dbSNP
rs1444437110 2671 dbSNP
rs748558890 2671 dbSNP
rs1019377370 2674 dbSNP
rs1464679446 2676 dbSNP
rs961813937 2681 dbSNP
rs1397867537 2682 dbSNP
rs1187304026 2685 dbSNP
rs972953987 2687 dbSNP
rs1423987766 2689 dbSNP
rs920156547 2694 dbSNP
rs548905126 2696 dbSNP
rs1475811907 2697 dbSNP
rs1178574370 2703 dbSNP
rs990809496 2704 dbSNP
rs866466606 2705 dbSNP
rs1204679874 2710 dbSNP
rs1323160221 2714 dbSNP
rs1423102318 2717 dbSNP
rs916549259 2718 dbSNP
rs1276752713 2719 dbSNP
rs1225605270 2724 dbSNP
rs944833384 2726 dbSNP
rs1351506016 2727 dbSNP
rs567119756 2728 dbSNP
rs898037389 2730 dbSNP
rs1471091949 2736 dbSNP
rs1040556857 2738 dbSNP
rs1374524937 2739 dbSNP
rs1046895715 2741 dbSNP
rs369870817 2742 dbSNP
rs550724634 2752 dbSNP
rs1402015122 2753 dbSNP
rs1408087081 2755 dbSNP
rs1157475977 2760 dbSNP
rs887441766 2761 dbSNP
rs1001937039 2766 dbSNP
rs1406548658 2767 dbSNP
rs570748552 2770 dbSNP
rs773173948 2770 dbSNP
rs960544976 2771 dbSNP
rs1013341007 2775 dbSNP
rs570808082 2782 dbSNP
rs1218235072 2783 dbSNP
rs1052910259 2784 dbSNP
rs1285442843 2785 dbSNP
rs537981888 2786 dbSNP
rs893053018 2787 dbSNP
rs1011483511 2791 dbSNP
rs1378177538 2796 dbSNP
rs556211603 2797 dbSNP
rs925982856 2798 dbSNP
rs957382229 2798 dbSNP
rs1297098639 2804 dbSNP
rs1368080113 2807 dbSNP
rs889411876 2808 dbSNP
rs1164778037 2813 dbSNP
rs1423686743 2814 dbSNP
rs986239564 2814 dbSNP
rs1207196900 2815 dbSNP
rs1007906368 2820 dbSNP
rs1019768720 2824 dbSNP
rs1287005302 2829 dbSNP
rs961176398 2835 dbSNP
rs972893762 2836 dbSNP
rs919431126 2840 dbSNP
rs12995928 2842 dbSNP
rs1362296170 2843 dbSNP
rs1277175347 2844 dbSNP
rs1397676486 2845 dbSNP
rs187291628 2846 dbSNP
rs887462513 2850 dbSNP
rs1457871749 2852 dbSNP
rs1348619402 2854 dbSNP
rs1001799825 2859 dbSNP
rs746060239 2860 dbSNP
rs554447636 2861 dbSNP
rs916853894 2871 dbSNP
rs564476329 2879 dbSNP
rs775578610 2880 dbSNP
rs896203805 2881 dbSNP
rs532043309 2886 dbSNP
rs1013377066 2888 dbSNP
rs1269723444 2888 dbSNP
rs1488138937 2888 dbSNP
rs1244898907 2890 dbSNP
rs1206447296 2896 dbSNP
rs1021249193 2902 dbSNP
rs1156557520 2907 dbSNP
rs1216440657 2910 dbSNP
rs966563867 2915 dbSNP
rs1301414644 2916 dbSNP
rs1385715228 2918 dbSNP
rs1443476436 2919 dbSNP
rs540514098 2919 dbSNP
rs12995960 2927 dbSNP
rs1168917018 2932 dbSNP
rs562043352 2944 dbSNP
rs1430207892 2950 dbSNP
rs914373595 2954 dbSNP
rs1175525223 2955 dbSNP
rs1284763525 2956 dbSNP
rs762241306 2956 dbSNP
rs1283587318 2957 dbSNP
rs1318627864 2958 dbSNP
rs1178894515 2960 dbSNP
rs191879284 2961 dbSNP
rs1049602705 2962 dbSNP
rs372396403 2968 dbSNP
rs1226147905 2970 dbSNP
rs1196498364 2973 dbSNP
rs1462418018 2976 dbSNP
rs1262890940 2981 dbSNP
rs562525523 2990 dbSNP
rs530318315 2991 dbSNP
rs1209772421 2993 dbSNP
rs1288343266 2996 dbSNP
rs1308440768 2996 dbSNP
rs1376758220 2997 dbSNP
rs548845913 2998 dbSNP
rs1454894743 3000 dbSNP
rs1407202136 3001 dbSNP
rs976156267 3005 dbSNP
rs765600493 3007 dbSNP
rs1365629851 3009 dbSNP
rs567043824 3014 dbSNP
rs1159875805 3019 dbSNP
rs1223289001 3021 dbSNP
rs889737769 3032 dbSNP
rs1008289458 3033 dbSNP
rs1471749278 3041 dbSNP
rs929470668 3043 dbSNP
rs1256508062 3044 dbSNP
rs1184187515 3047 dbSNP
rs1482041179 3068 dbSNP
rs528009037 3070 dbSNP
rs1049795709 3082 dbSNP
rs772764881 3083 dbSNP
rs534571835 3085 dbSNP
rs1307704961 3089 dbSNP
rs865891393 3098 dbSNP
rs1248723454 3100 dbSNP
rs367744826 3102 dbSNP
rs909434943 3102 dbSNP
rs937685189 3103 dbSNP
rs1426055356 3105 dbSNP
rs1303266049 3106 dbSNP
rs1054681084 3107 dbSNP
rs1369349727 3112 dbSNP
rs144556266 3113 dbSNP
rs35496447 3113 dbSNP
rs750361165 3113 dbSNP
rs1419161953 3114 dbSNP
rs1308614824 3115 dbSNP
rs993881534 3116 dbSNP
rs1244497752 3117 dbSNP
rs1026736048 3123 dbSNP
rs552812553 3124 dbSNP
rs570778297 3128 dbSNP
rs896156137 3129 dbSNP
rs949174036 3136 dbSNP
rs1193825724 3141 dbSNP
rs1487678909 3142 dbSNP
rs1042128236 3144 dbSNP
rs375864822 3146 dbSNP
rs902369649 3160 dbSNP
rs1247295560 3161 dbSNP
rs1012435162 3172 dbSNP
rs1243045826 3180 dbSNP
rs1279078523 3182 dbSNP
rs200664261 3182 dbSNP
rs537812857 3189 dbSNP
rs971029467 3190 dbSNP
rs111289319 3194 dbSNP
rs12996585 3195 dbSNP
rs1391323068 3198 dbSNP
rs1162483212 3203 dbSNP
rs1456186435 3203 dbSNP
rs1006808843 3206 dbSNP
rs1251502787 3207 dbSNP
rs1017652016 3215 dbSNP
rs887805046 3221 dbSNP
rs762611624 3231 dbSNP
rs1383111024 3235 dbSNP
rs1267261915 3239 dbSNP
rs35058325 3241 dbSNP
rs1208500254 3256 dbSNP
rs956713716 3266 dbSNP
rs150916924 3267 dbSNP
rs1259037138 3280 dbSNP
rs1164070805 3288 dbSNP
rs140179584 3289 dbSNP
rs1316248469 3290 dbSNP
rs1248700763 3292 dbSNP
rs554384569 3294 dbSNP
rs950960241 3295 dbSNP
rs1190251188 3309 dbSNP
rs1322805393 3313 dbSNP
rs1384949214 3314 dbSNP
rs947208393 3314 dbSNP
rs149578509 3320 dbSNP
rs572980476 3321 dbSNP
rs1049571711 3327 dbSNP
rs984940736 3329 dbSNP
rs1335175304 3331 dbSNP
rs565457146 3332 dbSNP
rs765812441 3333 dbSNP
rs1376513453 3338 dbSNP
rs909455334 3345 dbSNP
rs1247360431 3348 dbSNP
rs1440007654 3350 dbSNP
rs112382395 3351 dbSNP
rs1305899869 3352 dbSNP
rs1456645903 3353 dbSNP
rs1265216545 3354 dbSNP
rs1219956715 3355 dbSNP
rs1344404933 3356 dbSNP
rs1229679088 3359 dbSNP
rs991026349 3360 dbSNP
rs558790312 3367 dbSNP
rs896776904 3370 dbSNP
rs1344623644 3371 dbSNP
rs1198897177 3376 dbSNP
rs1241056300 3379 dbSNP
rs1397760939 3381 dbSNP
rs949039369 3388 dbSNP
rs574556769 3400 dbSNP
rs1400894859 3401 dbSNP
rs1184207721 3405 dbSNP
rs1048145820 3410 dbSNP
rs1170249630 3411 dbSNP
rs902231974 3414 dbSNP
rs1178472181 3422 dbSNP
rs936509874 3423 dbSNP
rs1053664361 3433 dbSNP
rs888226763 3438 dbSNP
rs539112630 3442 dbSNP
rs1442019610 3451 dbSNP
rs1178122857 3454 dbSNP
rs1206953441 3454 dbSNP
rs1373111501 3454 dbSNP
rs1465251187 3455 dbSNP
rs1355842361 3456 dbSNP
rs1309884658 3467 dbSNP
rs147293081 3474 dbSNP
rs1285683012 3486 dbSNP
rs1410673156 3498 dbSNP
rs971381372 3507 dbSNP
rs1331682558 3510 dbSNP
rs1453828424 3515 dbSNP
rs1361811860 3517 dbSNP
rs1320534278 3521 dbSNP
rs1418346856 3522 dbSNP
rs1416452573 3526 dbSNP
rs562461947 3528 dbSNP
rs1360457447 3536 dbSNP
rs1384384368 3540 dbSNP
rs1296412290 3546 dbSNP
rs764549341 3557 dbSNP
rs1472621595 3561 dbSNP
rs1235936006 3563 dbSNP
rs1330535755 3570 dbSNP
rs997496266 3576 dbSNP
rs1488663010 3577 dbSNP
rs551560160 3578 dbSNP
rs1221917628 3581 dbSNP
rs1285331060 3583 dbSNP
rs182059526 3584 dbSNP
rs1351358985 3596 dbSNP
rs1291808587 3598 dbSNP
rs1228649164 3600 dbSNP
rs757469453 3606 dbSNP
rs16834789 3615 dbSNP
rs1016423537 3619 dbSNP
rs183701672 3623 dbSNP
rs1296996711 3628 dbSNP
rs991057298 3642 dbSNP
rs1484870846 3643 dbSNP
rs1022316172 3645 dbSNP
rs527858159 3647 dbSNP
rs949087020 3653 dbSNP
rs985687294 3659 dbSNP
rs977751474 3662 dbSNP
rs552611101 3670 dbSNP
rs1196920497 3671 dbSNP
rs1430949777 3675 dbSNP
rs911024131 3680 dbSNP
rs1484879129 3686 dbSNP
rs80007393 3686 dbSNP
rs1158938113 3695 dbSNP
rs936468005 3699 dbSNP
rs976672432 3701 dbSNP
rs1320892920 3702 dbSNP
rs1270975517 3709 dbSNP
rs1220112849 3723 dbSNP
rs1343758264 3736 dbSNP
rs1318130528 3739 dbSNP
rs1277074924 3743 dbSNP
rs1216242487 3747 dbSNP
rs1455818267 3750 dbSNP
rs918519810 3753 dbSNP
rs1053933044 3754 dbSNP
rs577155456 3755 dbSNP
rs1436320565 3764 dbSNP
rs755932862 3765 dbSNP
rs376692146 3776 dbSNP
rs911080993 3781 dbSNP
rs1333736089 3785 dbSNP
rs942486277 3787 dbSNP
rs1048114974 3790 dbSNP
rs796355057 3799 dbSNP
rs1168688761 3801 dbSNP
rs1346353087 3808 dbSNP
rs1191715030 3810 dbSNP
rs377566286 3816 dbSNP
rs187243574 3818 dbSNP
rs1306051644 3824 dbSNP
rs1457981702 3827 dbSNP
rs568106193 3828 dbSNP
rs1224701488 3836 dbSNP
rs536345622 3836 dbSNP
rs886433558 3841 dbSNP
rs1006337687 3850 dbSNP
rs1219187076 3851 dbSNP
rs1016285759 3852 dbSNP
rs1311988724 3853 dbSNP
rs781433790 3863 dbSNP
rs386654189 3868 dbSNP
rs112419884 3869 dbSNP
rs113514573 3870 dbSNP
rs1359839471 3872 dbSNP
rs1031225389 3873 dbSNP
rs1175400364 3875 dbSNP
rs555726401 3882 dbSNP
rs145509045 3888 dbSNP
rs1010857528 3891 dbSNP
rs1440079474 3891 dbSNP
rs558575417 3898 dbSNP
rs953385142 3904 dbSNP
rs746089979 3907 dbSNP
rs1256120687 3921 dbSNP
rs758575854 3931 dbSNP
rs190273169 3934 dbSNP
rs1288780877 3940 dbSNP
rs1241427104 3941 dbSNP
rs1376647776 3942 dbSNP
rs1305246883 3943 dbSNP
rs182519248 3952 dbSNP
rs1380132885 3963 dbSNP
rs1040858429 3964 dbSNP
rs1422864319 3965 dbSNP
rs1305064116 3966 dbSNP
rs186755663 3967 dbSNP
rs1409453419 3968 dbSNP
rs1296595919 3971 dbSNP
rs1420174848 3972 dbSNP
rs1379486043 3973 dbSNP
rs1359286797 3974 dbSNP
rs1370991177 3975 dbSNP
rs929945439 3975 dbSNP
rs929917931 3977 dbSNP
rs192666797 3991 dbSNP
rs1180846914 3992 dbSNP
rs1047412062 3995 dbSNP
rs909517014 3997 dbSNP
rs1287470448 4001 dbSNP
rs947716442 4002 dbSNP
rs1353566283 4007 dbSNP
rs535865388 4008 dbSNP
rs1259378681 4010 dbSNP
rs1247424878 4011 dbSNP
rs1225243934 4020 dbSNP
rs1312283021 4021 dbSNP
rs1044798077 4026 dbSNP
rs906289031 4032 dbSNP
rs747067615 4033 dbSNP
rs1400574941 4036 dbSNP
rs1243620944 4039 dbSNP
rs1384141625 4041 dbSNP
rs541966734 4042 dbSNP
rs1459247633 4044 dbSNP
rs895202058 4044 dbSNP
rs756318781 4050 dbSNP
rs1230806214 4051 dbSNP
rs560157735 4052 dbSNP
rs1178107341 4061 dbSNP
rs769330720 4062 dbSNP
rs1022505502 4063 dbSNP
rs889091689 4065 dbSNP
rs1260255112 4067 dbSNP
rs1212082824 4069 dbSNP
rs572561325 4074 dbSNP
rs1019015206 4077 dbSNP
rs1231715438 4088 dbSNP
rs771659508 4093 dbSNP
rs17467616 4094 dbSNP
rs1429177703 4103 dbSNP
rs1327168698 4105 dbSNP
rs1325856832 4106 dbSNP
rs528356025 4106 dbSNP
rs1018036648 4123 dbSNP
rs1443158166 4130 dbSNP
rs963825713 4130 dbSNP
rs1298560791 4132 dbSNP
rs184168038 4134 dbSNP
rs1425299027 4150 dbSNP
rs1170853376 4152 dbSNP
rs1474797270 4154 dbSNP
rs922491696 4156 dbSNP
rs1201673560 4164 dbSNP
rs546932010 4165 dbSNP
rs770069776 4166 dbSNP
rs1212182607 4171 dbSNP
rs1025518697 4172 dbSNP
rs951201681 4175 dbSNP
rs982740402 4185 dbSNP
rs1337548895 4186 dbSNP
rs984001360 4191 dbSNP
rs1393726994 4195 dbSNP
rs1394991372 4195 dbSNP
rs1408959776 4195 dbSNP
rs146578104 4195 dbSNP
rs1478669160 4195 dbSNP
rs374160247 4195 dbSNP
rs58575390 4195 dbSNP
rs869128328 4195 dbSNP
rs942044132 4195 dbSNP
rs1317071668 4196 dbSNP
rs1192227703 4197 dbSNP
rs1359607119 4199 dbSNP
rs1213457097 4202 dbSNP
rs531922582 4203 dbSNP
rs1178285928 4204 dbSNP
rs1308924176 4206 dbSNP
rs1436253114 4207 dbSNP
rs1280878725 4208 dbSNP
rs1201086220 4209 dbSNP
rs980875877 4210 dbSNP
rs927732151 4211 dbSNP
rs1204717989 4212 dbSNP
rs1378864794 4212 dbSNP
rs939130962 4212 dbSNP
rs1242934425 4213 dbSNP
rs1441074520 4213 dbSNP
rs867807783 4213 dbSNP
rs1333597152 4214 dbSNP
rs1460203398 4214 dbSNP
rs1037628461 4216 dbSNP
rs1172333918 4216 dbSNP
rs1176957028 4216 dbSNP
rs1308459360 4216 dbSNP
rs1381353695 4216 dbSNP
rs1414543444 4216 dbSNP
rs1188426003 4217 dbSNP
rs1239418674 4217 dbSNP
rs1390623714 4217 dbSNP
rs1468842811 4217 dbSNP
rs1158910833 4218 dbSNP
rs1208676917 4218 dbSNP
rs1222978270 4218 dbSNP
rs1285602376 4218 dbSNP
rs1286531835 4218 dbSNP
rs1310503098 4218 dbSNP
rs1348177923 4218 dbSNP
rs1354296965 4218 dbSNP
rs1355723011 4218 dbSNP
rs1361710525 4218 dbSNP
rs1382341111 4218 dbSNP
rs1399318789 4218 dbSNP
rs1402440979 4218 dbSNP
rs1448233557 4218 dbSNP
rs1485393630 4218 dbSNP
rs868233522 4219 dbSNP
rs1164072778 4220 dbSNP
rs1195903557 4220 dbSNP
rs1415818925 4220 dbSNP
rs1474979284 4220 dbSNP
rs1489262568 4220 dbSNP
rs866929062 4220 dbSNP
rs1214906308 4221 dbSNP
rs1242623458 4221 dbSNP
rs1228566307 4222 dbSNP
rs1290960579 4222 dbSNP
rs1291700171 4222 dbSNP
rs1333667440 4222 dbSNP
rs1445083777 4222 dbSNP
rs1219921312 4224 dbSNP
rs1220440185 4224 dbSNP
rs1288809347 4224 dbSNP
rs1324582192 4224 dbSNP
rs1341753023 4224 dbSNP
rs1352012971 4224 dbSNP
rs1429179490 4224 dbSNP
rs1461164263 4224 dbSNP
rs1392536314 4225 dbSNP
rs867965257 4225 dbSNP
rs1172990448 4226 dbSNP
rs1478189638 4227 dbSNP
rs62189325 4227 dbSNP
rs1214071258 4228 dbSNP
rs1248287466 4228 dbSNP
rs1270879220 4228 dbSNP
rs1294185202 4228 dbSNP
rs1307593289 4228 dbSNP
rs1467800897 4228 dbSNP
rs200061877 4228 dbSNP
rs868232023 4228 dbSNP
rs1213367033 4229 dbSNP
rs1333629410 4229 dbSNP
rs914030673 4229 dbSNP
rs10209218 4230 dbSNP
rs1174200550 4230 dbSNP
rs1180155978 4230 dbSNP
rs1194101841 4230 dbSNP
rs1201805364 4230 dbSNP
rs1234123532 4230 dbSNP
rs1250318538 4230 dbSNP
rs1250852954 4230 dbSNP
rs1281668618 4230 dbSNP
rs1296584268 4230 dbSNP
rs1311867160 4230 dbSNP
rs1314529734 4230 dbSNP
rs1359750064 4230 dbSNP
rs1369275685 4230 dbSNP
rs1392228624 4230 dbSNP
rs1408188147 4230 dbSNP
rs1427167589 4230 dbSNP
rs1450291745 4230 dbSNP
rs1453581200 4230 dbSNP
rs1466298562 4230 dbSNP
rs1480736866 4230 dbSNP
rs374592876 4230 dbSNP
rs762661881 4230 dbSNP
rs796680631 4231 dbSNP
rs796783098 4232 dbSNP
rs1007538996 4233 dbSNP
rs1323568246 4234 dbSNP
rs1040817212 4235 dbSNP
rs901919523 4236 dbSNP
rs1186033951 4237 dbSNP
rs1244273573 4238 dbSNP
rs1475152806 4239 dbSNP
rs993955837 4242 dbSNP
rs1160213720 4243 dbSNP
rs1026405707 4244 dbSNP
rs1348589884 4244 dbSNP
rs1175046546 4245 dbSNP
rs1166263813 4246 dbSNP
rs951172238 4246 dbSNP
rs1438241225 4247 dbSNP
rs1178493609 4249 dbSNP
rs1421682820 4249 dbSNP
rs1410760808 4250 dbSNP
rs1175550795 4252 dbSNP
rs1405168167 4253 dbSNP
rs1210840160 4254 dbSNP
rs1346310366 4257 dbSNP
rs1468025617 4259 dbSNP
rs1338677070 4266 dbSNP
rs13031588 4268 dbSNP
rs1316622951 4269 dbSNP
rs1305140606 4270 dbSNP
rs1383401172 4270 dbSNP
rs1429887174 4272 dbSNP
rs1356208972 4273 dbSNP
rs1267920250 4276 dbSNP
rs550047467 4278 dbSNP
rs1373544407 4279 dbSNP
rs367913586 4279 dbSNP
rs1299874453 4282 dbSNP
rs1005403216 4286 dbSNP
rs1362947799 4287 dbSNP
rs1262112070 4288 dbSNP
rs1156518982 4294 dbSNP
rs895149549 4300 dbSNP
rs1321923866 4303 dbSNP
rs1016849397 4306 dbSNP
rs1186584506 4307 dbSNP
rs545937682 4309 dbSNP
rs1265970108 4312 dbSNP
rs777749997 4316 dbSNP
rs561776143 4317 dbSNP
rs1446957427 4325 dbSNP
rs1485754793 4333 dbSNP
rs1046445997 4337 dbSNP
rs1247307592 4340 dbSNP
rs559557196 4342 dbSNP
rs529223830 4343 dbSNP
rs547593157 4347 dbSNP
rs1475783179 4354 dbSNP
rs1199044788 4357 dbSNP
rs1342371292 4359 dbSNP
rs564597232 4360 dbSNP
rs987826295 4362 dbSNP
rs1382661515 4365 dbSNP
rs1384010024 4366 dbSNP
rs1286872399 4370 dbSNP
rs913666083 4388 dbSNP
rs539545032 4389 dbSNP
rs1163666774 4390 dbSNP
rs552387309 4393 dbSNP
rs1425079545 4394 dbSNP
rs1017985892 4400 dbSNP
rs570643630 4405 dbSNP
rs189142893 4406 dbSNP
rs1260142914 4412 dbSNP
rs71424265 4414 dbSNP
rs1211989455 4415 dbSNP
rs963695859 4426 dbSNP
rs1272784238 4427 dbSNP
rs770790813 4428 dbSNP
rs976523794 4437 dbSNP
rs71424266 4439 dbSNP
rs1270802084 4440 dbSNP
rs1228119274 4444 dbSNP
rs71022341 4450 dbSNP
rs1325765337 4452 dbSNP
rs1293253839 4456 dbSNP
rs1402580565 4459 dbSNP
rs1040639015 4467 dbSNP
rs1442830265 4486 dbSNP
rs1371378407 4501 dbSNP
rs901802139 4503 dbSNP
rs1316048924 4508 dbSNP
rs556467370 4513 dbSNP
rs1459504849 4520 dbSNP
rs1398051356 4525 dbSNP
rs866526863 4542 dbSNP
rs868824752 4543 dbSNP
rs1461972183 4559 dbSNP
rs1029805824 4562 dbSNP
rs993517524 4566 dbSNP
rs1201559886 4567 dbSNP
rs1454990359 4570 dbSNP
rs951262323 4575 dbSNP
rs1346522548 4576 dbSNP
rs1459232401 4578 dbSNP
rs982988305 4584 dbSNP
rs1195292553 4587 dbSNP
rs1338747665 4588 dbSNP
rs909803053 4588 dbSNP
rs71424267 4591 dbSNP
rs1047816971 4595 dbSNP
rs10186377 4602 dbSNP
rs1224920436 4606 dbSNP
rs1438320168 4607 dbSNP
rs193007394 4607 dbSNP
rs71424268 4611 dbSNP
rs776152174 4614 dbSNP
rs1350327780 4624 dbSNP
rs1203961842 4626 dbSNP
rs1329023655 4632 dbSNP
rs71424269 4633 dbSNP
rs1005372455 4635 dbSNP
rs1286945266 4641 dbSNP
rs1016810151 4642 dbSNP
rs948031966 4653 dbSNP
rs1176099747 4656 dbSNP
rs1046488715 4661 dbSNP
rs1447708588 4667 dbSNP
rs535388774 4672 dbSNP
rs1172142142 4686 dbSNP
rs905032192 4701 dbSNP
rs1002490349 4703 dbSNP
rs1053069506 4706 dbSNP
rs1436166331 4709 dbSNP
rs1034959569 4716 dbSNP
rs1481553339 4717 dbSNP
rs960622178 4718 dbSNP
rs1212976367 4720 dbSNP
rs1348468711 4726 dbSNP
rs1279412740 4731 dbSNP
rs893965513 4732 dbSNP
rs1231799775 4735 dbSNP
rs1352491110 4736 dbSNP
rs112585511 4738 dbSNP
rs1018521644 4740 dbSNP
rs1020641720 4749 dbSNP
rs1333506009 4753 dbSNP
rs1314143906 4758 dbSNP
rs997825708 4761 dbSNP
rs1156801697 4762 dbSNP
rs866473038 4762 dbSNP
rs1257034619 4763 dbSNP
rs1311517572 4763 dbSNP
rs375324310 4763 dbSNP
rs1158235146 4766 dbSNP
rs1410040172 4769 dbSNP
rs1029424322 4775 dbSNP
rs1302019146 4776 dbSNP
rs1363104058 4777 dbSNP
rs1406399164 4779 dbSNP
rs866763175 4787 dbSNP
rs576609181 4788 dbSNP
rs910678288 4794 dbSNP
rs1256722464 4798 dbSNP
rs1017214325 4803 dbSNP
rs1237312824 4808 dbSNP
rs185318444 4813 dbSNP
rs962499309 4814 dbSNP
rs991382880 4821 dbSNP
rs769381291 4827 dbSNP
rs1204223581 4839 dbSNP
rs943552936 4844 dbSNP
rs1352080576 4845 dbSNP
rs545571751 4846 dbSNP
rs1294660224 4847 dbSNP
rs1233363428 4855 dbSNP
rs781429139 4859 dbSNP
rs1291998508 4862 dbSNP
rs915799782 4874 dbSNP
rs969368356 4875 dbSNP
rs1318040050 4877 dbSNP
rs1490840846 4878 dbSNP
rs1223584083 4879 dbSNP
rs1165840626 4880 dbSNP
rs1250064376 4881 dbSNP
rs1474928666 4883 dbSNP
rs189030666 4897 dbSNP
rs923562656 4899 dbSNP
rs982479856 4903 dbSNP
rs1242535839 4914 dbSNP
rs1308339668 4915 dbSNP
rs927982136 4917 dbSNP
rs929281092 4918 dbSNP
rs1274671624 4936 dbSNP
rs935446155 4937 dbSNP
rs1047785706 4950 dbSNP
rs887852004 4951 dbSNP
rs376788068 4952 dbSNP
rs1270688448 4954 dbSNP
rs543730896 4955 dbSNP
rs1234353913 4956 dbSNP
rs562012658 4957 dbSNP
rs1162779294 4964 dbSNP
rs915437744 4965 dbSNP
rs879614168 4966 dbSNP
rs1373569972 4968 dbSNP
rs113818639 4970 dbSNP
rs1044486601 4973 dbSNP
rs1461077895 4979 dbSNP
rs904999221 4983 dbSNP
rs1392420070 4989 dbSNP
rs1002056261 4995 dbSNP
rs548532797 5003 dbSNP
rs1035335705 5004 dbSNP
rs1331321001 5010 dbSNP
rs1185795075 5017 dbSNP
rs900052946 5017 dbSNP
rs1447452625 5019 dbSNP
rs1254598736 5029 dbSNP
rs1193911765 5031 dbSNP
rs1452551107 5033 dbSNP
rs896429138 5038 dbSNP
rs1009184346 5040 dbSNP
rs1313546999 5043 dbSNP
rs1024162084 5046 dbSNP
rs543591332 5049 dbSNP
rs1307497159 5061 dbSNP
rs1272938497 5068 dbSNP
rs1226773739 5069 dbSNP
rs562081966 5073 dbSNP
rs1051242725 5076 dbSNP
rs1304580731 5086 dbSNP
rs1246777305 5092 dbSNP
rs1369028968 5097 dbSNP
rs886771255 5098 dbSNP
rs1443030165 5111 dbSNP
rs1004399996 5117 dbSNP
rs967696519 5122 dbSNP
rs1016659913 5123 dbSNP
rs979111731 5128 dbSNP
rs1174011004 5130 dbSNP
rs1453485184 5145 dbSNP
rs1422624346 5149 dbSNP
rs773898524 5149 dbSNP
rs1178514814 5151 dbSNP
rs1480684375 5154 dbSNP
rs1017372804 5158 dbSNP
rs1203686389 5161 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl , C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000409600.1 | 3UTR | AUCCAUUUAUUUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000409600.1 | 3UTR | CUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.449 1.0e-5 0.397 1.0e-4 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.751 6.8e-5 0.823 4.2e-6 20 Click to see details
GSE27834 Pluripotent stem cells -0.592 7.8e-3 -0.582 9.0e-3 16 Click to see details
GSE32688 Pancreatic cancer 0.356 2.3e-2 0.367 1.9e-2 32 Click to see details
GSE19783 ER- ER- breast cancer 0.214 2.9e-2 0.139 1.1e-1 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.407 3.7e-2 -0.397 4.2e-2 20 Click to see details
GSE14794 Lymphoblastoid cells -0.187 3.9e-2 -0.189 3.7e-2 90 Click to see details
GSE42095 Differentiated embryonic stem cells 0.308 7.6e-2 0.204 1.8e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.405 8.5e-2 -0.418 7.8e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.261 1.1e-1 -0.210 1.6e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.255 1.1e-1 0.403 2.3e-2 25 Click to see details
GSE38226 Liver fibrosis -0.272 1.2e-1 -0.269 1.2e-1 21 Click to see details
GSE19536 Breast cancer 0.105 1.5e-1 0.056 2.9e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.11 1.9e-1 -0.014 4.6e-1 64 Click to see details
GSE17306 Multiple myeloma 0.086 2.8e-1 0.050 3.7e-1 49 Click to see details
GSE28544 Breast cancer 0.122 2.9e-1 0.160 2.3e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.088 3.9e-1 -0.070 4.1e-1 12 Click to see details
GSE21849 B cell lymphoma 0.051 4.0e-1 0.438 8.7e-3 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.028 4.5e-1 0.148 2.4e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.028 4.5e-1 0.148 2.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.517 0 0.567 0 32 Click to see details
BLCA 0.613 0 0.631 0 18 Click to see details
LIHC -0.345 0.01 -0.306 0.02 49 Click to see details
HNSC 0.293 0.03 0.248 0.06 42 Click to see details
ESCA 0.559 0.04 0.509 0.05 11 Click to see details
KIRC 0.216 0.04 0.182 0.07 68 Click to see details
CESC -0.986 0.05 -1.000 0.5 3 Click to see details
KIRP -0.24 0.09 -0.217 0.12 32 Click to see details
COAD -0.324 0.22 -0.714 0.02 8 Click to see details
THCA 0.092 0.24 0.113 0.2 59 Click to see details
PRAD 0.09 0.27 0.081 0.29 50 Click to see details
KICH -0.128 0.27 -0.165 0.22 25 Click to see details
CHOL -0.188 0.31 -0.400 0.14 9 Click to see details
LUAD -0.138 0.33 -0.126 0.35 12 Click to see details
BRCA -0.044 0.35 -0.055 0.31 84 Click to see details
UCEC -0.088 0.36 -0.128 0.3 19 Click to see details
LUSC -0.055 0.37 -0.125 0.23 38 Click to see details
PAAD -0.161 0.42 0.200 0.4 4 Click to see details
PCPG 0.1 0.47 0.500 0.33 3 Click to see details
PCPG 0.1 0.47 0.500 0.33 3 Click to see details
PCPG 0.1 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component