miRTarBase - #MIRT196450 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TAOK1   
Synonyms KFC-B, MAP3K16, MARKK, PSK-2, PSK2, TAO1, hKFC-B, hTAOK1
Description TAO kinase 1
Transcript NM_020791   
Expression
Putative miRNA Targets on TAOK1
3'UTR of TAOK1
(miRNA target sites are highlighted)
>TAOK1|NM_020791|3'UTR
   1 CTTAATAATTGAGAGTGGCAATTCCGCTGGAGCTGTCTGCCAAAAGAAACTGCCTACAGACATCATCACAGCAGCCTCCT
  81 CACTTGGGTACTACAGTGTGGAAGCTGAGTGCATATGGTATATTTTATTCATTTTTGTAAAGCGTTCTGTTTTGTGTTTA
 161 CTAATTGGGATGTCATAGTACTTGGCTGCCGGGTTTGTTTGTTTTTGGGGAAATTTTGAAAAGTGGAGTTGATATTAAAA
 241 ATAAATGTGTATGTGTGTACATATATATACACACACATACACATATATTATGCATGTGGTGAAAAGAATTGGCTAGATAG
 321 GGGATTTTTCTGAACACTGCAAAAATAGAACGTAGCAAAATGGCTTCAGTTATCACTTTTGGGTGTCTGTATCCTAAGAA
 401 GTTTCTGAAAAGATCTAAAGCCTTTTTATCCCATATCCCAAATTCTTATGAGCCACTCACAGCAGGCAGCATATGTTGAA
 481 ATAAGTTATTACTGGTACACACCTGCATTGCCTCACCAGTGTATTTATTTGTTATTAAATTGATCTGACTTCTCAGCCTC
 561 ATTTGGACTAAAAAAAGAAAGCAGAAATCCATGAACACATTGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGAAATCC
 641 ATGAACACTAAAGGACTTCATTGATTTTTTCAGAGAGTAGAAAACAACTTAGTTTTTCTTTTTTCCTGAATGCGTCATAG
 721 GCTTGTGAGTGATTTTTGTCCATTCAATTGTGCCTTCTTTGTATTATGATAAGATGGGGGTACTTAAGGAGATCACAAGT
 801 TGTGTGAGGATTGCATTAACAAACCTATGAGCCTTCAATGGGGAAGACCAGAAGGGTGAGAGGGGCCCTGAAAGTTCATA
 881 TGGTGGGTATGTCCCGCAGCAGAGTGAGGAGATGAAGCTTACGTGTCCTGACGTTTTGTTGCTTATACTGTGATATCTCA
 961 TCCTAGCTAAGCTCTATAATGCCCAAGACCCCAAACAGTACTTTTACTTTGTTTGTACAAAAACAAAGACATATAGCCAA
1041 TACAAATCAAATGCCGGAGGTGTTTGATGCCATATTTGCAAATTGCCATCTATTGAAATTCTCGTCACACTACATAGACA
1121 TAATTGTTATCTCCTTTTGGCTTATGTGATTTTCTGTTTACAAGTAGAATAGCCAATTATTTAAATGTTTAGTTGCCACA
1201 GTGAACCAGGAGTCACTGAGCCAATGACTTTACCAGCTGCTGACTAATCTTCATCACCACTGTAGATTTTGCTGCATGTG
1281 CAGGTCCTCTATTTTTAATTGCTGTTTTCGTTGCTGCAGTACTTTACAAACTTCTAGTTCGTTGAGACTTAGTGACCATT
1361 TGGCATCAAGTTAACATCACACAATAGGAAACACCACTTCCACAAGTCTCAAGCCTCAGTGCTAAAGTACTACTGAAAAG
1441 GAACTAGGAAGTTTGGCCAATTAAAAAAAAAAAGTAAAATAAGTTATAGTGGTCAGGGAATCTCTTGACGAAAGCTAACT
1521 CTTATTTTTCAGGGGGCACATGTTTTGTTTTGTTATGTTTTGTTGTACAATGAAGGATGAACCCAATGCTAAAAAGTCAG
1601 TTATTTTCTTGGTTTTCCATTTCTTGTATATAAATTGTGTTGGAGGTGGGTAGGAAGCTGTGAGTATGACTTGAAGAAAA
1681 ATATCCTTTTCAGTGACAAATCAGAGTTTCTTACAAGTTATTGTCCTGCTCCCTTCCAAGTTGTCTTGAAGAATCCTTGC
1761 TGCTAACTCTGGATCCTGCTTTTCCTATAGTCAGAGGGCTCCAAGGTAGAACTCTCTAAGTCCCTCTCAATGGCACTCTT
1841 TGCCTAGACCAAACTAATGACCAAACAGTAATCAATCTATCACTGTTGAAGTCCTGGTTTTCTCAACCAAATTTTAAGTC
1921 TTTCCCAGGTATGTCAGTCGAGTTGCCATGAATCCTCACCTGTAGGAGTTTCTGGGATTCATTTTAAGGAAACTGGAAGA
2001 AAATTAATGTTTTAATGTAAATGTTTTTAAAACCAAGATCACCATAGAGTTCACACAAAATTTTAGGCAGTGTTTCAAGA
2081 AGCACTCTTATGTGTTGTTCTTTCAGCCCATGCTCCAGGTCACCGGTTTTTAGGTAAACATGACATGACATGTACTTGTA
2161 ATATCAGTGAAAGGGGCTTTTAGTCGTCTCAGTATCTTTTTTGCATTCAGGTATTATAGCGTTTCCAACAAATTGAGAAA
2241 TTACTTATTTGGTGTAAAATGACGAGAGAGCTTTAGAATTTAATAAAATGTCAAAAATACAATTTGATACCCTTAAAAAT
2321 TATTCATAGATCTGGCTGCTCTGTACTACTGGATGGGTGGAATAGGGAAGCAGATCACTTTTGCATACAAAAACTCTTTC
2401 AAACCCAAAATATTATTGGTGGTACATTTTAAAGTCCAATTGTGGACTTAAATTAGTCAAATTGAGAGTTACTGAGTCCA
2481 TTCAGATCTCCAGTAGGGTTTTGTATCTAATGTATTTGGCCACCAGTTTTACATGTAGGTCATGACTATACCTGGATTTT
2561 ATCATTAAGTTAACTTTAAAGTATATACAGTTTGCAAAAAATGATTCAAATTAATTGGTTTGTATATGTTTGTGAGATCT
2641 AGCTTCTGAGGAATCTCATACATAGTAGGAACCATCATAGAGTAAAGCTTGTAGCAGAAAAATTGGAAGGGTTTTGAGAT
2721 ATCCTAGAGAAAGAGCAAGCACTTTCTGAATCAGTGGGGAAATATCAATATTTGATCAAATTAACACTACCTCCTTCCCA
2801 GTGTTGGTGTTCACTCACTATATGTCTTTAAGAAAATTAAAACTATGGAAAATTTGTCTAGCATATCAGAAGTTGTAAAT
2881 GCTATATCTGGTATCCAGAGGCTGGCTGTAAAAAGTTCCTTGGGGTCACTCTATCTCACATTTTTTTTGGTTAGCATTTT
2961 AAAAATGCAAAGCCACATACTTTGAAATATATTATTCCAAATTGAGCTCCCTTCCCTTTGCACATATTTTTTCCTCCCCT
3041 TATTGAAGTCAGCTCTAACCCCAAATTCTAGTATCCAAAAGTATTTTTATTTGTATAATGCTATCTGAAAAATGTGTTTA
3121 TATTATATTTTCAGAGCTGCAATTCTTATTCGCCATTTCAATACCTAGAGATAGAGAGTCTTGTATTTGAAGCCACACAC
3201 ACTGGTGTAATATGCTTAGTACTCTAGGTCAAGGATTTGTTGGTAAATGGAACATTTTAGCATAGTCATGATTTTTGGTT
3281 GCCTAGACATCAGGTAAACATTCAGTACACTAAAGAAACTATCCTGGACACTCCCTCCTGCTTCCACCAATTTTTTTCTC
3361 ACCCCCTTTTCAAAAATTGAAAACTCTATGAGTGTCTTTTTGAGACCATAAAGCAGACTTTAGTAACTTTCTATTTCTGT
3441 AAGTACTAAATGTCTGGCATTTTAAACTTTTGTAGAATACATTATGTTGGACACTGGAATAATACTATTTATTTTCACCT
3521 GTGAAAAATGACTTCATTGTACTTGAAACACCTCCTTTGCATTTCTCCATTTGTGCCATTCACTAGTGGAAATAAATTGT
3601 ATTATACCATGATCTACTGGCTTTTTAAAACTGTATTAAATATGCACATTTTTGGTATAGCTATTATCATTTGTATGTAT
3681 ATATTGTATATACATATGAGTGTCTGTATGTGTGTATAGATGGATGGATGTAACTCATACTGTACATTTCCATCAGGGCA
3761 CTTAAAAGTTCTGTTATTTTTGTTTGGTTTTGTTATTTCAGTCCTCAGTTAAGGCAAGAATGCATGTGTTTCTTAAGAAT
3841 GAGTACTCTGCGTTGATGTTTATGAGAAGGTGGTCATTAGATGCAGTCTTTTCCTTTTTAATCCCCTCTTAGCACTTCTG
3921 TGAGTGGAGAGGACATTAAGTAAAATTTGGAATCATAAGTTGCAATGCAGTAAAATGGTGCTGGGGAAGGAGCCAGTTAG
4001 TGTTTCTGTGAGTTTGTGTTGTGATGCAATAAGAGATAAGTAATGCAGAGAGAAATGAACCATGGAAAGTAAGAACACTG
4081 ATGGTGATTCCTCTGCAAAGATGATAAGAAAAAGAACCAATAAATCACACAATCTTTATGTGCTTTCTATATGTATTTCT
4161 TAGTAGTGATACCATTGATCCTCTTACTTTTTTTACTCCATTAATACTAATAATTATATACTTTGCTGAGGATCAAAACA
4241 GCCAAGAAAGGAATTACTGCTAAAGCATCTAAGATTCTCCTGAACTGTAAAATCAACAGGAAATGGCCACTGGGAGAGAA
4321 GGATTTGGTATTGGGTGAGGGGCTTTCTCCCTTTACCTGCCTCTTCTTGCTTGCTAATAGTAAGTTCTTTGTGCACCTTC
4401 CACCACTTCTGAGCCACTACTATTCAAGTAGAGATTTGCCCCAACACATTAACTTTTTCCTTGGAGATTTATATGGTCCT
4481 GCATTTTGTCCTGTGCTCACAATGTGAAGTGTCTTCTGTATTCAAATCAAAAAATAATATATTTAAGGTATATAAGTGTG
4561 AATCTCCTATAATGATGGAAGAAGAGGTTCTCTTGTCTTAGATAGAAAAGAGCCTTCTCCAAGAGCAATGTCAAAACTTG
4641 GGCTGTCATCTTTGAGCTGTTTACCAAAATACAGACCATTATTGAAGAAAAACAAATTATCTATTTTGTTTTCCCCCATC
4721 TAACATGATAGTGCCCCCAACCAGGTTGTAGCATTGCCTTTTAAAAGAGACTCACTCACTCTTAGTTTTTAAGAACTGGA
4801 AATTTCCCATCCTCAGATCCCTTAAAGGATGAAGAGTTGGCTGTACACTTAGCGGACTTGCCTCTTGTATGCAAGGACTA
4881 CTGATTGAAGTCTGTTTTGCTGTGTCTGGTTATGTTGTCTGCACTTTTATGAAATCACTACAATAGGTCTGCATTGGAAA
4961 TGACTATTAATTTGTAAAGAAGTAAGTTTTATTAAACACTGTCTAGAAAAAGAAAGTGAAGCTGAGAACTCTTCCTTTAT
5041 TGTGCATTTATATTTTCTGCTGAATTCCGGTAGTTCCCTTTAAAGTCATGTTGACTAATGTTTTCCTCCTTGTTTGTATT
5121 CAGATTTCCAAAATTTCACTCATACAAGGGAAGAGACTCCATTTAGCTTAACGGTAGTCTTTAGATCATAAGAAATATAT
5201 AAATTAGTATGCACCTTATCTGCCTGTTGTGGGTTTCTTAAACTTGCACTTCCTACCCACCCAAAGATAGATATCCTTTA
5281 AAGAAAATAAAGGCAGAGAATTAAAACTGGGGAGCCATTTACTATGTCACCATCACTGTTAACTGTTTCCCAGCAATCTA
5361 AACTTTTTGAAGTTTCAGAGGTGTATTTTTTTTTTGTATATATGTCTGTGTGATTGTATTGTTTTGTTTCTAAATATACA
5441 AGGAATTCTTTAAATAGAGAAAAAGGTTAATCCTCACTGAAACACCAGGATGCCCACTGGATATACTAATCTGAACATCT
5521 GTAGGTAGTTTGTCATGAAAAAGTGGAGAGAAGATGAGACTTTTGAATGAATGAAAAAGGGTATCTTGATACCCAGAATT
5601 CCCCCCAAAGTACGGGTAATTCAACCTGCACAGTTTTCTTTCACTCAAAGTGTTCAGCACTTGTGAGTGAAAAATCATGT
5681 AATTATCTGTAAATATGTAGCTAACAAATTGACCTAGTTTCTGTATTTTTTTGTTTTTGTACTAAAGTTTATAGGTCTGT
5761 GCCAGCTAGAGAGAAGTTGCTGTCATTACCAGTTGTGGTCCTAGCATCTAACCCTGAAACCATCCTAGGTGACATTTTTA
5841 GAATTAATACTTAAATGTTAAACAGGGGGAAATGAAGCTTAATCATGGTCAGGTTTGAGATCTTTTGCAGTGAAATAATT
5921 TTATTTAATATAAATGATCACATGTCCTCAATCATGAATGAGGTAGGGAGCCTCTCTCCCCCAGTGGCCATGTTTACAAA
6001 AGTGTGTTTTGTCTATAAAGTGCAAGTGTTTTAATGTTTATGTAAATTATGCAGGTGATAACATGGTTTGGAACTGTTTA
6081 TTGGGCTCTTTAACTGAATTTTCAAATGAAATGAACTATGCTTATTGCTGGCACATTGATCCCATTTCTGGAACATTTTT
6161 CCTATTTCCAGAGTTACATATGTTCTTTTGTCATTACCCAATTTAACCTCCCTTTCTCTGATATGCCTTGTAGCCAAAGT
6241 ATTAAAGGCTGATGAACATAGACAAGGGAAATGCATTTCTTAGAAATCCGTGAACCCTCAGTTGTATGCTTTCAGTACTC
6321 GTGTTAATATGTTTCTATGGCAACTCTGAGGTCAGTGGTTTAGAAATGAGATACCAGTGTTAATGAAAAGTGTGTGCTCT
6401 TTGCTTTTGCATGGCTTGGCTTAGTATCCAAGGTATATTAGGGCCACTTGAAAGCATGAAGACCAGTTATATAGGGAACA
6481 GGTTTCTCTCAGTGGCACATTTTGCTTTTTCTGAGCCCCAAATACATTGCCTGGGCATGAACATTGTTACCGTAAATTGC
6561 ACATGGTCATGGACTGAATTATGTGACTTTAAAGGATGTAACTGCCCAACATTTGCAGATTCTGGGTGGTCTATGTGACC
6641 ATTTGTCTCGTATCCAAAAACCCCGGGGCTATTGGAACCCTTCCAACACTTTTTCCTTTGTCATAGACAAGTTTATATAT
6721 AACTTACCAAGATGTTGGCTGTCCTGGTGTATTGCCAGACAGCTCTCTTTTGGTTCCCATTCCAAATGTGCTGCTGTCCT
6801 TCTTTGCATTTCACAATATCAAAGAAACCACCACCCTTCTTCCTAACAGCATTTTATGCCTTTTATTCCACATTAAATGG
6881 GAATTGTGCCTACTTAGGAGTGCCCCTCCAATTAATTACATGTGTCCAAGAATAATCCAAGCTAGAGACACAAGGTGGGA
6961 AAACATTTCAAAAAAAAAAAGTCCTCTTAAGGCCAGTAATTTATCTGAAAAGGTATTTTATCACACCTTGACACCTTATA
7041 TATGAGCCTATTAGGAGCTGCAGGTGGTTTCATAGGGTAAAATCCAAGAAAAGAGAAGGATGTGTGGGGTTTCTATTAGA
7121 AGATAATTTTGTTCTCATTTTACCTTTTCTTTTATGATCCTTCTCTGCTAGAACAGGTTAATTCTCCAAATTTGTTTTGT
7201 TTTGTTTTGTTATTTTTTAGGGAACTCTTTTGCAAAAGCAATGGTCGGATGTAAATAACATTTAAAGTATAGTGCACATA
7281 ACTTCCCCGGACTGTTCCAATCTGATAATTTGTAAATGCTTTAGAGTTTTTTTAATTAACACTTGTGTTGCTAAATTCTA
7361 TTTATGTAAGTCTGCTAAAGTTTTTTAGCCCACTTAAAACTTAAGACAACCATTTAAAATAATGGATGGGTTACTATGAG
7441 CAATTTCGCTTTCAGAACCCCCTTGTTTTAGTATATGAAAAAGCCTAATGCGCATTAATGAGGTTGAAGAGACTATGAGA
7521 AATATGTATAGTGTATATTTTAAAACAGCTTTGCTTGTATTGTGAAGATTTAAAAACAAACTTGAGATTTTTAACGTAAC
7601 TATTAACACAGTTTTAACATAAGTTATCCCACTGGGTTTAAGAGCATCTTGAATGTATAATCCTTTTTGTAACCCAGGTT
7681 GGTTTCTACTTTTACCAGTCACCCAAACATATTTATGTTTTTAGTTTTATGTACTCATTTCCCTTTGTTTTCCTCAAACA
7761 GCATGATTTTTTTGCACATGTAGAAATTTTTTAAAAGAAAGAAATTAGTACATCATTTTCTCTGGATTTTCTTCACTTCC
7841 CTCTTCCTTTCTACTAACTCCTTCCTTAAAGGCCATATCACTCCATTTGCATTATTTGTGCAAATGCCAGGGTTGGTTTT
7921 TATTTTTATTTTTGCTATTTACCTAAAAAAAGAAAATGCTTCAGTCAATTGCTTTTTTATTTAAAAAAAAAAAGAAAAAA
8001 AGCTGTAACCTTATCATTTCTGAGTAGACCATTGAGCGATGAATGCACACCTGTAGTAGCCCAGGACCAGCTGTGGTGGC
8081 TAAAGGGAATATGTTAATTAAGCAAGAGGTTCTTTTCTAAAAGTGGTATCTGTTATCCACAATGTATTTTAGTTATTCCC
8161 ACAAGTCAGGGGTCCAGATAAAATGAGGGTTATCAGCTAACTGATATGCTATCATTGAGGTTCATCAATGAATTTGTACA
8241 TTTCTAGTTCCCTTTGGTGAAGGGAAAAATGATGATTTTGCAAGACCTAGATTTTGGCTTGGTTTCTTGCCTCCTTTTTT
8321 GGCAGCCTTCATCTTCTCATCTCCCAAACCCCCTGAGCCCGTAGGGTTTTCATAGTGGACAAAGAACTTGTGGTCTTTTA
8401 AAACTGGGACTGATACTTTTTTGAGAGAGTATCGTGTCGAAAGTGTGATGTTCTACCACTTTACCAATAACTAATTTTAA
8481 ATACACATTGTCCTCTCGATTTTTGGACCAAACAGACGCTCACAGTGGAGGCTTATCAAGGGTTGCATTGGGGAAGAAGC
8561 CTCTCCCTCTCTGTCAGCACCAGCTGGTAAAGGTGACTGTACAGATGTGCATTTTCCTTTTGGTATAAATGGTCCACAGC
8641 ACTAACTGGTAAGGCTTATTGTACAGTATATTGTCAGTATTCTTCTGGTTCAGCATACCTTATAGTTCATATATAACCTG
8721 TATTAATTGTATAGATTGTGCATTAAAAGCTGTTACCAAGTTGTCAGAACATAAGAGCGAAAACAAGGTCATATGTAATA
8801 TTTTGTTTGTAAGTATCCTTTGTATCATAGCAAAGGAAATGTTTAAAAAAATCAACTGTAATAAAGTAATTTTAGTACAC
8881 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAA----UACACGACGAu 5'
                |||||    |||||||||| 
Target 5' tggttcCCATTCCAAATGTGCTGCTg 3'
6771 - 6796 166.00 -19.70
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ::||  ||  | ||||||| 
Target 5' ctTGAAGAATCCT-TGCTGCTa 3'
1745 - 1765 147.00 -10.70
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: |||||||:||:| 
Target 5' gaagcACTCTTATGTGTTGTTc 3'
2079 - 2100 141.00 -14.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28104893 11 COSMIC
COSN30114165 47 COSMIC
COSN30133044 72 COSMIC
COSN30544289 144 COSMIC
COSN8241426 271 COSMIC
COSN31562185 319 COSMIC
COSN31549798 341 COSMIC
COSN31480797 368 COSMIC
COSN31611063 376 COSMIC
COSN28830630 933 COSMIC
COSN25471547 1104 COSMIC
COSN31555469 1105 COSMIC
COSN31593984 1105 COSMIC
COSN8602844 1108 COSMIC
COSN6548052 1192 COSMIC
COSN8602845 1227 COSMIC
COSN31549799 1340 COSMIC
COSN31520869 1368 COSMIC
COSN15657408 1472 COSMIC
COSN15657380 1473 COSMIC
COSN15657325 1474 COSMIC
COSN28994098 1474 COSMIC
COSN24151383 1793 COSMIC
COSN24152402 1905 COSMIC
COSN24150280 1940 COSMIC
COSN21122094 1998 COSMIC
COSN26235666 2218 COSMIC
COSN25387246 2618 COSMIC
COSN26531219 3814 COSMIC
COSN24973498 3920 COSMIC
COSN1716147 3929 COSMIC
COSN22894978 4195 COSMIC
COSN21299548 4281 COSMIC
COSN7163298 4349 COSMIC
COSN16066565 4725 COSMIC
COSN24149762 4778 COSMIC
COSN1195113 4983 COSMIC
COSN6101381 5359 COSMIC
COSN27200642 5396 COSMIC
COSN5415243 5690 COSMIC
COSN1716148 5803 COSMIC
COSN21470657 5950 COSMIC
COSN27250538 6124 COSMIC
COSN21085315 6369 COSMIC
COSN33025 6647 COSMIC
COSN29190842 6697 COSMIC
COSN20699846 6745 COSMIC
COSN16068674 6835 COSMIC
COSN28419458 6852 COSMIC
COSN6101382 6864 COSMIC
COSN27501632 6981 COSMIC
COSN28979241 6981 COSMIC
COSN31582839 7771 COSMIC
COSN31528406 7779 COSMIC
COSN26643828 7835 COSMIC
COSN5415245 7886 COSMIC
COSN7163299 7912 COSMIC
COSN16232484 7936 COSMIC
COSN27114475 8004 COSMIC
COSN16162867 8083 COSMIC
COSN20331266 8213 COSMIC
COSN4768753 8266 COSMIC
COSN24701695 8489 COSMIC
COSN31561643 8518 COSMIC
COSN5415246 8548 COSMIC
COSN31550681 8667 COSMIC
COSN26586728 8735 COSMIC
COSN26573089 8768 COSMIC
COSN31597453 8852 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771986402 2 dbSNP
rs780822346 2 dbSNP
rs1024696137 3 dbSNP
rs1217153139 4 dbSNP
rs535568453 8 dbSNP
rs1331065082 9 dbSNP
rs553541204 13 dbSNP
rs1307510982 17 dbSNP
rs1445073555 22 dbSNP
rs139171312 26 dbSNP
rs1441723178 27 dbSNP
rs780081881 31 dbSNP
rs1238667236 36 dbSNP
rs1479397826 38 dbSNP
rs995367505 40 dbSNP
rs779684261 47 dbSNP
rs377624136 48 dbSNP
rs1176490589 50 dbSNP
rs980492477 57 dbSNP
rs1459198577 61 dbSNP
rs1027049703 70 dbSNP
rs1199798358 73 dbSNP
rs1181798959 74 dbSNP
rs1278251612 80 dbSNP
rs1218944369 87 dbSNP
rs1354639395 96 dbSNP
rs1308835367 99 dbSNP
rs952699434 100 dbSNP
rs951149015 106 dbSNP
rs1445491406 110 dbSNP
rs1313972711 113 dbSNP
rs983097755 114 dbSNP
rs1395944123 116 dbSNP
rs908427110 123 dbSNP
rs986538697 126 dbSNP
rs943857874 140 dbSNP
rs866054805 144 dbSNP
rs1165177225 145 dbSNP
rs1415700272 148 dbSNP
rs1459179999 150 dbSNP
rs1407945128 176 dbSNP
rs772532856 182 dbSNP
rs923365041 191 dbSNP
rs1195878807 192 dbSNP
rs975080287 193 dbSNP
rs1285499313 194 dbSNP
rs1203612801 202 dbSNP
rs914840070 203 dbSNP
rs1334150612 207 dbSNP
rs1354058267 223 dbSNP
rs1381354592 223 dbSNP
rs932039111 224 dbSNP
rs1400008460 225 dbSNP
rs746725443 232 dbSNP
rs1050487208 235 dbSNP
rs775782408 236 dbSNP
rs1295868342 246 dbSNP
rs1406715847 248 dbSNP
rs761483788 250 dbSNP
rs1391049053 252 dbSNP
rs569040318 252 dbSNP
rs1285534918 269 dbSNP
rs752830421 269 dbSNP
rs936649445 271 dbSNP
rs1337925046 275 dbSNP
rs539104272 277 dbSNP
rs1214346321 279 dbSNP
rs1171309177 283 dbSNP
rs1477493996 284 dbSNP
rs977601054 288 dbSNP
rs1052639268 298 dbSNP
rs1453513247 299 dbSNP
rs1259317168 304 dbSNP
rs892695103 310 dbSNP
rs938818974 325 dbSNP
rs1013719977 328 dbSNP
rs1025084673 331 dbSNP
rs894536692 339 dbSNP
rs557733327 340 dbSNP
rs1002359526 341 dbSNP
rs1438023962 349 dbSNP
rs538065602 352 dbSNP
rs1322493470 353 dbSNP
rs1438361496 369 dbSNP
rs1402195814 374 dbSNP
rs554827285 374 dbSNP
rs898429797 387 dbSNP
rs187989356 392 dbSNP
rs772721367 396 dbSNP
rs1003845173 397 dbSNP
rs1240558871 416 dbSNP
rs1015540512 421 dbSNP
rs1198417962 432 dbSNP
rs762509946 434 dbSNP
rs1240386048 443 dbSNP
rs765804272 446 dbSNP
rs1199703993 449 dbSNP
rs1185680885 450 dbSNP
rs751556020 464 dbSNP
rs1271537045 468 dbSNP
rs1220399493 472 dbSNP
rs1424304123 475 dbSNP
rs1273805894 480 dbSNP
rs1231609805 487 dbSNP
rs1378719585 498 dbSNP
rs1331754588 502 dbSNP
rs1008023704 506 dbSNP
rs1352632274 507 dbSNP
rs921093808 519 dbSNP
rs1019798310 522 dbSNP
rs1415038246 524 dbSNP
rs1402983936 525 dbSNP
rs1172112225 532 dbSNP
rs1174100754 564 dbSNP
rs149537132 570 dbSNP
rs953521667 570 dbSNP
rs543276951 571 dbSNP
rs759369805 573 dbSNP
rs1439488613 604 dbSNP
rs1212860789 609 dbSNP
rs936684265 609 dbSNP
rs1443560743 610 dbSNP
rs1021290512 634 dbSNP
rs1335854939 636 dbSNP
rs1324289864 637 dbSNP
rs1208155934 639 dbSNP
rs1052357190 642 dbSNP
rs1355359317 660 dbSNP
rs914183667 664 dbSNP
rs1370903601 665 dbSNP
rs753405469 665 dbSNP
rs949621431 666 dbSNP
rs767370912 671 dbSNP
rs1339842781 694 dbSNP
rs113458784 700 dbSNP
rs76598043 714 dbSNP
rs1002342635 729 dbSNP
rs1048622631 731 dbSNP
rs1282466270 739 dbSNP
rs80278783 739 dbSNP
rs1400418653 740 dbSNP
rs776202355 743 dbSNP
rs1003897065 748 dbSNP
rs1217575032 750 dbSNP
rs1015257458 751 dbSNP
rs1473394651 754 dbSNP
rs1263639487 756 dbSNP
rs1478649414 757 dbSNP
rs567098557 758 dbSNP
rs992982513 776 dbSNP
rs998092440 777 dbSNP
rs1197263589 780 dbSNP
rs1428513064 781 dbSNP
rs1291717453 784 dbSNP
rs1213940735 785 dbSNP
rs868667486 786 dbSNP
rs1378285201 790 dbSNP
rs1291377031 792 dbSNP
rs1412943935 795 dbSNP
rs1342449863 796 dbSNP
rs1298948182 805 dbSNP
rs916009829 812 dbSNP
rs1478092673 821 dbSNP
rs1430255364 824 dbSNP
rs1028208445 826 dbSNP
rs1343696163 833 dbSNP
rs1167298664 836 dbSNP
rs1173800178 838 dbSNP
rs954013596 839 dbSNP
rs978594286 850 dbSNP
rs143107440 855 dbSNP
rs1399783343 857 dbSNP
rs1163395320 871 dbSNP
rs1479121553 880 dbSNP
rs958134936 884 dbSNP
rs1038146551 888 dbSNP
rs533883859 890 dbSNP
rs78836924 892 dbSNP
rs1248115015 894 dbSNP
rs138152422 896 dbSNP
rs1046639768 897 dbSNP
rs1283281780 903 dbSNP
rs1332145624 909 dbSNP
rs182966257 919 dbSNP
rs1271113254 923 dbSNP
rs1277874457 924 dbSNP
rs754105756 926 dbSNP
rs1278887740 928 dbSNP
rs938198230 931 dbSNP
rs1360074898 932 dbSNP
rs1295519850 933 dbSNP
rs550470246 934 dbSNP
rs888223664 938 dbSNP
rs1019428045 944 dbSNP
rs149550134 947 dbSNP
rs115895321 953 dbSNP
rs1021760985 957 dbSNP
rs968359724 960 dbSNP
rs1426229748 965 dbSNP
rs1426748844 973 dbSNP
rs998454126 980 dbSNP
rs1467802003 984 dbSNP
rs17766675 986 dbSNP
rs1452134401 989 dbSNP
rs1200864069 993 dbSNP
rs576821852 999 dbSNP
rs1028676064 1001 dbSNP
rs889680856 1006 dbSNP
rs545476061 1008 dbSNP
rs1158934506 1018 dbSNP
rs1381775633 1019 dbSNP
rs200361074 1025 dbSNP
rs76584698 1031 dbSNP
rs565686111 1032 dbSNP
rs1000466247 1035 dbSNP
rs539498650 1037 dbSNP
rs557482787 1042 dbSNP
rs1302897737 1046 dbSNP
rs1449489421 1057 dbSNP
rs920637424 1063 dbSNP
rs1032826839 1065 dbSNP
rs958403184 1073 dbSNP
rs1391842957 1078 dbSNP
rs1360378656 1079 dbSNP
rs1176223054 1086 dbSNP
rs1044996 1087 dbSNP
rs908485850 1093 dbSNP
rs1392914652 1104 dbSNP
rs943968954 1105 dbSNP
rs575603133 1115 dbSNP
rs1193989680 1121 dbSNP
rs1335312982 1131 dbSNP
rs1240965087 1134 dbSNP
rs1257803601 1144 dbSNP
rs773820139 1145 dbSNP
rs1211723882 1146 dbSNP
rs1347359903 1157 dbSNP
rs187490359 1161 dbSNP
rs899674860 1187 dbSNP
rs1378103292 1188 dbSNP
rs1020962155 1189 dbSNP
rs1306813591 1214 dbSNP
rs970705615 1227 dbSNP
rs1390149449 1235 dbSNP
rs1245461289 1239 dbSNP
rs555200669 1241 dbSNP
rs997045305 1245 dbSNP
rs1433585461 1246 dbSNP
rs573587123 1267 dbSNP
rs1420005484 1269 dbSNP
rs1362985593 1279 dbSNP
rs778832962 1284 dbSNP
rs904253035 1288 dbSNP
rs982056578 1292 dbSNP
rs11545088 1295 dbSNP
rs764720403 1297 dbSNP
rs1485386464 1298 dbSNP
rs938267115 1304 dbSNP
rs1255575816 1305 dbSNP
rs1219059565 1309 dbSNP
rs1456984069 1311 dbSNP
rs984721175 1312 dbSNP
rs746408031 1316 dbSNP
rs1351737602 1335 dbSNP
rs192003805 1339 dbSNP
rs910041193 1341 dbSNP
rs758791078 1342 dbSNP
rs1323978653 1349 dbSNP
rs184778846 1351 dbSNP
rs960319643 1364 dbSNP
rs1178677953 1390 dbSNP
rs1413560217 1392 dbSNP
rs1353020568 1393 dbSNP
rs1299551120 1402 dbSNP
rs940134161 1403 dbSNP
rs1400194200 1411 dbSNP
rs1239668351 1420 dbSNP
rs1036783662 1435 dbSNP
rs1014499304 1439 dbSNP
rs572483186 1454 dbSNP
rs933657698 1457 dbSNP
rs1023603567 1459 dbSNP
rs1195990341 1463 dbSNP
rs1255465948 1463 dbSNP
rs970251695 1463 dbSNP
rs189204707 1464 dbSNP
rs1369426310 1474 dbSNP
rs1203699502 1476 dbSNP
rs920688099 1477 dbSNP
rs192369727 1487 dbSNP
rs747315645 1488 dbSNP
rs1000113999 1510 dbSNP
rs1033293229 1511 dbSNP
rs891638500 1514 dbSNP
rs911891137 1515 dbSNP
rs944671787 1515 dbSNP
rs1227544600 1523 dbSNP
rs1325430081 1525 dbSNP
rs563232792 1530 dbSNP
rs1447674948 1532 dbSNP
rs867114900 1538 dbSNP
rs1325033546 1541 dbSNP
rs1459782840 1542 dbSNP
rs1021014522 1551 dbSNP
rs1161605165 1551 dbSNP
rs1172845789 1552 dbSNP
rs768995912 1571 dbSNP
rs1380626666 1577 dbSNP
rs1452199345 1596 dbSNP
rs1313634860 1606 dbSNP
rs772916518 1609 dbSNP
rs1191302033 1612 dbSNP
rs1435193384 1626 dbSNP
rs748863766 1627 dbSNP
rs959922178 1638 dbSNP
rs541008847 1640 dbSNP
rs984394105 1647 dbSNP
rs796667969 1651 dbSNP
rs1195803641 1660 dbSNP
rs1199136805 1665 dbSNP
rs1052751934 1668 dbSNP
rs910084272 1674 dbSNP
rs564349154 1677 dbSNP
rs972866008 1680 dbSNP
rs1234930703 1703 dbSNP
rs1459534616 1714 dbSNP
rs531693085 1715 dbSNP
rs773688782 1722 dbSNP
rs1023234126 1724 dbSNP
rs139374009 1726 dbSNP
rs1409377806 1729 dbSNP
rs1395851354 1731 dbSNP
rs933710115 1736 dbSNP
rs544137489 1742 dbSNP
rs1166279906 1747 dbSNP
rs1479104897 1748 dbSNP
rs906078176 1754 dbSNP
rs562408736 1757 dbSNP
rs995042438 1758 dbSNP
rs1027824118 1774 dbSNP
rs950813911 1784 dbSNP
rs79364688 1788 dbSNP
rs1270237831 1789 dbSNP
rs1201708980 1805 dbSNP
rs1466632138 1807 dbSNP
rs144113586 1813 dbSNP
rs1348094988 1814 dbSNP
rs935632406 1815 dbSNP
rs1404016433 1818 dbSNP
rs966090944 1822 dbSNP
rs1469342736 1823 dbSNP
rs566229617 1825 dbSNP
rs1303709871 1826 dbSNP
rs1054382106 1829 dbSNP
rs891690932 1831 dbSNP
rs1010039221 1832 dbSNP
rs1436671512 1837 dbSNP
rs1376215119 1838 dbSNP
rs1045530454 1839 dbSNP
rs1173245281 1839 dbSNP
rs184270664 1851 dbSNP
rs1003630734 1853 dbSNP
rs1382532309 1862 dbSNP
rs551409337 1865 dbSNP
rs569319714 1870 dbSNP
rs145992224 1876 dbSNP
rs1219172104 1884 dbSNP
rs959401161 1909 dbSNP
rs1188953845 1927 dbSNP
rs1256280097 1932 dbSNP
rs1320884766 1934 dbSNP
rs370634234 1940 dbSNP
rs561953636 1941 dbSNP
rs567248913 1942 dbSNP
rs1484042733 1946 dbSNP
rs1285884423 1971 dbSNP
rs1415391234 1989 dbSNP
rs527830373 1995 dbSNP
rs961606874 2003 dbSNP
rs373757886 2005 dbSNP
rs1347213000 2010 dbSNP
rs922763172 2024 dbSNP
rs139889568 2034 dbSNP
rs376870648 2038 dbSNP
rs985235217 2043 dbSNP
rs1052805248 2044 dbSNP
rs547529362 2045 dbSNP
rs76062881 2046 dbSNP
rs189166882 2050 dbSNP
rs1416500702 2051 dbSNP
rs1185214043 2059 dbSNP
rs1489037162 2064 dbSNP
rs1242349226 2065 dbSNP
rs1360914161 2068 dbSNP
rs1445058224 2070 dbSNP
rs1451931894 2072 dbSNP
rs36099080 2083 dbSNP
rs1334117023 2088 dbSNP
rs1359675546 2091 dbSNP
rs913181369 2092 dbSNP
rs995082251 2105 dbSNP
rs602056 2108 dbSNP
rs115413537 2125 dbSNP
rs760609884 2126 dbSNP
rs1462400289 2127 dbSNP
rs1218525494 2138 dbSNP
rs549883205 2139 dbSNP
rs1429776753 2150 dbSNP
rs1005032233 2151 dbSNP
rs1185553987 2162 dbSNP
rs1474250058 2163 dbSNP
rs907050876 2165 dbSNP
rs1001733215 2170 dbSNP
rs1019043199 2177 dbSNP
rs181528676 2186 dbSNP
rs763945690 2187 dbSNP
rs1055232986 2195 dbSNP
rs1029405210 2200 dbSNP
rs895191643 2201 dbSNP
rs543884069 2202 dbSNP
rs978655644 2206 dbSNP
rs925832192 2207 dbSNP
rs562041827 2212 dbSNP
rs1016925920 2216 dbSNP
rs961661041 2218 dbSNP
rs142108370 2219 dbSNP
rs541682077 2221 dbSNP
rs1267439744 2222 dbSNP
rs988573634 2222 dbSNP
rs1464028136 2230 dbSNP
rs1029886458 2240 dbSNP
rs955569824 2250 dbSNP
rs1407816185 2261 dbSNP
rs386385870 2262 dbSNP
rs200275614 2264 dbSNP
rs35627467 2264 dbSNP
rs67346866 2265 dbSNP
rs75254343 2265 dbSNP
rs1336307719 2271 dbSNP
rs1233477286 2276 dbSNP
rs1178865678 2278 dbSNP
rs1480949048 2293 dbSNP
rs867440096 2301 dbSNP
rs1282742337 2303 dbSNP
rs1427356613 2303 dbSNP
rs1235380306 2304 dbSNP
rs1370695473 2308 dbSNP
rs1417333446 2313 dbSNP
rs570003760 2322 dbSNP
rs1381121522 2323 dbSNP
rs1393613846 2323 dbSNP
rs75458770 2324 dbSNP
rs186257967 2331 dbSNP
rs1297058010 2333 dbSNP
rs1439412714 2336 dbSNP
rs1299835137 2342 dbSNP
rs866925017 2349 dbSNP
rs912898402 2354 dbSNP
rs372000858 2367 dbSNP
rs16965097 2370 dbSNP
rs151157580 2374 dbSNP
rs930258142 2376 dbSNP
rs1419562824 2388 dbSNP
rs140117317 2389 dbSNP
rs1176621728 2397 dbSNP
rs1482111054 2401 dbSNP
rs1259764589 2409 dbSNP
rs886663620 2411 dbSNP
rs1347478952 2412 dbSNP
rs1308126646 2428 dbSNP
rs1254590842 2434 dbSNP
rs1353940790 2440 dbSNP
rs1241801073 2442 dbSNP
rs937201729 2453 dbSNP
rs111600327 2454 dbSNP
rs1317984506 2463 dbSNP
rs1306924047 2464 dbSNP
rs1222632481 2466 dbSNP
rs1356801889 2471 dbSNP
rs1313010478 2472 dbSNP
rs1413760251 2473 dbSNP
rs1056020397 2475 dbSNP
rs1005084398 2486 dbSNP
rs1222964262 2490 dbSNP
rs1363078135 2495 dbSNP
rs1156819094 2505 dbSNP
rs895255066 2511 dbSNP
rs1248948511 2512 dbSNP
rs534203711 2519 dbSNP
rs1420070422 2524 dbSNP
rs941439323 2550 dbSNP
rs1485439488 2554 dbSNP
rs1254350053 2563 dbSNP
rs1238816054 2565 dbSNP
rs1486396493 2577 dbSNP
rs566886056 2586 dbSNP
rs1441814175 2587 dbSNP
rs1161837481 2589 dbSNP
rs1411378400 2590 dbSNP
rs901965484 2591 dbSNP
rs758957668 2596 dbSNP
rs534636125 2602 dbSNP
rs1165474557 2609 dbSNP
rs16965099 2610 dbSNP
rs1293329585 2617 dbSNP
rs1463648080 2618 dbSNP
rs968022877 2623 dbSNP
rs1353121943 2626 dbSNP
rs1297266007 2633 dbSNP
rs1330115396 2634 dbSNP
rs1383937093 2637 dbSNP
rs1286938762 2638 dbSNP
rs994130430 2640 dbSNP
rs1462911404 2642 dbSNP
rs1029938868 2643 dbSNP
rs1032902831 2645 dbSNP
rs1474923461 2655 dbSNP
rs1366863016 2659 dbSNP
rs114883092 2663 dbSNP
rs1262340728 2667 dbSNP
rs1007089270 2672 dbSNP
rs1261435462 2675 dbSNP
rs1207262027 2698 dbSNP
rs76133193 2701 dbSNP
rs79701158 2703 dbSNP
rs1470184612 2708 dbSNP
rs1274370792 2711 dbSNP
rs988625845 2715 dbSNP
rs573206348 2724 dbSNP
rs1353624359 2748 dbSNP
rs1252602388 2749 dbSNP
rs917065464 2766 dbSNP
rs971223593 2769 dbSNP
rs1378973744 2771 dbSNP
rs980264008 2780 dbSNP
rs1018841642 2792 dbSNP
rs1325132253 2800 dbSNP
rs1459864661 2804 dbSNP
rs927041216 2807 dbSNP
rs1027481243 2808 dbSNP
rs538866943 2817 dbSNP
rs189148444 2822 dbSNP
rs1372746041 2823 dbSNP
rs1187009176 2849 dbSNP
rs540487247 2859 dbSNP
rs940920699 2862 dbSNP
rs1258804541 2864 dbSNP
rs1040581710 2873 dbSNP
rs1450431950 2876 dbSNP
rs989853894 2891 dbSNP
rs1019950027 2892 dbSNP
rs1195894746 2893 dbSNP
rs1338277252 2902 dbSNP
rs374238694 2905 dbSNP
rs967033166 2908 dbSNP
rs1236124392 2914 dbSNP
rs1348310404 2915 dbSNP
rs1459103449 2916 dbSNP
rs149869879 2922 dbSNP
rs548465116 2925 dbSNP
rs747510479 2926 dbSNP
rs1472365535 2939 dbSNP
rs937236515 2940 dbSNP
rs368074402 2941 dbSNP
rs902016244 2941 dbSNP
rs909030497 2946 dbSNP
rs941809168 2948 dbSNP
rs1436867067 2952 dbSNP
rs1396032697 2957 dbSNP
rs200891782 2978 dbSNP
rs866668616 2981 dbSNP
rs568265524 2987 dbSNP
rs1235115220 2991 dbSNP
rs1181814445 2993 dbSNP
rs1415628065 3001 dbSNP
rs903916959 3002 dbSNP
rs541368940 3003 dbSNP
rs1212551335 3009 dbSNP
rs1485818015 3012 dbSNP
rs560035421 3015 dbSNP
rs897221507 3024 dbSNP
rs1352684747 3033 dbSNP
rs929975133 3034 dbSNP
rs181483798 3037 dbSNP
rs891403121 3044 dbSNP
rs1416809661 3049 dbSNP
rs545222301 3056 dbSNP
rs1466718672 3058 dbSNP
rs1333855538 3060 dbSNP
rs1331864729 3068 dbSNP
rs971657811 3071 dbSNP
rs1410703683 3074 dbSNP
rs1448241022 3076 dbSNP
rs979934031 3079 dbSNP
rs1007552720 3082 dbSNP
rs1018480180 3085 dbSNP
rs116061853 3114 dbSNP
rs1485767555 3118 dbSNP
rs1256388356 3146 dbSNP
rs951757744 3150 dbSNP
rs1218584099 3151 dbSNP
rs1284769772 3152 dbSNP
rs190843323 3153 dbSNP
rs1020002448 3162 dbSNP
rs1198769163 3164 dbSNP
rs1278242793 3167 dbSNP
rs1239215250 3168 dbSNP
rs1356261424 3170 dbSNP
rs1283813162 3171 dbSNP
rs1443233714 3173 dbSNP
rs1446165377 3173 dbSNP
rs907531362 3174 dbSNP
rs548642583 3175 dbSNP
rs1457139572 3184 dbSNP
rs1387120833 3192 dbSNP
rs1238992290 3194 dbSNP
rs981095384 3195 dbSNP
rs1166399146 3197 dbSNP
rs1035760974 3211 dbSNP
rs1412532181 3221 dbSNP
rs1179745125 3225 dbSNP
rs748993660 3240 dbSNP
rs117561113 3241 dbSNP
rs570441081 3244 dbSNP
rs1463441753 3257 dbSNP
rs903967898 3263 dbSNP
rs936754646 3265 dbSNP
rs1335533339 3266 dbSNP
rs1289304377 3276 dbSNP
rs1226792540 3282 dbSNP
rs1170321613 3289 dbSNP
rs183845338 3290 dbSNP
rs1271088231 3292 dbSNP
rs1434846379 3319 dbSNP
rs1423808950 3322 dbSNP
rs1414687492 3324 dbSNP
rs1335721869 3346 dbSNP
rs1052417966 3351 dbSNP
rs541065644 3351 dbSNP
rs1462485151 3362 dbSNP
rs1348774840 3365 dbSNP
rs1399779647 3375 dbSNP
rs892470827 3384 dbSNP
rs941861556 3385 dbSNP
rs1299388702 3388 dbSNP
rs546272651 3389 dbSNP
rs1254720187 3390 dbSNP
rs571563898 3403 dbSNP
rs1194159735 3406 dbSNP
rs1468009494 3409 dbSNP
rs1246162346 3414 dbSNP
rs538536089 3417 dbSNP
rs1219495338 3423 dbSNP
rs918704811 3439 dbSNP
rs930027640 3443 dbSNP
rs1051143883 3457 dbSNP
rs1342911624 3458 dbSNP
rs1228033680 3464 dbSNP
rs1231644876 3464 dbSNP
rs1340469000 3468 dbSNP
rs912547502 3472 dbSNP
rs147755041 3478 dbSNP
rs942684623 3484 dbSNP
rs1367542128 3494 dbSNP
rs773918411 3497 dbSNP
rs745312925 3498 dbSNP
rs771698126 3499 dbSNP
rs1291227800 3532 dbSNP
rs1443743606 3534 dbSNP
rs1354676874 3537 dbSNP
rs569040734 3540 dbSNP
rs1040376556 3555 dbSNP
rs907107304 3565 dbSNP
rs57204151 3567 dbSNP
rs58470231 3568 dbSNP
rs893357153 3574 dbSNP
rs1221169121 3576 dbSNP
rs1284130484 3577 dbSNP
rs1487223600 3581 dbSNP
rs372007435 3583 dbSNP
rs1001798464 3584 dbSNP
rs1410084201 3587 dbSNP
rs779193153 3594 dbSNP
rs1263572627 3597 dbSNP
rs1034182587 3599 dbSNP
rs1422992939 3605 dbSNP
rs1189484573 3606 dbSNP
rs1481658038 3607 dbSNP
rs539448872 3608 dbSNP
rs376917957 3627 dbSNP
rs1245638563 3632 dbSNP
rs1482221616 3644 dbSNP
rs1282848233 3646 dbSNP
rs1041848984 3658 dbSNP
rs1235493084 3659 dbSNP
rs760664967 3661 dbSNP
rs1299812853 3663 dbSNP
rs537543821 3665 dbSNP
rs1373400617 3666 dbSNP
rs1378066622 3669 dbSNP
rs1035410309 3678 dbSNP
rs1313203795 3685 dbSNP
rs1465364169 3687 dbSNP
rs1357285034 3688 dbSNP
rs1159563515 3689 dbSNP
rs1159647430 3695 dbSNP
rs1419655213 3698 dbSNP
rs1014641607 3701 dbSNP
rs962032340 3701 dbSNP
rs958617888 3707 dbSNP
rs1259877095 3717 dbSNP
rs1323409900 3723 dbSNP
rs555856849 3724 dbSNP
rs1483119771 3730 dbSNP
rs1012560944 3737 dbSNP
rs1331810529 3741 dbSNP
rs975744857 3743 dbSNP
rs574039685 3746 dbSNP
rs1318080494 3756 dbSNP
rs1287106855 3757 dbSNP
rs1016608704 3758 dbSNP
rs1438696830 3760 dbSNP
rs1307395854 3764 dbSNP
rs1395155979 3770 dbSNP
rs963279118 3773 dbSNP
rs535064482 3775 dbSNP
rs1241097218 3783 dbSNP
rs1454216274 3797 dbSNP
rs1387829971 3805 dbSNP
rs919090699 3825 dbSNP
rs932232054 3829 dbSNP
rs374948231 3844 dbSNP
rs146865492 3849 dbSNP
rs987300307 3852 dbSNP
rs912611549 3853 dbSNP
rs1423500273 3859 dbSNP
rs1254460562 3862 dbSNP
rs1188681685 3869 dbSNP
rs1266588226 3876 dbSNP
rs115549994 3877 dbSNP
rs1194938924 3889 dbSNP
rs1039692465 3905 dbSNP
rs936804037 3906 dbSNP
rs1052492073 3913 dbSNP
rs1382564343 3914 dbSNP
rs1243578558 3916 dbSNP
rs1338372714 3919 dbSNP
rs914855929 3920 dbSNP
rs892524728 3941 dbSNP
rs1382573323 3951 dbSNP
rs1364273826 3966 dbSNP
rs1456700428 3973 dbSNP
rs1318442101 3974 dbSNP
rs949446477 3979 dbSNP
rs186252778 3985 dbSNP
rs1392039059 3994 dbSNP
rs907154126 4006 dbSNP
rs1366949938 4009 dbSNP
rs1407200118 4009 dbSNP
rs1001452164 4022 dbSNP
rs1376168487 4026 dbSNP
rs1034234979 4027 dbSNP
rs887612131 4038 dbSNP
rs1470255680 4043 dbSNP
rs750410265 4054 dbSNP
rs1267375769 4066 dbSNP
rs562161440 4067 dbSNP
rs903364648 4070 dbSNP
rs758324058 4081 dbSNP
rs1337384730 4082 dbSNP
rs1228775319 4089 dbSNP
rs1341160858 4100 dbSNP
rs1242302213 4103 dbSNP
rs563560318 4105 dbSNP
rs1331642059 4109 dbSNP
rs1324211426 4111 dbSNP
rs1386297413 4115 dbSNP
rs1388738535 4121 dbSNP
rs1057297484 4125 dbSNP
rs1430687460 4126 dbSNP
rs575388513 4127 dbSNP
rs961807737 4129 dbSNP
rs1167120116 4131 dbSNP
rs1215440251 4133 dbSNP
rs1255608921 4138 dbSNP
rs542326266 4142 dbSNP
rs1198946717 4150 dbSNP
rs976175416 4151 dbSNP
rs1013020923 4159 dbSNP
rs1252101376 4161 dbSNP
rs1205403749 4162 dbSNP
rs1422476731 4164 dbSNP
rs1015917494 4168 dbSNP
rs1369373944 4175 dbSNP
rs963323022 4179 dbSNP
rs561081538 4182 dbSNP
rs1345559173 4188 dbSNP
rs1274166629 4189 dbSNP
rs986351583 4191 dbSNP
rs993409715 4192 dbSNP
rs1290344949 4207 dbSNP
rs1410611691 4208 dbSNP
rs1370217579 4216 dbSNP
rs1306484211 4217 dbSNP
rs528170201 4218 dbSNP
rs1403441644 4226 dbSNP
rs954533556 4232 dbSNP
rs75912974 4235 dbSNP
rs374261217 4244 dbSNP
rs1172477124 4245 dbSNP
rs1477356183 4248 dbSNP
rs1364979831 4255 dbSNP
rs546604250 4262 dbSNP
rs564712169 4263 dbSNP
rs532465485 4264 dbSNP
rs762097008 4266 dbSNP
rs1400310630 4270 dbSNP
rs1442784829 4272 dbSNP
rs1277701482 4278 dbSNP
rs988258371 4280 dbSNP
rs1352774324 4282 dbSNP
rs200802506 4289 dbSNP
rs1229087216 4293 dbSNP
rs1350037045 4296 dbSNP
rs1286682285 4304 dbSNP
rs1450514485 4305 dbSNP
rs949495473 4313 dbSNP
rs1333949405 4326 dbSNP
rs1413226580 4329 dbSNP
rs1391476245 4335 dbSNP
rs912663599 4367 dbSNP
rs1456235156 4370 dbSNP
rs1311776161 4373 dbSNP
rs964150029 4375 dbSNP
rs1340775799 4381 dbSNP
rs926654405 4389 dbSNP
rs1276208099 4391 dbSNP
rs937971230 4392 dbSNP
rs975855205 4395 dbSNP
rs1236629553 4399 dbSNP
rs1316832863 4404 dbSNP
rs550845830 4406 dbSNP
rs887664517 4410 dbSNP
rs1208107755 4418 dbSNP
rs1198689346 4439 dbSNP
rs1328542042 4439 dbSNP
rs765318262 4442 dbSNP
rs947350993 4446 dbSNP
rs1230194584 4450 dbSNP
rs1482082968 4458 dbSNP
rs1036176994 4461 dbSNP
rs977652038 4467 dbSNP
rs1446299221 4472 dbSNP
rs569082116 4474 dbSNP
rs1257321889 4499 dbSNP
rs938866973 4505 dbSNP
rs1385777896 4510 dbSNP
rs1192209178 4520 dbSNP
rs1057281333 4529 dbSNP
rs1405549134 4540 dbSNP
rs1412624479 4542 dbSNP
rs1161179790 4544 dbSNP
rs1451079919 4547 dbSNP
rs1478219871 4548 dbSNP
rs1172657113 4551 dbSNP
rs536490836 4553 dbSNP
rs894244237 4557 dbSNP
rs1463508907 4566 dbSNP
rs953092909 4570 dbSNP
rs1223872509 4571 dbSNP
rs751365103 4574 dbSNP
rs1289414927 4577 dbSNP
rs1226886408 4584 dbSNP
rs548401587 4588 dbSNP
rs1032587613 4591 dbSNP
rs1303580545 4593 dbSNP
rs72353361 4599 dbSNP
rs868108901 4599 dbSNP
rs567772991 4602 dbSNP
rs1037409042 4605 dbSNP
rs1348849497 4607 dbSNP
rs534789725 4626 dbSNP
rs763088130 4629 dbSNP
rs553345588 4635 dbSNP
rs1390508089 4639 dbSNP
rs914065636 4640 dbSNP
rs575950625 4647 dbSNP
rs1427200618 4649 dbSNP
rs982221030 4660 dbSNP
rs1488846660 4678 dbSNP
rs993127018 4679 dbSNP
rs1219619378 4683 dbSNP
rs571521733 4688 dbSNP
rs780848891 4695 dbSNP
rs890362829 4700 dbSNP
rs538952047 4702 dbSNP
rs909152298 4704 dbSNP
rs369283573 4710 dbSNP
rs1220375089 4711 dbSNP
rs941922088 4713 dbSNP
rs638730 4725 dbSNP
rs1411235090 4726 dbSNP
rs975527327 4730 dbSNP
rs1307120766 4733 dbSNP
rs769388710 4734 dbSNP
rs752112204 4736 dbSNP
rs1176663683 4738 dbSNP
rs1214881737 4740 dbSNP
rs542864170 4741 dbSNP
rs1432571586 4753 dbSNP
rs1197400284 4754 dbSNP
rs1424484820 4754 dbSNP
rs977368997 4759 dbSNP
rs1262861559 4760 dbSNP
rs924889397 4761 dbSNP
rs1204774050 4763 dbSNP
rs1051537084 4764 dbSNP
rs1258191587 4770 dbSNP
rs938933161 4772 dbSNP
rs58207204 4775 dbSNP
rs377286027 4778 dbSNP
rs1275815620 4785 dbSNP
rs1188733368 4794 dbSNP
rs1350636235 4797 dbSNP
rs369868184 4799 dbSNP
rs1287319458 4802 dbSNP
rs1407656576 4810 dbSNP
rs1381041200 4821 dbSNP
rs1303234250 4825 dbSNP
rs1465448207 4827 dbSNP
rs1357361859 4830 dbSNP
rs1174290157 4833 dbSNP
rs1007206625 4847 dbSNP
rs1412873669 4853 dbSNP
rs1031967954 4854 dbSNP
rs554843260 4855 dbSNP
rs1432651820 4859 dbSNP
rs1177138427 4862 dbSNP
rs1397085628 4885 dbSNP
rs555635228 4887 dbSNP
rs1436409502 4899 dbSNP
rs916076810 4907 dbSNP
rs1156635616 4913 dbSNP
rs1359615166 4914 dbSNP
rs1211196021 4918 dbSNP
rs572345405 4929 dbSNP
rs948859677 4935 dbSNP
rs781571814 4938 dbSNP
rs1323175439 4939 dbSNP
rs1009782651 4944 dbSNP
rs367753945 4945 dbSNP
rs1290548124 4946 dbSNP
rs749864669 4955 dbSNP
rs867789832 4963 dbSNP
rs572929029 4977 dbSNP
rs1037461680 4981 dbSNP
rs1322455933 4981 dbSNP
rs970939500 4987 dbSNP
rs752941003 4989 dbSNP
rs982658260 5002 dbSNP
rs1364960818 5022 dbSNP
rs1385703025 5023 dbSNP
rs1301607308 5026 dbSNP
rs539915865 5027 dbSNP
rs898884085 5028 dbSNP
rs1349635115 5032 dbSNP
rs1237459624 5033 dbSNP
rs1285755888 5034 dbSNP
rs1423595447 5037 dbSNP
rs926755930 5043 dbSNP
rs1191034436 5062 dbSNP
rs756952853 5068 dbSNP
rs564919066 5069 dbSNP
rs892580293 5070 dbSNP
rs1246834137 5071 dbSNP
rs113995990 5079 dbSNP
rs1488219944 5090 dbSNP
rs1191822342 5091 dbSNP
rs1243697547 5104 dbSNP
rs778491736 5113 dbSNP
rs1299606775 5117 dbSNP
rs745498660 5117 dbSNP
rs1229009935 5121 dbSNP
rs10221234 5124 dbSNP
rs116578342 5127 dbSNP
rs1178198987 5129 dbSNP
rs1380594758 5135 dbSNP
rs1393056732 5135 dbSNP
rs1294310824 5139 dbSNP
rs1017901073 5140 dbSNP
rs1457640358 5140 dbSNP
rs900342723 5142 dbSNP
rs1450566551 5149 dbSNP
rs1379521458 5150 dbSNP
rs529994370 5162 dbSNP
rs1401070363 5168 dbSNP
rs939968580 5168 dbSNP
rs1010666220 5173 dbSNP
rs11868320 5174 dbSNP
rs1348030011 5179 dbSNP
rs190723275 5188 dbSNP
rs1276430473 5189 dbSNP
rs1457304266 5190 dbSNP
rs551845245 5193 dbSNP
rs746971578 5194 dbSNP
rs933199310 5199 dbSNP
rs1268341172 5202 dbSNP
rs1235377123 5208 dbSNP
rs533286417 5211 dbSNP
rs1052016552 5212 dbSNP
rs1302101383 5213 dbSNP
rs148970896 5215 dbSNP
rs768645900 5223 dbSNP
rs1310176927 5224 dbSNP
rs1031624414 5225 dbSNP
rs960606137 5233 dbSNP
rs993095548 5247 dbSNP
rs916112998 5248 dbSNP
rs1377645999 5250 dbSNP
rs1372461651 5252 dbSNP
rs1479220366 5263 dbSNP
rs572285705 5267 dbSNP
rs1182540647 5268 dbSNP
rs1482588434 5271 dbSNP
rs546728721 5272 dbSNP
rs1202062902 5277 dbSNP
rs867042456 5284 dbSNP
rs1009166097 5295 dbSNP
rs970262860 5299 dbSNP
rs1222998032 5311 dbSNP
rs774931254 5316 dbSNP
rs543865036 5325 dbSNP
rs571626186 5327 dbSNP
rs776495947 5333 dbSNP
rs920373991 5337 dbSNP
rs1327291973 5338 dbSNP
rs929034181 5344 dbSNP
rs1311268203 5354 dbSNP
rs1403558822 5354 dbSNP
rs906764881 5357 dbSNP
rs760008795 5361 dbSNP
rs1159416696 5364 dbSNP
rs62066652 5364 dbSNP
rs1472074266 5368 dbSNP
rs769625942 5372 dbSNP
rs1189367358 5379 dbSNP
rs1240902666 5382 dbSNP
rs529258454 5384 dbSNP
rs1350265132 5386 dbSNP
rs747366454 5386 dbSNP
rs984210983 5386 dbSNP
rs78516808 5387 dbSNP
rs1450620993 5395 dbSNP
rs944338904 5397 dbSNP
rs1198326877 5399 dbSNP
rs1046267075 5401 dbSNP
rs1470418597 5403 dbSNP
rs1282445640 5405 dbSNP
rs1336616807 5407 dbSNP
rs1486021169 5413 dbSNP
rs78606380 5427 dbSNP
rs1016989336 5432 dbSNP
rs1038965112 5434 dbSNP
rs1399688650 5438 dbSNP
rs1405359290 5445 dbSNP
rs1164692968 5449 dbSNP
rs148105880 5451 dbSNP
rs973132861 5459 dbSNP
rs1010718427 5463 dbSNP
rs1043527617 5484 dbSNP
rs904649536 5489 dbSNP
rs998892619 5491 dbSNP
rs370106162 5512 dbSNP
rs1032133243 5517 dbSNP
rs960075088 5527 dbSNP
rs1446559919 5545 dbSNP
rs1423182636 5550 dbSNP
rs1014640610 5551 dbSNP
rs569238380 5555 dbSNP
rs1282423522 5557 dbSNP
rs1230286418 5559 dbSNP
rs987358385 5561 dbSNP
rs910394177 5564 dbSNP
rs763139825 5572 dbSNP
rs766471364 5573 dbSNP
rs1053487762 5574 dbSNP
rs970276658 5580 dbSNP
rs1429395503 5593 dbSNP
rs1396102876 5606 dbSNP
rs973604575 5609 dbSNP
rs751600729 5614 dbSNP
rs893529014 5615 dbSNP
rs1364673180 5620 dbSNP
rs1161474612 5625 dbSNP
rs1451178468 5626 dbSNP
rs1390701981 5634 dbSNP
rs377626256 5636 dbSNP
rs548550812 5642 dbSNP
rs983208315 5649 dbSNP
rs1240486089 5652 dbSNP
rs1223990827 5656 dbSNP
rs1452440061 5661 dbSNP
rs1291413348 5663 dbSNP
rs1220735337 5676 dbSNP
rs1354729724 5677 dbSNP
rs1344828117 5693 dbSNP
rs1042428192 5696 dbSNP
rs1214541769 5697 dbSNP
rs1276125166 5718 dbSNP
rs1301491302 5724 dbSNP
rs1344478505 5726 dbSNP
rs906824035 5726 dbSNP
rs183382241 5731 dbSNP
rs1234501097 5733 dbSNP
rs1295653204 5734 dbSNP
rs1370986655 5739 dbSNP
rs1316189183 5740 dbSNP
rs1218069759 5742 dbSNP
rs1258743118 5743 dbSNP
rs911603631 5745 dbSNP
rs141847808 5747 dbSNP
rs746531197 5750 dbSNP
rs1417417329 5751 dbSNP
rs1004195885 5752 dbSNP
rs549682912 5755 dbSNP
rs1033895876 5756 dbSNP
rs895317360 5758 dbSNP
rs1268427652 5769 dbSNP
rs1482795816 5775 dbSNP
rs1005699027 5778 dbSNP
rs1275859664 5782 dbSNP
rs1017061083 5790 dbSNP
rs1188649941 5793 dbSNP
rs1280039802 5801 dbSNP
rs760044440 5806 dbSNP
rs767856333 5816 dbSNP
rs2946740 5826 dbSNP
rs1411334629 5830 dbSNP
rs1350834807 5849 dbSNP
rs1476581180 5851 dbSNP
rs1439848330 5864 dbSNP
rs1491126141 5864 dbSNP
rs1030071457 5865 dbSNP
rs1470341530 5865 dbSNP
rs1428730719 5870 dbSNP
rs946627331 5873 dbSNP
rs1174519492 5878 dbSNP
rs1473705769 5885 dbSNP
rs1251634876 5886 dbSNP
rs1043578436 5894 dbSNP
rs573330985 5895 dbSNP
rs902357351 5903 dbSNP
rs999279498 5912 dbSNP
rs1260737443 5916 dbSNP
rs1053220068 5923 dbSNP
rs540330471 5937 dbSNP
rs1329435910 5939 dbSNP
rs1305956230 5942 dbSNP
rs1221848376 5945 dbSNP
rs1381157971 5947 dbSNP
rs895863046 5948 dbSNP
rs910446709 5960 dbSNP
rs1451886098 5963 dbSNP
rs1014278258 5968 dbSNP
rs1359016729 5982 dbSNP
rs753238247 5990 dbSNP
rs186902098 5999 dbSNP
rs906155989 6000 dbSNP
rs1158724058 6007 dbSNP
rs995092083 6007 dbSNP
rs1027876358 6014 dbSNP
rs964527769 6035 dbSNP
rs950874790 6040 dbSNP
rs756506751 6054 dbSNP
rs1339125271 6062 dbSNP
rs1399893557 6063 dbSNP
rs1240655637 6067 dbSNP
rs775827782 6075 dbSNP
rs1270853269 6080 dbSNP
rs989258764 6085 dbSNP
rs1217752441 6089 dbSNP
rs1259781229 6104 dbSNP
rs1278178448 6105 dbSNP
rs915014524 6107 dbSNP
rs778173484 6119 dbSNP
rs750061785 6120 dbSNP
rs1245100958 6122 dbSNP
rs1380491493 6125 dbSNP
rs945117059 6127 dbSNP
rs1018720399 6131 dbSNP
rs1385815546 6138 dbSNP
rs1042089024 6139 dbSNP
rs1451930193 6149 dbSNP
rs369310423 6152 dbSNP
rs116361885 6157 dbSNP
rs1444502308 6165 dbSNP
rs1242206209 6172 dbSNP
rs974469008 6177 dbSNP
rs1383914029 6190 dbSNP
rs1191128563 6198 dbSNP
rs938988887 6202 dbSNP
rs35745363 6205 dbSNP
rs906321580 6224 dbSNP
rs192169577 6228 dbSNP
rs1202951358 6238 dbSNP
rs373249640 6240 dbSNP
rs182750487 6255 dbSNP
rs1357079922 6260 dbSNP
rs923829841 6290 dbSNP
rs897274497 6291 dbSNP
rs1175956368 6292 dbSNP
rs1327052757 6300 dbSNP
rs1294986104 6314 dbSNP
rs1380678531 6316 dbSNP
rs935182282 6319 dbSNP
rs1419643777 6322 dbSNP
rs1304046111 6336 dbSNP
rs1319545129 6338 dbSNP
rs530029168 6367 dbSNP
rs895928274 6378 dbSNP
rs1462961832 6382 dbSNP
rs150610931 6385 dbSNP
rs1190403501 6389 dbSNP
rs1017505205 6395 dbSNP
rs1269139033 6416 dbSNP
rs1434353452 6419 dbSNP
rs964579161 6432 dbSNP
rs1253737208 6445 dbSNP
rs560296190 6448 dbSNP
rs1338673321 6455 dbSNP
rs915068324 6457 dbSNP
rs1225322170 6461 dbSNP
rs1325839556 6464 dbSNP
rs1372025050 6472 dbSNP
rs1404616281 6473 dbSNP
rs1343969445 6474 dbSNP
rs764297563 6477 dbSNP
rs1044449101 6483 dbSNP
rs1236720536 6495 dbSNP
rs1282203277 6501 dbSNP
rs187777081 6502 dbSNP
rs905871438 6507 dbSNP
rs1204545343 6509 dbSNP
rs978245810 6510 dbSNP
rs2559619 6522 dbSNP
rs939026354 6525 dbSNP
rs1429425935 6526 dbSNP
rs559384945 6532 dbSNP
rs1448277410 6537 dbSNP
rs1027928565 6538 dbSNP
rs1437079655 6543 dbSNP
rs1248327472 6547 dbSNP
rs571457312 6552 dbSNP
rs1005080707 6553 dbSNP
rs1263855009 6556 dbSNP
rs916876433 6562 dbSNP
rs138150283 6570 dbSNP
rs1038600560 6572 dbSNP
rs1195053583 6574 dbSNP
rs965861270 6579 dbSNP
rs1419481269 6582 dbSNP
rs1335610666 6588 dbSNP
rs1327398520 6593 dbSNP
rs781056620 6596 dbSNP
rs1406126890 6602 dbSNP
rs547256198 6606 dbSNP
rs1467850772 6607 dbSNP
rs1413700190 6609 dbSNP
rs1158858307 6612 dbSNP
rs370552532 6616 dbSNP
rs1361900164 6625 dbSNP
rs897317582 6625 dbSNP
rs142659342 6634 dbSNP
rs1445195526 6640 dbSNP
rs1203123958 6641 dbSNP
rs923880717 6646 dbSNP
rs1286603403 6650 dbSNP
rs1205986592 6651 dbSNP
rs1051629830 6652 dbSNP
rs1278178747 6665 dbSNP
rs935230443 6666 dbSNP
rs1248725047 6672 dbSNP
rs1384201223 6673 dbSNP
rs1323006340 6679 dbSNP
rs891198829 6682 dbSNP
rs1006868205 6703 dbSNP
rs769526250 6704 dbSNP
rs1346498688 6711 dbSNP
rs1395220942 6726 dbSNP
rs1399778641 6734 dbSNP
rs992046759 6736 dbSNP
rs1018226531 6740 dbSNP
rs1445102014 6742 dbSNP
rs964631654 6745 dbSNP
rs917747528 6750 dbSNP
rs1374438525 6755 dbSNP
rs947880796 6761 dbSNP
rs1194121632 6764 dbSNP
rs1060636 6766 dbSNP
rs966961674 6768 dbSNP
rs1225167592 6772 dbSNP
rs905923729 6776 dbSNP
rs1291656045 6783 dbSNP
rs1244487084 6786 dbSNP
rs930655725 6794 dbSNP
rs776604333 6799 dbSNP
rs1352790608 6806 dbSNP
rs1363392620 6821 dbSNP
rs1270300164 6831 dbSNP
rs1429505733 6835 dbSNP
rs1049077765 6836 dbSNP
rs886725866 6837 dbSNP
rs1425061093 6849 dbSNP
rs1364775709 6852 dbSNP
rs1161571415 6865 dbSNP
rs749544565 6866 dbSNP
rs146011386 6867 dbSNP
rs1421659838 6873 dbSNP
rs1168585259 6878 dbSNP
rs1475160008 6880 dbSNP
rs1040591034 6892 dbSNP
rs1201919126 6896 dbSNP
rs916257551 6903 dbSNP
rs193301417 6904 dbSNP
rs1309784163 6909 dbSNP
rs974342752 6914 dbSNP
rs1213459470 6920 dbSNP
rs1235940107 6922 dbSNP
rs539167101 6923 dbSNP
rs1344582169 6927 dbSNP
rs534173820 6931 dbSNP
rs774429445 6934 dbSNP
rs1444228300 6936 dbSNP
rs1355025704 6958 dbSNP
rs1169736715 6959 dbSNP
rs1409423888 6966 dbSNP
rs1051256739 6970 dbSNP
rs1421643557 6970 dbSNP
rs1428945276 6970 dbSNP
rs200447302 6970 dbSNP
rs891243593 6970 dbSNP
rs967751978 6971 dbSNP
rs942777876 6993 dbSNP
rs1481855441 7014 dbSNP
rs1365867277 7016 dbSNP
rs759674572 7018 dbSNP
rs1233959238 7025 dbSNP
rs1039726503 7031 dbSNP
rs1472097455 7033 dbSNP
rs767634393 7040 dbSNP
rs956363066 7051 dbSNP
rs992495811 7068 dbSNP
rs1022646418 7071 dbSNP
rs1322419701 7074 dbSNP
rs1281048304 7079 dbSNP
rs1225254900 7092 dbSNP
rs1163124997 7103 dbSNP
rs1373837435 7110 dbSNP
rs1418738249 7115 dbSNP
rs1463073462 7116 dbSNP
rs898852676 7125 dbSNP
rs185490937 7127 dbSNP
rs1398155404 7131 dbSNP
rs189559932 7146 dbSNP
rs1034853119 7161 dbSNP
rs1405602650 7166 dbSNP
rs1306936744 7168 dbSNP
rs537904383 7174 dbSNP
rs927390717 7178 dbSNP
rs1421214745 7183 dbSNP
rs990572104 7185 dbSNP
rs1244385597 7191 dbSNP
rs556175476 7191 dbSNP
rs962385019 7191 dbSNP
rs930708027 7193 dbSNP
rs1203739644 7209 dbSNP
rs1329303636 7213 dbSNP
rs1460541513 7214 dbSNP
rs1253854625 7226 dbSNP
rs1049130358 7227 dbSNP
rs769619893 7228 dbSNP
rs907869614 7236 dbSNP
rs973754052 7242 dbSNP
rs550484044 7244 dbSNP
rs1384920312 7245 dbSNP
rs761191632 7247 dbSNP
rs1041037712 7248 dbSNP
rs1405486530 7248 dbSNP
rs902068407 7250 dbSNP
rs996770706 7251 dbSNP
rs1301293820 7261 dbSNP
rs1455559674 7262 dbSNP
rs1292598717 7264 dbSNP
rs1334966576 7267 dbSNP